REGISTER now for FREE 
|
FREE patent keyword monitoring and additional FREE benefits. REGISTER now for FREE
|
|
|
Chemistry: Molecular Biology And Microbiology > Enzyme (e.g., Ligases (6. ), Etc.), Proenzyme; Compositions Thereof; Process For Preparing, Activating, Inhibiting, Separating, Or Purifying Enzymes > Transferase Other Than Ribonuclease (2.) > Transferring Phosphorus Containing Group (e.g., Kineases, Etc.(2.7)) Transferring Phosphorus Containing Group (e.g., Kineases, Etc.(2.7))Transferring Phosphorus Containing Group (e.g., Kineases, Etc.(2.7)) patent applications listed are from June 2005 to current and include Date, Patent Application Number, Patent Title, Patent Abstract summary and are linked to the corresponding patent application page.04/05/07 - 20070077640 - Organic compounds The present invention relates to isolated polypeptides which comprise an amino acid sequence consisting of a mutated functional Abl kinase domain, said mutated functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such polypeptides to screen for ... 03/29/07 - 20070072281 - Three-dimensional structure of the catalytic domain of protein kinase c theta, methods and uses thereof The present invention concerns protein kinase C (PKC) theta, in particular, the three-dimensional structure of the catalytic domain of PKC theta. Methods of expression, purification and crystallization of PKC theta catalytic domain are provided in preparation for crystallography. The atomic coordinates of a complex of PKC theta complexed with an ... 02/08/07 - 20070031956 - Crystal structure of human pim-1 kinase protein complexes and binding pockets thereof, and uses thereof in drug design The present invention relates to the X-ray analysis of crystalline molecules or molecular complexes of human Pim-1. The present invention also relates to Pim-1-like binding pockets. The present invention provides a computer comprising a data storage medium encoded with the structure coordinates of such binding pockets. This invention also relates ... 02/01/07 - 20070026512 - Atomic structure of the catalytic domain for use in designing and identifying inhibitors of zap-70 kinase The present invention relates to the three dimensional structure of ZAP-70 protein tyrosine kinase and describes methods of making a crystal of ZAP-70 and purification of the catalytic domain of ZAP-70 for use in crystallization. The invention also relates to the use of the three dimensional structure of the catalytic ... 01/25/07 - 20070020745 - Method for crystallizing human gsk3 and novel crystal structure thereof The invention provides the three-dimensional structure of a construct of human glycogen synthase kinase 3 (GSK3); crystals of a construct of human glycogen synthase kinase 3-β (GSK3-β) containing the protein's catalytic kinase domain; a method for crystallizing the protein construct to provide a GSK3 crystal sufficient for structure determination; and ... 10/05/06 - 20060223158 - Regulation of neuronal function through metabotropic glutamate receptor signaling pathways The present invention provides methods and compositions for modulating the activities of metabotropic glutamate receptor intracellular signaling molecules. The present invention provides methods and compositions for modulating the activities of casein kinase I and/or cyclin-dependent kinase 5 in cells or tissues. The present invention provides methods of modulating the function ... 08/24/06 - 20060188974 - Human protein kinases and protein kinase-like enzymes GGGGGATCTCTGTTTCCTCCGATTGCGCTGTCCTGGGGCCT ... 07/06/06 - 20060148058 - Organic compounds The tides which comprise an amino acid sequence consisting of a mutated functional Abl kinase domain, said mutated functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such polypeptides to screen for compounds which inhibit they tyrosine ... 06/29/06 - 20060141599 - Crystals of glucokinase and methods of growing them Crystalline forms of mammalian Gluckokinase of sufficient size and quality to obtain structural data by X-ray crystallography are presented. Methods of growing such crystals are also disclosed. ... 06/22/06 - 20060134768 - Erbb4 co-crystal A crystal structure of the ErbB4 kinase domain (ErbB4K), specifically the ErbB4K in liganded form as well as methods of using the same in the discovery of ErbB4 inhibitors. Disclosed further are methods of treatment of diseases mediated by inappropriate ErbB4 activity utilizing ErbB4 inhibitors identified by the methods disclosed ... 06/22/06 - 20060134767 - Mitotic kinesin binding site The present invention is directed to the identification, characterization and three-dimensional structure of a novel ligand binding site of KSP. Binding of ligands to the novel binding site result in a conformational change in the three-dimensional structure of the protein and a modulation of the activity of KSP. This conformational ... 