FREE patent keyword monitoring and additional FREE benefits. /images/triangleright (1K) REGISTER now for FREE triangleleft (1K)
Fresh Patents
Monitor Patents Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents Browse Locations


Chemistry: Molecular Biology And Microbiology > Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip > Involving Virus Or Bacteriophage

Involving Virus Or Bacteriophage

Involving Virus Or Bacteriophage patent applications listed are from June 2005 to current and include Date, Patent Application Number, Patent Title, Patent Abstract summary and are linked to the corresponding patent application page.

06/07/07 - 20070128589 - Substrates, sensors, and methods for assessing conditions in females
Described herein are substrates, methods, articles, and kits that are useful for detecting a condition in a female mammal. The substrates interact with one or more proteins (e.g., an enzyme) produced by a microorganism or the female animal. The substrates are labelled in order to produce a visible signal (e.g., ...

06/07/07 - 20070128588 - Detection and typing of human papillomavirus using pna probes
The invention provides methods for detection and typing of HPV infection using PNA probes. More specifically, methods are provided for detecting high-risk types of HPV infection with minimal numbers of PNA probes or using PNA probes to selectively amplify only high-risk types of HPV ...

06/07/07 - 20070128587 - Method of diagnosis of foot and mouth disease and the diagnostic kit
The present invention provides a method for diagnosing foot-and-mouth disease virus infection, comprising the steps of applying a predetermined amount of a test sample to a loading region of a strip; coupling a detection reagent including a given labeling reagent to an analyte of interest in the test sample to ...

06/07/07 - 20070128586 - Therapeutic, prophylactic and diagnostic agents
The present invention provides compounds useful in the treatment and prophylaxis of infection in mammals and avian species by pathogenic agents such as, but not limited to, viruses. The present invention further provides compounds useful in the treatment of other disease conditions such as cirrhosis and hepatocellular carcinoma. The present ...

05/31/07 - 20070122801 - Binding molecules capable of neutralizing west nile virus and uses thereof
The invention provides human binding molecules specifically binding to West Nile virus and having West Nile virus neutralizing activity, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used ...

05/31/07 - 20070122800 - Methods for quantifying polymer attachment to a particle
The present invention relates to improved methods for quantifying the degree of polymer attachment of particles with multiple polymer attachment sites. The disclosed methods are useful for gene therapy, particularly gene therapy using pegylated adenoviral vectors. ...

05/31/07 - 20070122799 - Method of isolation and self-assembly of small protein particles from blood and other biological materials
Compositions and methods for the isolation and manipulation of misfolded, or partially misfolded, proteins present in blood and other biological materials are provided. In one aspect of the invention, the compositions, hereinafter termed “proteons” are misfolded or partially misfolded proteins surrounding a metallic nanocluster, termed “proteon nucleation center” (PNC). Also ...

05/31/07 - 20070122798 - Methods and tools for screening active rna in cellulo
The invention relates to methods and compositions for screening active RNA in cellulo. The invention more particularly relates to methods of the preparation and selection of random RNA providing a cell with a desired phenotype, to random RNA banks and the production thereof, as well as to cellular populations which ...

05/24/07 - 20070117089 - Sol-gel coated glass microspheres for use in bioassay
A microsphere for use in a bioassay comprising a glass core coated with a sol-gel comprising a bioactive probe is provided. The sol-gel coating enhances the density of bioprobe loading on the surface of the microspheres, resulting in enhanced dynamic range and sensitivity in bioassays. The particle may be used ...

05/24/07 - 20070117088 - Methods and kits for detection of prion diseases
The invention relates to diagnostic methods and kits for detecting transmissible spongiform encephalopathies (TSEs) such as BSE, scrapie, chronic wasting disease and related diseases in animals and humans. The invention provides a method for determining whether an aberrant prion protein is present or absent in a mammalian sample comprising the ...

05/17/07 - 20070111202 - Electrochemical detection of nucleic acid sequences
An electrochemical detection system which specifically detects selected nucleic acid segments is described. The system utilizes biological probes such as nucleic acid or peptide nucleic acid probes which are complementary to and specifically hybridize with selected nucleic acid segments in order to generate a measurable current when an amperometric potential ...

05/17/07 - 20070111201 - Reverse transfection of cell arrays for structural and functional analyses of proteins
The present invention relates to articles and methods for determining the function of genes, gene products, and nucleic acid products. The present invention also relates to identifying ligands and binding partners or proteins and nucleic acid products. The present invention also relates to methods and compositions related to reverse-transfection. ...

