REGISTER now for FREE 
|
FREE patent keyword monitoring and additional FREE benefits. REGISTER now for FREE
|
|
|
Drug, Bio-affecting And Body Treating Compositions > Designated Organic Active Ingredient Containing (doai) > Cyclopentanohydrophenanthrene Ring System Doai > With Additional Active Ingredient With Additional Active IngredientWith Additional Active Ingredient patent applications listed are from June 2005 to current and include Date, Patent Application Number, Patent Title, Patent Abstract summary and are linked to the corresponding patent application page.02/01/07 - 20070027127 - Treatment of inflammatory oral diseases with a combination of inhibitors of tnf-alpha and immunosuppressive agents The invention provides methods for treating inflammatory oral diseases, involving administration of combinations of inhibitors of TNF-α and immunosuppressive agents. ... 02/01/07 - 20070027126 - Cyanopyrrole-sulfonamide progesterone receptor modulators and uses thereof wherein R1, R2, R3, R4, R5, R6 and R7 are as defined herein, are useful for contraception and hormone replacement therapy are described. Also provided are products containing these compounds. ... 02/01/07 - 20070027125 - Cyanopyrrole-phenyl progesterone receptor modulators and uses thereof wherein R1, R2, R3, R4, R5, R6, and R7 are as defined herein. These compounds are useful for contraception and hormone replacement therapy. Also provided are products containing these compounds. ... 01/11/07 - 20070010502 - Methods and reagents for the treatment of immunoinflammatory disorders The invention features a method for treating a patient diagnosed with, or at risk of developing, an immunoinflammatory disorder by administering to the patient a tetra-substituted pyrimidopyrimidine, either alone or in combination with one or more additional agents. The invention also features a composition containing a tetra-substituted pyrimidopyrimidine in combination ... 01/11/07 - 20070010501 - Skin treatments Compositions comprising an LXR activator and retinoic acid and/or a metabolic precursor thereto are useful in reducing the effects of chronoageing and/or photoageing of the skin. ... 01/04/07 - 20070004691 - Antitumoral combinations containing et-743 and a cruciferous and a cruciferous indole compound Administration of a cruciferous indole compound can reduce undesirable toxic side effects inherent in the anti-tumor therapy with ET-743 before during or after administration of the ET-743. ... 12/28/06 - 20060293295 - Pharmaceutical composition comprising progestogens and/or estrogens and 5-methyl- (6s)-tetrahydrofolate The present invention relates to a pharmaceutical composition which may comprise progestogens, preferably drospirenone, estrogens, preferably ethinylestradiol and 5-methyl-(6S)-tetrahydrofolate, which may be employed as oral contraceptive and moreover prevents disorders caused by folate deficiency in the consumers, in particular cardiovascular disorders and, after conception of the embryo, congenital malformations caused ... 12/28/06 - 20060293294 - Method for treatment or prevention of androgen deficiency This invention relates to a method for the treatment or prevention of androgen deficiency in a male individual by administering to the individual an effective amount of a selective estrogen receptor modulator, or an isomer, isomer mixture, metabolite or a pharmaceutically acceptable salt thereof. Furthermore, the invention concerns methods for ... 12/28/06 - 20060293293 - Salmeterol and ciclesonide combination The invention relates to pharmaceutical compositions containing combinations of salmeterol and ciclesonide and the use of such pharmaceutical compositions in medicine, in particular, the prophylaxis and treatment of respiratory disease. ... 12/21/06 - 20060287286 - Phenethanolamine derivatives for treatment of respiratory diseases The present invention relates to novel compounds of Formula (I), to a process for their manufacture, to pharmaceutical compositions containing them, and to their use in therapy, in particular their use in the prophylaxis and treatment of respiratory diseases. ... 12/14/06 - 20060281723 - Folic acid-containing pharmaceutical compositions, and related methods and delivery systems This invention provides folic acid-containing pharmaceutical compositions comprising either an oral contraceptive or a hormone replacement composition. This invention also provides methods of administering folic acid to a subject using the instant pharmaceutical compositions. Finally, this invention provides a drug delivery system useful for administering the instant pharmaceutical compositions. ... 12/14/06 - 20060281722 - Compounds and uses thereof The invention features charge-modified antidepressants and compounds conjugated to either a charged group or a bulky group in a manner that resists in vivo cleavage. The invention provides a method for treating a patient having an inflammatory disease by administering to the patient a compound of the invention. ... 12/07/06 - 20060276441 - Medicaments comprising steroids and a novel anticholinergic (b) a steroid 2, processes for preparing such pharmaceutical composition, and their use in the treatment of respiratory complaints. ... 11/30/06 - 20060270643 - Hyfroxyflutamide induced pathways related to androgen receptor negative prostate cancer cells Disclosed are compositions and methods for reducing androgen receptor dependent cancer cell proliferation. ... 