05/18/06 - 20060105445 - Medium and method for enriching, purifying or depleting atp binding proteins from a pool of proteins The present invention relates to a medium and a method for enriching ATP binding proteins, e.g. proteinkinases, from a pool of proteins, like a proteome. The medium of the present invention comprises specific inhibitors, e.g. at least one of the compounds 4-[4-(4-fluoro-phenyl)-5-pyridine-4-yl-1H-imidazole-2-yl]-benzylamine, 2-[4-(2-Amino-ethoxy)-phenylamino]-6-(2,6-dichloro-phenyl)-8-methyl-8H-pyrido[2,3-d]pyrimidine-7-one, 2-[1-(3-aminopropyl)-1H-indole-3-yl)maleinmide, 3-[1-(3-Aminopropyl)-1H-indol-3-yl]-3-(1H-indol 3-yl)-maleinmide, 3-[1-(3-Aminopropyl)-1H-indol-3-yl]4-(1-methyl-1H-indol-3-yl) maleinimide, 3-(8-Aminomethyl-6,7,8,9-tetrahydropyrido-[1,2-a]-indol-10-yl) (1-methyl-1H-indol ... 05/04/06 - 20060094101 - Mk2 interacting proteins The present invention relates to uses of proteins that bind MK2 to modulate inflammation. More particularly, the invention relates to uses of proteins that bind MK2 for treating condition that are related to inflammation. The invention is useful for treating inflammatory conditions, particularly those in which a decrease in inflammation ... 04/27/06 - 20060088924 - Erk2 crystals The present invention relates to crystals of the ERK2 polypeptide and complexes thereof which are useful, inter alia, for structure assisted drug design. ... 04/13/06 - 20060078977 - Novel purified polypeptides from enterococcus faecalis The present invention relates to novel drug targets for pathogenic bacteria. Accordingly, the invention provides purified protein comprising the amino acid sequence set forth in SEQ ID NO: 4. The invention also provides biochemical and biophysical characteristics of the polypeptides of the invention. ... 04/13/06 - 20060078976 - Crystal structures of bacterial thymidylate kinases The present invention relates to novel drug targets for pathogenic bacteria. Accordingly, the invention provides purified protein comprising the amino acid sequence set forth in SEQ ID NO: 8. The invention also provides biochemical and biophysical characteristics of the polypeptides of the invention. ... 04/13/06 - 20060078975 - Crystal structure of enzyme and uses thereof The invention provides crystalline forms of a polypeptide corresponding to the catalytic domain of Aurora kinase. The active site ATP binding pocket is defined by its amino acid residues and their atomic coordinates. This structure may be used to select or design chemical modulators of Aurora kinase, particularly Aurora inhibitors. ... 04/06/06 - 20060073582 - Rab9 protein crystal structures and methods for identifying rab9 modulators The present invention relates to crystalline Rab9 in complex with either GDP or the GTP analog Guanosine 5′-(β,γ-imido) triphosphate (GppNHp), the three dimensional coordinates and structures of Rab9 in Rab9-GDP and Rab9-GppNHp complexes, and uses thereof for drug design. In particular, the present invention relates to methods for producing Rab9 ... 04/06/06 - 20060073581 - Crystal structures of bacterial guanylate kinases The present invention relates to novel drug targets for pathogenic bacteria. Accordingly, the invention provides purified protein comprising the amino acid sequence set forth in SEQ ID NO: 4. The invention also provides biochemical and biophysical characteristics of the polypeptides of the invention. ... 03/30/06 - 20060068481 - Human kinases The invention provides human kinases (PKIN) and polynucleotides which identify and encode PKIN. The invention also provides expression vectors, host cells, antibodies, agonists, and antagonists. The invention also provides methods for diagnosing, treating, or preventing disorders associated with aberrant expression of PKIN. ... 03/09/06 - 20060051853 - Human mekk proteins, corresponding nucleic acid molecules and uses therefor Isolated nucleic acid molecules encoding human MEKK proteins, and isolated MEKK proteins, are provided. The invention further provides antisense nucleic acid molecules, recombinant expression vectors containing a nucleic acid molecule of the invention, host cells into which the expression vectors have been introduced and non-human transgenic animals carrying a human ... 02/23/06 - 20060040372 - Ganp protein The object of the present invention is to provide a novel protein having a kinase activity and a gene encoding said protein. According to the present invention, there is provided a GANP protein which is represented by the arnino acid sequence shown in SEQ ID No. 1 or No. 3 ... 02/16/06 - 20060035359 - Survivin-binding proteins, encoding nucleic acids, and methods of use In accordance with the present invention, there are provided novel Survivin-binding-proteins (SBPs). Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention SBPs can be employed in a variety of ways, for example, for the production of anti-SBP antibodies thereto, in therapeutic compositions and in ... 02/09/06 - 20060030018 - Crystal structure of human jak3 kinase domain complex and binding pockets thereof The present invention relates to human Janus Kinase 3 (JAK3) and JAK3-like binding pockets. The present invention provides a computer comprising a data storage medium encoded with the structure coordinates of such binding pockets. This invention also relates to methods of using the structure coordinates to solve the structure of ... 