05/17/07 - 20070111200 - Detection of hpv
The present invention provides compositions and methods for the detection and characterization of HPV sequences. More particularly, the present invention provides compositions, methods and kits for using invasive cleavage structure assays (e.g. the INVADER assay) to screen nucleic acid samples, e.g., from patients, for the presence of any one of ...

05/10/07 - 20070105094 - Water-soluble cationic magnetic fine particles and method for separating or detecting lipid vesicle using the same
A phospholipid vesicle such as a virus is to be rapidly separated (concentrated, roughly purified) and good detection (diagnosis) results can be obtained with suppressing inhibition of virus-denature, PCR inhibition, latex-aggregation inhibition, and the like. Moreover, the above operations are to be automated. A phospholipid vesicle is separated using a ...

05/10/07 - 20070105093 - Uncoupling of dna insert propagation and expression of protein for phage display
The present invention provides an advance in phage display technology by permitting the uncoupling of the propagation of phages containing inserted sequences encoding heterologous polypeptides from the expression of said polypeptides. The invention provides phage constructs and methods for their use to permit phage coat protein expression, and thus phage ...

05/10/07 - 20070105092 - Proteolytic and covalent antibodies
Improved methods for the production, selection and inhibition of catalytic and covalent antibodies are disclosed. ...

05/10/07 - 20070105091 - Real time assay for rotavirus
A highly sensitive quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) assay with wide linear dynamic range is useful as a high-throughput screening assay for detecting Rotavirus in clinical samples. The primers and probe specifically detect Rotavirus of all serotypes. The assay is particularly useful as a screening assay for determining ...

05/10/07 - 20070105090 - Amplification method
The present invention combines the use of template switching with nucleic acid amplification—such as PCR—to generate amplification products representative of an entire RNA population. An RNA polymerase promoter sequence allows transcription-based amplification to be performed on the derived amplification products such that antisense amplified RNA (aRNA) or complementary RNA (cRNA) ...

05/03/07 - 20070099183 - Comparative ligand mapping from mhc positive cells
The present invention relates generally to a methodology for the isolation, purification and identification of peptide ligands presented by MHC positive cells. In particular, the methodology of the present invention relates to the isolation, purification and identification of these peptide ligands from soluble class I and class II MHC molecules ...

05/03/07 - 20070099182 - Comparative ligand mapping from mhc class i positive cells
The present invention relates generally to a methodology for the isolation, purification and identification of peptide ligands presented by MHC positive cells. In particular, the methodology of the present invention relates to the isolation, purification and identification of these peptide ligands from soluble class I and class 11 MHC molecules ...

05/03/07 - 20070099181 - Postweaning multisystemic wasting syndrome virus from pigs
The cloning of a novel PCVII viral genome is described as is expression of proteins derived from the PCVII genome. These proteins can be used in vaccine compositions for the prevention and treatment of PCVII infections, as well as in diagnostic methods for determining the presence of PCVII infections in ...

05/03/07 - 20070099180 - Evanescent wave sensor with attached ligand
The invention in particular embodiments provides an evanescent wave sensor which includes a ligand bound to a sensor substrate via a β-hydroxy-linker moiety, as defined herein. Methods of making the subject evanescent wave sensors are also provided which include contacting a first reactive moiety which has an epoxy-ring moiety with ...

05/03/07 - 20070099179 - Method for inducing hepatitis c virus (hcv) replication in vitro, cells and cell lines enabling robust hcv replication and kit therefor
The present invention relates to hepatitis C virus (HCV). More particularly, the invention relates to the development of a tool suitable for the search, discovery and validation of novel HCV antiviral drugs and therapies (e.g. vaccine). The invention further relates to methods for inducing HCV replication in vitro, and more ...

05/03/07 - 20070099178 - Method for detecting sars coronavirus
This invention provides: a method for detecting SARS pathogenic viruses with high sensitivity and rapidity for diagnosing severe acute respiratory syndrome (SARS); an oligonucleotide primer that can specifically hybridize with any nucleotide sequence constructed based on the nucleotide sequence of RNA polymerase of the SARS coronavirus; a method for nucleic ...