11/16/06 - 20060258631 - Methods of using fatty-acid esters of estrogens and serotonin reuptake inhibiting compounds for reducing the body weight of a mammal and compositions containing the same Compositions and methods for reducing the body weight of a mammal are disclosed. The invention is directed to methods for reducing the body weight in a mammal comprising administering therapeutically effective amounts of a fatty-acid ester of an estrogen or estrogen derivative and a fatty-acid, and a serotonin reuptake-inhibiting compound. ... 11/09/06 - 20060252736 - Process for producing unsaturated fatty acid-containing oils An edible oil obtained by culturing a microorganism belong to the genus Mortierella subgenus Mortierella in a medium containing a nitrogen source derived from soybean is discussed. The oils obtained have a low 24,25-methylenecholest-5-en-3β-ol content. ... 11/09/06 - 20060252735 - Treatment of graft-versus-host disease and leukemia with beclomethasone dipropionate and prednisone A method for reducing mortality associated with GVHD by treating the patent with an oral BDP regimen that involves co-administration of: 1) a high dose of prednisone (about 1-2 mg/kg/day) for about 10 days, which is then tapered rapidly over the following 7 days to a physiological replacement dose of ... 11/02/06 - 20060247218 - Treatment of congestion using steroids and adrenergics A decongestant composition is provided comprising: (a) a safe and effective amount of an adrenergic compound; (b) a safe and effective amount of a steroid; and (c) a pharmaceutically-acceptable carrier. Methods of treating congestion in a human or animal subject are also provided comprising administering to the subject a composition ... 10/19/06 - 20060234991 - Combinations for the treatment of immunoinflammatory disorders The invention features pharmaceutical compositions that include dipyridamole and a corticosteroid. ... 10/12/06 - 20060229283 - Cholesterol as an antibiotic for streptococcus pneumoniae Topical application of cholesterol has been found to be effective in preventing, treating or ameliorating the damage to the cornea caused by Streptococcus pneumoniae. Topical administration of cholesterol caused a significant decrease in the inflammation of the eye. In addition, cholesterol was surprisingly found to be a bactericide to Streptococcus ... 10/05/06 - 20060223788 - Analgesic composition for topical use An analgesic composition, is disclosed which comprises a mixture of piroxicam, dexamethasone, ketamine, lidocaine injection, dimethyl sulfoxide, gabapentin and Vanicream™, preferably in the form of a cream or ointment. The composition is applied topically for the relief of pain of arthritis, neuropathy, post-herpetic (shingles) conditions, sore muscles, tendons and ligaments, ... 09/28/06 - 20060217356 - Nutritional supplement for lowering serum triglyceride and cholesterol levels Triglycerides and cholesterol in the bloodstream are important factors in the development in the development of cardiovascular disease. The present invention discloses a nutritional supplement comprising a sterol and an omega-3 fatty acid, or an ester thereof, for lowering cholesterol and triglyceride levels in the bloodstream of a subject. Preferably, ... 09/28/06 - 20060217355 - Co-administration of dehydroepiandrosterone (dhea) congeners and other active agents for treating cancer The present invention is related to therapeutic uses of dehydroepiandrosterone (DHEA) congeners. More specifically, the present invention relates to the co-administration of a dehydroepiandrosterone (DHEA) congener in combination with at least one other pharmaceutically active agent to treat or prevent cancer. ... 09/21/06 - 20060211666 - 2-phenyl-1-[4-(2-aminoethoxy)-benzyl]-indole and estrogen formulations The present invention relates to new formulations containing one or more estrogens and 2-Phenyl-1-[4-(2-Aminoethoxy)-Benzyl]-Indole compounds which are useful as estrogenic agents, as well as pharmaceutical compositions and methods of treatment utilizing these compounds, which have the general structures below: ... 09/21/06 - 20060211665 - Reduction of postoperative pain medication A procedure for reducing the pain from orthopedic surgery, such as hip or knee replacement by injecting a mixture of components into the site of trauma (surgical incision or tissue twisting/stretching) before closing the wound. The mixture includes a local anesthetic agent, epinephrine, morphine and a corticosteroid. ... 09/21/06 - 20060211664 - Method for treating erectile dysfunction and increasing libido in men The present invention relates to a transdermal hydroalcoholic testosterone gel formulation that overcomes the problems associated with other testosterone delivery mechanisms by providing, among other things, a desirable pharmacokinetic hormone profile with little or no skin irritation. In addition, the gel is used in conjunction with pharmaceuticals aimed at treating ... 09/14/06 - 20060205703 - Stabilized steroid composition and method for its preparation Stabilized, 17-substituted hydrocortisone containing compositions and methods of manufacture are disclosed. Isomerization of the hydrocortisone component of topical steroid compositions is markedly reduced by including an omega-6 acid component in the form of a free acid or as a compound such as an ester. Specifically disclosed are methods for preventing ... 09/14/06 - 20060205702 - Combinations comprising antimuscarinic agents and corticosteroids Combinations comprising (a) a corticosteroid and (b) an antagonist of M3 muscarinic receptors which is 3(R)-(2-hydroxy-2,2-dithien-2-ylacetoxy)-1-(3-phenoxypropyl)-1-azoniabicyclo[2.2.2]octane, in the form of a salt having an anion X, which is a pharmaceutically acceptable anion of a mono or polyvalent acid are useful, e.g., for treatment of respiratory disease, e.g., asthma or chronic ... 