02/09/06 - 20060030017 - Three-dimensional structure of c-abl The present invention concerns c-Abl, in particular, the three-dimensional structure of c-Abl containing an active DFG conformation. The atomic coordinates of c-Abl possessing this active DFG motif complexed with a specific ligand are also provided. ... 02/09/06 - 20060030016 - Crystal structure of interleukin-2 tyrosine kinase (itk) and binding pockets thereof The invention relates to molecules or molecular complexes which comprise binding pockets of ITK or its structural homologues. The invention relates to crystallizable compositions and crystals comprising ITK. The present invention also relates to a data storage medium encoded with the structural coordinates of molecules and molecular complexes which comprise ... 02/02/06 - 20060024807 - Antibodies to novel murine and human kinases The invention is directed to purified and isolated novel murine and human kinase polypeptides, the nucleic acids encoding such polypeptides, processes for production of recombinant forms of such polypeptides, antibodies generated against these polypeptides, fragmented peptides derived from these polypeptides, and the uses of the above. ... 01/26/06 - 20060019365 - Ikk-alpha proteins, nucleic acids and methods The invention provides methods and compositions relating to an IκB kinase, IKK-α, and related nucleic acids. The polypeptides may be produced recombinantly from transformed host cells from the disclosed IKK-α encoding nucleic acids or purified from human cells. The invention provides isolated IKK-α hybridization probes and primers capable of specifically ... 01/05/06 - 20060003431 - Structure of protein kinase c theta A three-dimensional structure of protein kinase C theta (PKCθ) can be used in methods of designing an agent that interacts with PKCθ. The agent can be an inhibitor of PKCθ activity. ... 11/24/05 - 20050260730 - Cdk2/cyclin a crystals and uses thereof The present invention relates to a method of forming a crystal complex of CDK2/cyclin A and a cyclin binding groove peptide oligomer using a technique involving ligand exchange within the protein crystal. The invention further relates to novel crystal complexes of CDK2/cyclin A with various peptide oligomers, methods of identifying ... 09/22/05 - 20050208640 - Novel human kinase and polynucleotides encoding the same Novel human polynucleotide and polypeptide sequences are disclosed that can be used in therapeutic, diagnostic, and pharmocogenomic applications. ... 09/22/05 - 20050208639 - Crystal structure of staphylococcus undecaprenyl pyrophosphate synthase and uses thereof The invention is directed generally to the structure of prenyltransferases, particularly undecaprenyl pyrophosphate synthase, an enzyme important in bacterial cell wall synthesis. The invention relates to the crystal structure of undecaprenyl pyrophosphate synthase from Staphylococcus aureus and the interaction with a cofactor and ligands. The invention also relates to the ... 09/08/05 - 20050196851 - Crystal structure of the btk kinase domain The invention provides crystal structure of the kinase domain of BTK, as well as use of the crystal structure in the design, identification, and verification of ligands that modulate BTK activity. ... 08/25/05 - 20050186668 - Hormonally up-regulated, neu-tumor-associated kinase This invention relates generally to a novel serine/threonine protein kinase, specifically to hormonally up-regulated, neu-tumor-associated kinase (HUNK); and to the nucleotide sequence encoding it. The kinase is temporally expressed during postnatal mammary development in a spatially heterogeneous manner in certain subsets of cells, and overexpressed in a subset of primary ... 08/25/05 - 20050186667 - Pregnancy up-regulated, nonubiquitous cam kinase This invention relates generally to a novel CaM multi-functional protein kinase, which has been named Pregnancy Up-Regulated, Nonubiquitous CaM Kinase (PNCK), and to the nucleotide sequence encoding it. The kinase is temporally expressed during postnatal mammary development in a spatially heterogeneous manner in certain subsets of cells, and overexpressed in ... 08/04/05 - 20050170486 - Nucleic acids encoding human inositolpolyphosphate 5-phosphatase Reagents which regulate human inositol polyphosphate 5-phosphatase and reagents which bind to human inositol polyphosphate 5-phosphatase gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, COPD, asthma, diabetes, and cancer. ... 07/28/05 - 20050164364 - Human heme-regulated initiation factor 2-alpha kinase The present invention provides an isolated nucleic acid sequence encoding a human heme-regulated initiation factor 2 alpha kinase. In addition, the invention provides a method for inhibiting protein synthesis, inducing cellular differentiation, or inhibiting infection in human cells by administering an effective amount of a heme-regulated initiation factor 2 alpha ... 07/21/05 - 20050158838 - Novel enterokinase cleavage sequences Novel enterokinase cleavage sequences are provided. Also disclosed are methods for the rapid isolation of a protein of interest present in a fusion protein construct including a novel enterokinase cleavage sequence of the present invention and a ligand recognition sequence for capturing the fusion construct on a solid substrate. Preferred ... ### FreshPatents.com Support |