05/03/07 - 20070099177 - Agents and methods for detecting human adenoviruses
The invention relates to labeled or unlabelled nucleic acids to specifically bind to DNA of human adenoviruses (HAdV DNA), whereby the nucleic acid a) possesses the sequence SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, b) possesses a sequence with a homology of greater than ...

04/26/07 - 20070092871 - Microarray for pathogen identification
There is disclosed a microarray device for pathogen identification and for subtyping influenza A. Pools of primers are disclosed and used to amplify any subtype of influenza A. Pathogen identification includes influenza A, influenza B, parainfluenza virus, adenovirus, enterovirus, rhinovirus, human metapneumovirus, respiratory syncytal virus, herpes simplex viruses, SARS coronavirus, ...

04/26/07 - 20070092870 - Detection of biomolecules
Compositions, systems and methods for the detection of analytes with labeled nanostructures are provided. In particular, compositions and systems including labeled nanostructures for detecting a biomolecule of interest, and methods of use thereof, are provided. ...

04/26/07 - 20070092869 - Spike-in controls and methods for using the same
Methods, compositions, and kits for performing a one-color analysis of microarray data are provided. Also disclosed are compositions including control nucleic acid sequences, and methods for measuring the dynamic range of a microarray analysis. ...

04/26/07 - 20070092868 - Liquid crystal cassette
A functional cassette for the detection of ligands comprises a first inner housing, a second middle housing and a third outer housing and each housing is at least partially rotatable relative to an adjoining housing. The first inner housing contains a central well adapted for receiving a sample, and the ...

04/26/07 - 20070092867 - Application using non-covalent bond between a cucurbituril derivative and a ligand
Provided are a kit including a first component that is a compound of formula (1) below bound to a first material and a second component that is a ligand bound to a second material, wherein each of the first and second materials is independently selected from the group consisting of ...

04/26/07 - 20070092866 - Avian adenoassociated virus and uses thereof
The present invention provides an Avian adeno-associated virus (AAAV) virus and vectors and particles derived therefrom. In addition, the present invention provides methods of delivering a nucleic acid to a cell using the AAAV vectors and particles. Methods of isolating the AAAV are provided. ...

04/19/07 - 20070087341 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087340 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087339 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087338 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087337 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087336 - Compositions for use in identification of influenza viruses
The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ...

04/19/07 - 20070087335 - Human microrna targets in hiv genome and a method of identification thereof
The present invention relates to human microRNA targets in HIV genome and a method of identification thereof. Using multiple software targets to six human microRNAs [miRNAs] were discovered in the net, vpr, env, and I vif genes. The miRNAs were identified as hsa-miR-29a, hsa-miR-29b, hsa-miR-29c, hsa-mir-149, hsa-mir-324-5p, hsa-mir-378. These miRNAs ...

04/19/07 - 20070087334 - Pkr activation via hybridization chain reaction
The present application relates to the use of hybridization chain reaction (HCR) to form double stranded RNA polymers in the presence of a target, such as a nucleic acid associated with a disease or disorder. The RNA polymers are preferably able to activate the RNA-dependent kinase PKR. Activation of PKR ...

04/19/07 - 20070087333 - Method to detect antigen-specific cytolytic activity
The invention relates to a novel non-radioactive method to detect cytolytic activity that provides a measure of the existence and magnitude of an immune response against a particular antigen or immunogen. Provided is a method for detecting cytolytic activity of cells or a substance against a population of target cells, ...

04/19/07 - 20070087332 - Pulmonary stem cells, related methods and kits of parts
Isolated pulmonary stem cells, the isolated pulmonary stem cells being slowly dividing Oct-4 expressing cells forming individual colonies and able to undergoing terminal differentiation into a mature phenotype in vitro; a method to identify stem cells of a tissue; a kit for the identification of stem cell of a tissue; ...

04/19/07 - 20070087331 - Selection of b cells with specificity if interest: method of preparation and use
The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides methods using a composition comprising an ordered and repetitive antigen or antigenic determinant array for visualization and selection of B cells specific for the antigen. These B cells are useful for the ...

04/19/07 - 20070087330 - Viral deconstruction through capsid assembly in vitro
A cell-free method for translation and assembly of viral capsid and capsid intermediates is disclosed for use in deconstructing an unknown virus and for screening for compounds that inhibit assembly of viral capsids for the unknown virus. ...