09/07/06 - 20060199789 - Medical composition The present invention provides a pharmaceutical composition, which comprises 7-[2-(3,5-dichloro-4-pyridyl)-1-oxoethyl]-4-methoxy-spiro[1,3-benzodioxol-2,1′-cyclopentane] or a pharmaceutically acceptable salt thereof and a steroid agent; an agent for treating and/or preventing a pulmonary disease; the agent which comprises 7-[2-(3,5-dichloro-4-pyridyl)-1-oxoethyl]-4-methoxy-spiro[1,3-benzodioxol-2,1′-cyclopentane] or a pharmaceutically acceptable salt thereof and a steroid agent which are simultaneously or separately with ... 08/24/06 - 20060189588 - Process for producing unsaturated fatty acid-containing oils An edible oil obtained by culturing a microorganism belong to the genus Mortierella subgenus Mortierella in a medium containing a nitrogen source derived from soybean is discussed. The oils obtained have a low 24,25-methylenecholest-5-en-3β-ol content. ... 08/24/06 - 20060189587 - Use for budesonide and formoterol The invention provides the use of formoterol and budesonide in the treatment of chronic obstructive pulmonary disease. ... 08/17/06 - 20060183726 - Pharmaceutical compositions based on anticholinergics and etiprednol The present invention relates to novel pharmaceutical compositions based on anticholinergics and etiprednol, processes for preparing them and their use in the treatment of respiratory diseases. ... 07/13/06 - 20060154908 - Co-administration of dehydroepiandrosterone (dhea) congeners and other active agents for treating depression The present invention is drawn to compositions and methods for treating depression in a subject comprising co-administering therapeutically effective amounts of a DHEA congener and a second antidepressant agent to the subject, wherein the step of co-administrating is more effective in producing an anti-depressive effect compared to the administration of ... 07/06/06 - 20060148772 - Combination The present invention provides a combination for the treatment of a disease or condition which responds to dual EGFR and VEGF protein tyrosine kinase inhibition and either aromatase inhibition or inhibition of estrogen action, in particular a proliferative disease, especially a malignant disease, such as breast cancer, comprising a dual ... 07/06/06 - 20060148771 - Medicinal compounds A compound of formula (I) or a salt, solvate, or physiologically functional derivative thereof, wherein: m is an integer of from 2 to 8; n is an integer of from 2 to 5; with the proviso that m+n is 4 to 10; R4 and R5 are independently selected from hydrogen ... 07/06/06 - 20060148770 - Combinations for the treatment of rheumatoid arithritis The invention features a method for treating a patient diagnosed with rheumatoid arthitis by systemically administering an azole and a steroid to the patient. The invention also features a pharmaceutical composition containing an azole and a steroid for the treatment of rheumatoid arthritis. ... 06/22/06 - 20060135497 - Combination therapy for treating heart disease A combination therapy and co-therapy method for administering therapeutic doses of an aldosterone antagonist agent and a metolazone-related compound to a subject in need of treatment for hypertension, congestive heart failure, and chronic kidney disease are provided. A pharmaceutical composition comprising these therapeutic agents is also provided. ... 06/08/06 - 20060122160 - Co-administration of dehydroepiandrosterone (dhea) congener with parthenolide for treating inflammation The present invention is related to therapeutic uses of dehydroepiandrosterone (DHEA) congeners. More specifically, the present invention relates to the co-administration of a dehydroepiandrosterone (DHEA) congener in combination with a parthenolide to reduce inflammation. ... 06/08/06 - 20060122159 - Pharmaceutical formulation Disclosed are novel formulations for the treatment of otic infections in an animal comprising a triazole anti-fungal compound, a quinolone antibiotic and a corticosteroid such as mometasone furoate monohydrate. ... 05/11/06 - 20060100183 - Therapeutic agents targeting the ncca-atp channel and methods of use thereof The present invention is directed to therapeutic compositions targeting the NCCa-ATP channel of an astrocyte, neuron or capillary endothelial cell and methods of using same. More specifically, antagonists of the NCCa-ATP channel are contemplated. The compositions are used to prevent cell death and to treat secondary damage associated with spinal ... 05/11/06 - 20060100182 - pharmaceutical compositions for the treatment of urinary incontinence Pharmaceutical compositions for the treatment of urinary incontinence with a cholinergic and musulotropic substance, combined or not combined with a little resorbed estrogen agent, by local route, wherein the cholinergic and musculotropic substance is oxybutynin, or one of its salts, and the little resorbed estrogen agent is chosen from estriol, ... 05/11/06 - 20060100181 - Combinations for the treatment of inflammatory skin disorders The invention features methods and compositions for the treatment of inflammatory skin conditions. ... 05/04/06 - 20060094699 - Combination therapy using an 11beta-hydroxysteroid dehydrogenase type 1 inhibitor and a glucocorticoid receptor agonist to minimize the side effects associated with glucocorticoid receptor agonist therapy Combination therapy comprising the administration of an 11β-hydroxysteroid dehydrogenase type 1 inhibitor and a glucocorticoid receptor agonist for treating some forms of cancer, diseases and disorders having inflammation as a component, and to minimize the side effects associated with glucorticoid receptor agonist therapy. ... 04/20/06 - 20060084636 - Methods of using fatty-acid esters of estrogens and serotonin reuptake inhibiting compounds for reducing the body weight of a mammal and compositions containing the same Compositions and methods for reducing the body weight of a mammal are disclosed. The invention is directed to methods for reducing the body weight in a mammal comprising administering therapeutically effective amounts of a fatty-acid ester of an estrogen or estrogen derivative and a fatty-acid, and a serotonin reuptake-inhibiting compound. ... 04/06/06 - 20060074058 - Combination of dpp iv inhibitor and a cardiovascular compound The present invention relates to a combination, such as a combined preparation or pharmaceutical composition, respectively, comprising of a DPP IV inhibitor or a pharmaceutically acceptable salt thereof and a cardiovascular compound (being different from a statin) or a pharmaceutically acceptable salt thereof. The present invention furthermore relates to the ... 03/30/06 - 20060069075 - Methods for treating dry eye Methods of treating dry eye by administering fixed combinations of MUC-1 secretagogues, such as HETE derivatives, and anti-inflammatory steroids are disclosed. ... 03/30/06 - 20060069074 - Genetic predictor of efficacy of anti-asthmatic agents for improving pulmonary function The present invention relates to methods for determining and predicting the efficacy of therapeutics for the treatment of an individual with asthma based on that individual's β2-adrenergic receptor. The invention finds particular applicability to the treatment of an individual with asthma with an inhaled corticosteroid or a leukotriene receptor antagonist ... 03/30/06 - 20060069073 - Medicaments for inhalation comprising steroids and an anticholinergic The present invention relates to novel pharmaceutical compositions based on steroids and salts of an anticholinergic, processes for preparing them and their use in the treatment of respiratory complaints. ... 03/30/06 - 20060069072 - Method of male sexual enhancement A method of sexual enhancement in men includes the steps of testing the blood of the man to determine the levels of free estradiol and free testosterone therein, assuring that the man's blood includes free estradiol within a first predetermined range and free testosterone within a second predetermined range, and ... 03/16/06 - 20060058273 - Mastitis treatment A pharmaceutical composition for intramammary administration to a nonhuman mammal comprising an antibacterial agent and prednisolone, wherein the composition comprises at least 20 mg of prednisolone, and its use for the treatment of clinical mastitis. ... 03/09/06 - 20060052352 - Mixtures or organic compounds for the treatment of airway diseases A medicament comprising, separately or together, (A) a compound of formula (I) in free or pharmaceutically acceptable salt or solvate form and (B) a corticosteroid, for simultaneous, sequential or separate administration in the treatment of an inflammatory or obstructive airways disease, the molar ratio of (A) to (B) being from ... 03/09/06 - 20060052351 - Oils enriched with diacylglycerols and phytosterol esters for use in the reduction of blood cholestrol and triglycerides and oxidative stress Disclosed is the use of a composition comprising a combination of diacylglycerol(s) (DAG), mainly 1,3-diacylglycerol(s), and phytosterol and/or phytostanol ester(s) (PSE) dissolved or dispersed in edible oil and/or edible fat, particularly olive, canola and fish oil, in the manufacture of nutritional supplements and orally administrable pharmaceutical preparations which are capable ... 02/16/06 - 20060035877 - Method and compositions for treating pulmonary diseases This invention relates to treating pulmonary diseases such as chronic obstructive pulmonary disease or asthma by administering a phosphodiesterase 4 inhibitor in combination with anti-inflammatory corticosteriod. ... 02/16/06 - 20060035876 - Combination therapy of an sodm and a corticosteroid for prevention and/or treatment of inflammatory bone or joint disease The present invention relates to pharmaceutical compositions and methods of using such compositions for the treatment of inflammatory diseases of the bone and joints. The compositions comprise a catalyst for the dismutation of superoxide, which is a non-proteinaceous mimetic of superoxide dismutase, in combination with a corticosteroid. The combination is ... 02/16/06 - 20060035875 - Remedy for hormone-dependent cancer A therapeutic agent for a hormone-dependent cancer, which comprises (a) a steroid-sulfatase inhibitor and (b) an agent for hormone therapy and/or an agent for chemotherapy, which may be administered together or separately at an interval, is provided. A method for treating a hormone-dependent cancer, which comprises administering (a) a steroid-sulfatase ... 02/16/06 - 20060035874 - Pharmaceutical products and composition comprising specific anticholinergic agents, beta-2 agonists and corticosteroids This invention relates to pharmaceutical products and compositions for use in the treatment of asthma and related disorders, and especially but not exclusively for the treatment of chronic obstructive pulmonary disease (COPD). More particularly, the invention provides pharmaceutical products and compositions comprising specific anticholinergic agents, β-2 agonists and corticosteroids. ... 