04/12/07 - 20070082331 - Chemical processing cartridge and method of using same
A cartridge capable of making effective use of a sample is provided. A blood sample is injected into a well via an injection path by use of a syringe, and so forth. A roller, in a state as kept pressed into contact with the cartridge, is rotated rightward, whereupon an ...

04/12/07 - 20070082330 - Compounds displayed on icosahedral phage and methods of using same
Icosahedral phage and collections thereof that display various compounds are provided. In some instances, the icosahedral phage include nucleic acid tags that serve to record a characteristic of the compound or compounds that are attached to the phage. A number of different methods for using the icosahedral phage to screen ...

04/05/07 - 20070077555 - Adsorption system for the removal of viruses and viral components from fluids, in particular blood and blood plasma
The present invention relates to an adsorption system for the removal of viruses and viral components, in particular hepatitis C viruses, from physiological fluids, in particular whole blood or blood plasma, by means of extracorporeal adsorption processes, as well as to an adsorber material for use in the adsorption system ...

04/05/07 - 20070077554 - Homologous viral internal controls for use in rt-pcr assays of enteric viruses
Homologous viral internal controls have been developed for use in RT-PCR assays of a number for viruses. Two of these internal controls, such as for HAV and Norwalk virus, are cloned on a single plasmid, thereby making them useful for the multiplex detection of these viruses in a single reaction. ...

04/05/07 - 20070077553 - Bioinformatically detectable group of novel vaccinia regulatory genes and uses thereof
The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “Viral genomic record” or “VGR genes”. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive ...

03/29/07 - 20070072177 - Binding molecules capable of neutralizing rabies virus and uses thereof
The invention provides binding molecules that specifically bind to rabies virus and are capable of neutralizing the virus. The invention further provides nucleic acid molecules encoding the binding molecules, compositions comprising the binding molecules and methods of identifying or producing the binding molecules. The binding molecules can be used in ...

03/29/07 - 20070072176 - Novel peptide compositions and their use in particular in the preparation of pharmaceutical compositions active against the hepatitis c virus
The invention relates to peptide compositions for use in the preparation of pharmaceutical compositions against hepatitis C virus, as well as corresponding methods. ...

03/29/07 - 20070072175 - Nucleotide array containing polynucleotide probes complementary to, or fragments of, cynomolgus monkey genes and the use thereof
This invention relates to a nucleotide array containing polynucleotide probes complementary to, or fragments of, Cynomolgus monkey genes, and the use of such a nucleotide array to characterize the biological effects, including the actions, targets, and toxicities, of therapeutic agents in primates, e.g., a human, a Cynomolgus monkey, or a ...

03/29/07 - 20070072174 - Bioreporter for detection of microbes
A recombinant phage system has been developed for the rapid detection of bacteria, particularly fecal coliform indicator bacteria. The systems of the invention link phage infection events to quorum sensing signal molecule biosynthesis and bioluminescent bioreporter induction, facilitating the detection of pathogens that may be present in low numbers. The ...

03/29/07 - 20070072173 - Utilization of nucleotide probes in elisa procedure for the quantitative determination of baculovirus titer
To maximize the yield of protein from a baculovirus system, optimal infection of the host cell culture must be achieved; in order to obtain such optimal infection, the titer of the virus inoculation must be known. The present invention is the development of a simple, rapid, and universally applicable titration ...

03/22/07 - 20070065815 - Methods for genotyping hepatitis c virus
The present invention relates to methods and compositions for analyzing nucleic acids. In particular, the present invention provides methods and compositions for the detection and characterization of nucleic acid sequences and sequence changes. The methods of the present invention permit the detection and/or identification of genetic polymorphism such as those ...

03/22/07 - 20070065814 - Detecting foot-and-mouth disease virus
This document relates to methods and materials involved in determining whether or not an animal contains a foot-and-mouth disease virus. For example, nucleic acid primer pairs, combinations of nucleic acid primer pairs, nucleic acid arrays (e.g., diagnostic cards) containing nucleic acid primer pairs or combinations of nucleic acid primer pairs, ...

03/22/07 - 20070065813 - Assay for quantitative detection of respiratory syncytial virus (rsv)
The present invention describes respiratory syncytial virus (RSV) primers and probes as reagents for detection of a RSV infection. Specifically, the invention provides nucleic acid sequences from the RSV nucleocapsid gene used with hybridization and PCR techniques to detect RSV infection. ...