02/16/06 - 20060035873 - Methods for inducing apolipoprotein e secretion The invention provides a method for increasing apolipoprotein E (ApoE) in plasma and in tissues of a mammal by using a combination of an ApoE increasing amount of an activator of the orphan nuclear receptor FXR and an ApoE increasing amount of an activator of the orphan nuclear receptor LXRα. ... 02/09/06 - 20060030550 - Pharmaceutical formulations Disclosed are medicaments containing, separately or together, (A) Pleconaril or a pharmaceutically acceptable salt thereof and (B) a pharmaceutically active agent for simultaneous, sequential or separate administration in the treatment of a viral infection and/or other disease states and the symptoms associated therewith. ... 02/02/06 - 20060025392 - Combination medicament The invention relates to the combination of ciclesonide with formoterol. ... 02/02/06 - 20060025391 - Combination of azelastine and steroids A pharmaceutical product or formulation, which comprises azelastine or a pharmaceutically acceptable salt, solvate or physiologically functional derivative thereof, and a steroid, or a pharmaceutically acceptable salt, solvate or physiologically functional derivative thereof, preferably the product or formulation being in a form suitable for nasal or ocular administration. ... 01/26/06 - 20060019935 - Composition and method for treating acne including anti-inflammatory hepes oleate The present invention is directed toward a topical composition for the treatment of acne comprising water, an anti-acne agent such as benzoyl peroxide, thickening agent, emulsifiers, stabilizers, and a natural esterified anti-inflammatory (Hepes Oleate). This combined therapy is more effective than either active ingredient alone and is particularly effective for ... 01/12/06 - 20060009431 - Nitrosated and nitrosylated compounds, compositions and methods use The invention describes novel nitrosated and/or nitrosylated compounds of the invention, and pharmaceutically acceptable salts thereof, and novel compositions comprising at least one nitrosated and/or nitrosylated compound of the invention, and, optionally, at least one nitric oxide donor compound and/or at least one therapeutic agent. The invention also provides novel ... 01/12/06 - 20060009430 - Composition for the prevention and treatment of the detrimental effects of dihydrotestosterone The composition of the invention relates generally to a nutritional supplement, which is capable of ameliorating the biologically detrimental effects of dihydrotestosterone (DHT). The present composition comprises a combination of natural plant-derived extracts, and minerals including Saw palmetto berry extract; pumpkin seed (Curcubito pepo) extract; beta-sitosterol; quercetin; Polygonum multiflorum root ... 01/12/06 - 20060009429 - Antiandrogen oligonucleotides usable for the treatment of dermatological androgen-related disorders relating to androgen metabolism, their pharmaceutical compositions, their uses and treatment method These anti-androgenic active principles are specific to reach their molecular target, which is circumscribed to the site of application. The oligonucleotides described inhibit the androgen receptor (AR) expression at very low concentrations in skin and hair follicle primary cell cultures, through a mechanism implying the reaching of, and the hibridizing ... // - 5′ GCC GCC ACC ACC CCC ACC 3′ - ... // - 5′ CCA CCA CCA CCA CAC GG 3′ - ... // - 5′ TGG CGC ACA GGT ACT TCT 3′ - ... // - 5′ GGCGAAGTAGAGCATCCT 3′ - ... // - 5′ CACACGGTCCATACAACTGG 3′ - ... // - 5′ GGCCTTCTTCGGCTGTGAAG 3′ - ... // - 5′ CAATCATTTCTGCTGGCG 3′ - ... // - 5′ CATTGGTGAAGGATCGCC 3′ - ... 01/05/06 - 20060003975 - Combination of an aldosterone receptor antagonist and an hmg coa reductase inhibitor Novel methods and combinations for the treatment and/or prophylaxis of a pathologic condition in a subject, wherein the methods comprise the administration of one or more HMG Co-A reductase inhibitors and one or more aldosterone receptor antagonists, and the combinations comprise one or more HMG Co-A reductase inhibitors and one ... 12/29/05 - 20050288266 - Combinations comprising antimuscarinic agents and corticosteroids Combinations comprising (a) a corticosteroid and (b) an antagonist of M3 muscarinic receptors which is 3(R)-(2-hydroxy-2,2-dithien-2-ylacetoxy)-1-(3-phenoxypropyl)-1-azoniabicyclo[2.2.2]octane, in the form of a salt having an anion X, which is a pharmaceutically acceptable anion of a mono or polyvalent acid are useful, e.g., for treatment of respiratory disease, e.g., asthma or chronic ... 12/29/05 - 20050288265 - Novel combination of glucocorticoids and pde-4 inhibitors for treating respiratory diseases, allegic diseases, asthma and copd The invention relates to a novel combination of a glucocorticoid, especially loteprednol, and at least one phospho-diesterase-4 inhibitor (PDE-4-inhibitor), especially hydroxyindole-derivative N-(3,5-dichloropyridine-4-yl)-2-[1-(4-fluorbenzyl)-5-hydroxyindole-3-yl]-2-oxoacetamide, for a simultaneous, sequential or separate administration in the treatment of respiratory diseases, allergic diseases, asthma and chronic obstructive pulmonary diseases (COPD). ... 12/01/05 - 20050267085 - Combined therapy for the treatment of parkinson's disease The present invention concerns a method and a pharmaceutical composition for treating the symptoms associated to Parkinson's disease. The method and the pharmaceutical composition use a combination of a therapeutically effective amount of at least one of DHEA or DHEA-S in combination with a therapeutically effective amount of a dopamine ... 11/24/05 - 20050261260 - Combination of a cdk inhibitor and mitoxantrone A first aspect of the invention relates to a combination comprising a CDK inhibitor and mitoxantrone. A second aspect of the invention relates to a pharmaceutical product comprising a CDK inhibitor and mitoxantrone as a combined preparation for simultaneous, sequential or separate use in therapy. A third aspect of the ... 11/10/05 - 20050250748 - Combination therapy of angiotensin converting enzyme inhibitor and eplerenone for treatment of cardiovascular disease Combinations of an ACE inhibitor and an epoxy-steroidal aldosterone receptor antagonist are described for use in treatment of circulatory disorders. Of particular interest are therapies using epoxy-steroidal-type aldosterone receptor antagonist compounds, such as eplerenone, in combination with an angiotensin converting enzyme inhibitor. This co-therapy would be particularly useful to treat ... 11/03/05 - 20050245494 - Methods to treat one or all of the defined etiologies of female sexual dysfunction The U.S. Food and Drug Administration defines the four separate components of Female Sexual Dysfunction (FSD) to be decreased sexual desire, decreased sexual arousal, dyspareunia (pain with intercourse), and persistent difficulty in achieving or inability to achieve orgasm (anorgasmia). To establish a diagnosis of FSD, these components must be associated ... 11/03/05 - 20050245493 - Use of the combination of ciclesonide and antihistamines for the treatment of allergic rhinitis The present invention relates to a combination of ciclesonide with antihistamines. ... 10/27/05 - 20050239759 - Method of treatment of disease using an adenosine a1 receptor antagonist and an aldosterone inhibitor Pharmaceutical compositions comprising an aldosterone inhibitor and an adenosine A1 receptor antagonist (AA1RA) and methods of treating cardiovascular disease comprising identifying a patient in need of such treatment, and administering a pharmaceutical composition disclosed herein to said patient are disclosed. ... 10/20/05 - 20050234026 - Method and agent for inducing apoptosis/cell death in leukemia cells A method for inducing apoptosis or cell death in leukemia cells includes inhibiting the production of nitric oxide (NO) by using a nitric oxide synthase (NOS) inhibitor, or the actions of NO by a NO quencher/scavenger. The NOS inhibitor includes a NOS1-specific inhibitor, such as N-[4-(2-{[(3-chlorophenyl)methyl]amino}ethyl)phenyl]-2-thiophenecarboximide dihydrochloride, [N5-(1-imino-3-butenyl)-L-ornithine], 7-nitroindazole, or ... 10/20/05 - 20050234025 - Compositions comprising one or more policosanols and/or policosanoic acids combined with sterol and/or steroid based ascorbic acid derivatives, and uses thereof A composition comprises one or more long chain alcohols (policosanols) and/or their respective acids (policosanoic acids) and one or more ascorbic acid derivatives, including all biologically acceptable salts or solvates or prodrugs of at least one such derivative or of the salts or of the solvates thereof and is used ... 10/20/05 - 20050234024 - Materials and methods for the treatment of ulcerative colitis The present invention provides materials and methods for the treatment of inflammatory bowel disease, such as ulcerative colitis, by administering to a patient a nicotine composition comprising an anti-depressant in an amount effective to alleviate symptoms of the disease. ... 10/06/05 - 20050222103 - Airway alkalinization as therapy for airway diseases The present invention relates to a method of treating asthma by raising the pH of the airways of an individual. The effect can be mediated directly by administering a pharmaceutically acceptable basic solution or alternatively, the effect can be mediated by enhancing the activity of glutaminase. ... 10/06/05 - 20050222102 - Treatment of rhinitis with anticholinergics alone or in combination with antihistamines, phosphodiesterase 4 inhibitors, or corticosteroids The present invention provides novel combinations comprising a topical anticholinergic drug alone or in combination with topically administered antihistamines, topically or orally administered phosphodiesterase 4 inhibitors or topical corticosteroids for the treatment of rhinitis of various origins. It further comprises presentation of these combinations in locally applied formulations and includes ... 10/06/05 - 20050222101 - Method and composition for treatment of skin conditions A method for treating dermatological conditions as eczema, seborrheic dermatitis, psoriasis and allergic skin reactions such as hives, skin irritations, poison ivy, poison oak, and the like. The method involves applying to the affected area of the skin a few drops of a combination of pheniramine maleate and either naphazoline ... 10/06/05 - 20050222100 - Treatment of post-menopausal complaints in breast cancer patients comprising tibolone and a serm The subject invention provides a use of tibolone and a SERM for the manufacture of a medicine for the treatment of an estrogen-deficiency related complaint and for the prevention of a recurrence of breast cancer in females suffering from, or at risk for breast cancer that exhibit the estrogen-deficiency related ... 