03/22/07 - 20070065812 - Multiplexed rt-pcr assay for detection and separation of barley and cereal yellow dwarf viruses
RT-PCR primer multiplexes and a method for detecting the presence of Subgroup I and II barley or cereal yellow dwarf viruses in a sample. A first multiplex includes a first primer pair that selectively amplifies Subgroup I viruses, and a second primer pair that selectively amplifies Subgroup II viruses. A ...

03/22/07 - 20070065811 - Method of detecting multiple analytes
The invention relates to a a microtiter plate and its use in a method of the invention, which microtiter plate comprises a plurality of containers, wherein the bottom of each container comprises a (semi-)permeable membrane capable of directly or indirectly binding an analyte, and wherein each container is separated from ...

03/22/07 - 20070065810 - Diagnosis and treatment of cervical cancer
In certain aspects, the invention relates to methods of diagnosing cervical cancer by using a combination of certain biomarkers such as hTERT, IGFBP-3, transferrin receptor, beta-catenin, Myc-HPV E6 interaction, HPV E7, and telomere length. In other aspects, the invention relates to methods of detecting immortalization of cervical cells by using ...

03/22/07 - 20070065809 - Compositions and methods screening using populations of surrogate antibodies
Methods and compositions for the detection, identification, and quantification of compounds of interest in a sample are provided. The compositions and methods include arrays and kits comprising a population of surrogate antibodies that bind compounds of interest. The surrogate antibodies can be immobilized on to a solid support by means ...

03/15/07 - 20070059686 - Materials and methods for the detection of severe acute respiratory syndrome virus (sars)
Disclosed are methods and kits for identifying a virus in a sample, which may include a coronavirus capable of causing Severe Acute Respiratory Syndrome (“SARS”) or SARS-like symptoms. The virus may be a SARS-Associated Coronavirus (“SARS-CoV”). Typically, the methods may include reacting a mixture that includes, in addition to nucleic ...

03/15/07 - 20070059685 - Method for producing improved results for applications which directly or indirectly utilize gene expression assay results
A method for producing improved results for applications of any kind which directly or indirectly utilizes gene expression assay results. ...

03/15/07 - 20070059684 - Method of identifying an antiviral agent
A method of identifying an antiviral agent effective against viruses, which utilize −1 programmed ribosomal frameshifting is provided. The method includes providing cells harboring a −1 frame plasmid including a translation start site followed by a −1 ribosomal frameshifting signal followed by a reporter gene which is in a −1 ...

03/15/07 - 20070059683 - Veterinary diagnostic system
The invention relates to a method for diagnosing an animal for a condition by obtaining a fluid sample from the animal, enriching a first analyte having a concentration of less than 1×10−3 analytes/μL from said sample by a factor of at least 10,000 fold; and analyzing one or more enriched ...

03/15/07 - 20070059682 - Method to increase specificity and/or accuracy of lateral flow immunoassays
The present invention relates to a method for detecting an analyte in a sample, wherein the sample to be analyzed is applied to a chromatographic carrier. After separating from an interfering substance which may be present in the sample, the analyte of interest is detected on the carrier by means ...

03/15/07 - 20070059681 - Method for production of bioresorable microparticles, microparticles thus obtained and use thereof
The present invention relates to a method for preparing nonlamellar bioresorbable microparticles to which protein substances are bonded, characterized in that it comprises the steps of: (i) preparing said microparticles from at least one bioresorbable polymer without stabilizer and without surfactant, and (ii) bonding said protein substances to the microparticles ...

03/08/07 - 20070054264 - Methods and means relating to hepatitis b infection
The present inventors have discovered that the presence of antibodies reactive with residues 94-117 of the PreS1 component of the hepatitis B surface antigen (HBsAg) in an individual with HBV infection correlates closely with the effectiveness of interferon (IFN) in treating the individual. Methods and means based on this finding ...

03/08/07 - 20070054263 - Method and kit for molecular identification of smallpox
We have developed two new PCR based assays to detect Orthopoxvirus DNA which when tested under simulated clinical conditions, have proven to be very sensitive, rapid and robust. Importantly, we were able to construct artificial templates for use as positive controls in the RFLP analysis necessary to differentiate variola and ...

03/08/07 - 20070054262 - Methods of identifying optimal variants of peptide epitopes
The present invention is directed to methods for selecting a variant of a peptide epitope which induces a CTL response against another variant(s) of the peptide epitope, by determining whether the variant comprises only conserved residues, as defined herein, at non-anchor positions in comparison to the other variant(s). The present ...