09/29/05 - 20050215537 - Epoxy-steroidal aldosterone antagonist and beta-adrenergic antagonist combination therapy for treatment of congestive heart failure A combination therapy comprising a therapeutically-effective amount of an epoxy-steroidal aldosterone receptor antagonist and a therapeutically-effective amount of a beta-adrenergic antagonist is described for treatment of circulatory disorders, including cardiovascular disorders such as hypertension, congestive heart failure, cirrhosis and ascites. Preferred beta-adrenergic antagonists are those compounds having high potency and ... 09/22/05 - 20050209205 - Enhancement of anti-androgenic activity by a combination of inhibitors targeting different steps of a steroid-dependent gene activation pathway and uses thereof The present invention includes novel methods and compositions for inhibiting or reducing steroid-dependent gene activation including the administration of at least two compounds that act different steps within a steroid receptor gene activation pathway. Preferred methods may include administering a first compound able to induce degradation of a steroid receptor ... 09/22/05 - 20050209204 - Treatment of age-related lung abnormalities using estrogen and/or retinoids Methods of treating diseases or age disorders involving loss of alveoli, lung recoil or elasticity and gas exchange using RARα agonists and estrogen therapies are provided. ... 09/15/05 - 20050203072 - Compositions, combinations, and methods for treating cardiovascular conditions and other associated conditions This invention is directed generally to a method for treating a pathological condition (particularly a cardiovascular condition (e.g., hypertension or heart failure) or a condition associated with a cardiovascular condition) using a p38-kinase inhibitor (e.g., a p38-kinase-inhibiting substituted pyrazole), and specifically a combination comprising a p38-kinase inhibitor with an aldosterone ... 09/08/05 - 20050197323 - Use of 5-ht3 receptor antagonists for the treatment of inflammations of the respiratory tract It has been found that compounds having 5-HT3 (serotonin M) receptor antagonist activity can be used for (the manufacture of medicaments for) treating inflammations of the respiratory tract including the larynx, the trachea, or especially the bronchi and the lung, especially for treating obstructive pulmonary/bronchial diseases, or laryngospams (Spasmus glottides). ... 09/01/05 - 20050192261 - Methods and reagents for the treatment of immunoinflammatory disorders The invention features a method for treating a patient diagnosed with, or at risk of developing, an immunoinflammatory disorder by administering to the patient an antihistamine, either alone or in combination with one or more additional agents. The invention also features a pharmaceutical composition containing an antihistamine in combination with ... 09/01/05 - 20050192260 - Pharmaceutical composition A pharmaceutical composition comprising: (A) an androgen; (B) a cyclic enhancer of the type used in the compositions and methods claimed by U.S. Pat. No. 5,023,252 to Hsieh; and (C) a thickening agent; including, for example, a composition in which the cyclic enhancer is a macrocyclic ester or a macrocyclic ... 08/25/05 - 20050187205 - Pyrrolidineacetamide derivative alone or in combination for treatment of cns disorders A use of (S)-(−)-α-ethyl-2-oxo-1-pyrrolidineacetamide for the manufacture of a medicament for treatment of particular diseases and new pharmaceutical compositions comprising (S)-(−)-α-ethyl-2-oxo-1-pyrrolidineacetamtide. ... 08/25/05 - 20050187204 - Medicinal composition for lowering blood lipid level A pharmaceutical composition for lowering blood lipid levels which contains an HMG-CoA reductase inhibitor and bile acids. For treatment, the components of the composition can be administered together, as a composition, or separately. ... 08/25/05 - 20050187203 - Methods and reagents for the treatment of inflammatory disorders The invention features a method for treating an immunoinflammatory administering a compound of formula (I), e.g., ibudilast or KC-764, alone or in combination with a corticosteroid, tetra-substituted pyrimidopyrimidine, or other compound. The invention also features pharmaceutical compositions including the combination above for the treatment or prevention of an immunoinflammatory disorder. ... 08/18/05 - 20050182037 - Composition for the regulation of the human immune system and the prevention and treatment of diseases thereof A nutritional supplement composed of phytosterols, anti-oxidants, and other complexes, including hydrolysates of fatty acids, amino acids, peptides, proline rich polypeptides and digestive enzymes is described. The nutritional supplement may be used by individuals suffering from or at risk of developing immune system diseases; breast cancer, colon and prostate cancer; ... 08/18/05 - 20050182036 - Medicinal composition containing an hmg-coa reductase inhibitor A pharmaceutical composition for promoting the synthesis of vascular endothelial nitrogen oxide and/or maintaining or elevating the concentration of vascular endothelial nitrogen oxide in the blood, or a pharmaceutical composition for improving blood lipids. The pharmaceutical composition contains an HMG-CoA reductase inhibitor; and gamma-oryzanol, and/or thiamines. For treatment, the components ... 08/11/05 - 20050176693 - Method of intermittent administration of a pharmaceutical for the treatment of conditions associated with a female's menstrual cycle The present invention is a method of non-continuous administration of a pharmaceutical to a female for a condition associated with the female's menstrual cycle, comprising administering a daily placebo dosage, starting on the first or the second day of the menstrual cycle and continuing the daily administration for a placebo ... 08/11/05 - 20050176692 - Oral androgen therapy using modulators of testosterone bioavailability This invention provides methods of treating a mammalian subject in need of androgen therapy by orally administering to the subject testosterone, a testosterone ester, or a testosterone precursor in an oil vehicle and by administering to the subject a modulator such as finasteride or dutasteride which increases testosterone bioavailability in ... 08/11/05 - 20050176691 - Combination therapy for the treatment of estrogen-sensitive disease The present invention provides methods which increase the effectiveness of combination drug therapies for treating estrogen-sensitive diseases, such as breast cancer, as well as novel combinations useful to treat such diseases. ... 08/04/05 - 20050171073 - Composition and method for treatment and chemoprevention of prostate cancer This invention relates to compositions and methods of use thereof in the prevention of prostate carcinogenesis in a subject; prevention of the recurrence of, suppression, inhibition or reduction of the incidence of prostate carcinogenesis in a subject; treatment of a subject with prostate cancer; suppression, inhibition or reduction of the ... 08/04/05 - 20050171072 - Therapeutic combinations and methods including irm compounds The present invention provides therapeutic combinations that include an immune response modifier (IRM) component and an anti-inflammatory component. The inventions further provide methods of treating a condition by administering to one having the condition a therapeutic combination that includes an IRM component and an anti-inflammatory component. ... 07/14/05 - 20050153948 - Methods and formulations for the treatment of medical conditions related to elevated dihydrotestosterone The present invention describes a composition that contains a plant sterol or plant stanol or their fatty acid esters and an emulsifier for treating conditions that are related to elevated dihydrotestosterone. The compositions can be prepared in a dry form for use as a food ingredient, tablet or capsule. Alternatively, ... 07/14/05 - 20050153947 - Methods and reagents for the treatment of diseases and disorders associated with increased levels of proinflammatory cytokines The invention features a method for treating a patient diagnosed with, or at risk of developing, an immunoinflammatory disorder by administering an SSRI or analog or metabolite thereof and, optionally, a corticosteroid or other compound to the patient. The invention also features a pharmaceutical composition containing an SSRI or analog ... 07/07/05 - 20050148562 - Pharmaceutical compositions based on anticholinergics and additional active ingredients A pharmaceutical composition comprising an anticholinergic and at least one additional active ingredient selected from among corticosteroids, dopamine agonistes, PDE-IV inhibitors, NK1-antagonists, endothelin antagonists, antihistamines, and EGFR-kinase inhibitors, processes for preparing them and their use in the treatment of respiratory diseases. ... 07/07/05 - 20050148561 - Novel triterpene derivatives, preparation thereof and use thereof or pharmaceutically acceptable salt or ester thereof, wherein R1 is a carboxyalkanoyl, where the alkanoyl chain can be interrupted by a nitrogen, sulfur or oxygen atom, or combinations thereof. ... 06/30/05 - 20050143361 - Compositions for pulmonary administration An inhalation medicament comprising orazipone and a beta2-adrenoreceptor agonist and/or a corticosteroid as a combined preparation. Optionally the medicament also comprises one or more pharmaceutically acceptable additive, diluents or carriers. The beta-2adrenoreceptor agonist and the corticosteroid may comprise, respectively, formoterol and budesonide. ... 06/30/05 - 20050143360 - Method of using a cyclooxygenase-2 inhibitor and sex steroids as a combination therapy for the treatment and prevention of dismenorrhea The present invention provides methods for the treatment and prevention of dysmenorrhea in a woman using a combination of a cyclooxygenase-2 inhibitor and sex steroids. ... 06/23/05 - 20050137177 - Ester combination local anesthetic The present invention provides compositions and methods for improved local anesthesia and/or analgesia, in which onset of action is rapid, the risk of toxicity is low, and the effect is sustained. More particularly, the present invention provides a combination of at least two ester anesthetics for administration to a subject, ... 06/16/05 - 20050130946 - Metabolite The present invention relates to the modulation of glucocorticoid metabolism. In particular the invention relates to the modulation of the functional activity of the glucocorticoid receptor by 5α reduced metabolic breakdown products of glucocorticoids. ... 06/16/05 - 20050130945 - Combination therapy for the treatment of estrogen-sensitive disease The present invention provides methods which increase the effectiveness of combination drug therapies for treating estrogen-sensitive diseases, such as breast cancer, as well as novel combinations useful to treat such diseases. ... 06/09/05 - 20050124593 - Use of nitroxides in treating skin disease Methods of treating inflammatory skin diseases such as rosacea, atopic dermatitis, contact dermatitis, drug eruptions, psoriasis, seborrheic dermatitis, connective tissue diseases, autoimmune disorders, urticaria or hives, and inflammation associated with skin infections by topical or systemic administration of a nitroxide containing compound are provided. ... ### FreshPatents.com Support |