03/01/07 - 20070048736 - Hepatitis
An isolated nucleic acid containing a mutant hepatitis B virus genome and related methods. ...

03/01/07 - 20070048735 - Methods for rapid detection and identification of biogents in epidemiological and forensic investigations
The present invention provides methods for rapid forensic investigations by identification of bioagents associated with biowarfare and acts of terrorism or crime. The methods are also useful for epidemiological investigations by genotyping of bioagents. ...

02/22/07 - 20070042359 - Binding molecules capable of neutralizing west nile virus and uses thereof
The invention provides human binding molecules specifically binding to West Nile virus and having West Nile virus neutralizing activity, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used ...

02/22/07 - 20070042358 - Method for improving cell permeability to foreign particles
The present invention provides a method for allowing foreign particles to penetrate, very efficiently, the cell wall, cell membrane, organelle membrane and/or nuclear membrane of a cell and hybridizing or binding to the complimentary target in the cell. The cells may be from a culture or from specimens obtained from ...

02/22/07 - 20070042357 - Detection and identification of bacterial strains
The present invention relates to a method to detect bacteria, the method comprising the following steps: coupling of the bacteriophages and/or bacteriophage proteins to a support, incubating the support coupled with the bacteriophages and/or bacteriophage proteins with a sample, optionally removing the sample and the bacteria in the sample not ...

02/22/07 - 20070042356 - Variants of hepatitis b virus resistant against some nucleoside analogues, but sensitive to others, and uses thereof
The present invention relates generally to the field of Hepatitis B variants exhibiting a reduced sensitivity to nucleoside analogues both in vivo and in vitro. More in particular, reverse transcriptase mutant rt I233V is provided. Present invention provides assays and methods for detecting such variant, which assays are useful in ...

02/22/07 - 20070042355 - Integrated method for collection and maintenance of detectability of a plurality of microbiological agents in a single clinical sample and for handling a plurality of samples for reporting a sum of diagnostic results for each sample
A method and kit related thereto are described for the collection and maintenance of detectability of a plurality of species of microbiological agents in a single clinical sample as well as an integral method for handling a plurality of the samples and managing information associated therewith for reporting a sum ...

02/22/07 - 20070042354 - Detecting pathogens in companion animals
This document relates to methods and materials involved in determining whether or not an animal contains a pathogen. For example, nucleic acid primer pairs, combinations of nucleic acid primer pairs, nucleic acid arrays (e.g., diagnostic cards) containing nucleic acid primer pairs or combinations of nucleic acid primer pairs, methods for ...

02/22/07 - 20070042353 - Hcv polymerase suitable for crystal structure analysis and method for using the enzyme
An HCV polymerase suitable for crystal structural analysis and a method for using the enzyme are provided. The HCV polymerase suitable for crystal structural analysis and/or comprising high HCV polymerase activity can be used for the three-dimensional structural analysis, and for rational identification of HCV polymerase inhibitors by computers. The ...

02/22/07 - 20070042352 - Retroviral vector and cell-based assay for measuring the mutations rate of retroviruses employing same
Lentiviral-based retrovirus vectors and an in vivo mutation rate assay employing them. More particularly, an assay for directly determining the in vivo mutation rate of HIV-1. ...

02/22/07 - 20070042351 - Multi-allelic molecular detection of sars-associated coronavirus
The subject invention relates to a multiple-allelic RT-real-time polymerase chain reaction (PCR) assay for coronaviruses including the SARS virus. Multiple target sequences within the SARS-CoV, S, E, M and N genes are identified. The use of the four different targets enhances the likelihood that the fundamental genetic drift of the ...

02/22/07 - 20070042350 - Methods and compositions for detecting sars virus and other infectious agents
This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotides sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated. ...

02/22/07 - 20070042349 - Methods for assessing biologic diversity
Methods for determining biologic diversity (e.g., lymphocyte receptor diversity or diversity of viral quasispecies) in a subject are described, as well as methods for monitoring a disease in a subject. ...

02/22/07 - 20070042348 - Colorimetric sensor
A means for detecting a presence of a particular material in the air, a filter for an air conditioner which can confirm the presence of the particular material in the air, and a method for confirming a performance of the filter for an air conditioner about a removal of the ...

02/15/07 - 20070037143 - Method for screening for protease modulators
The present invention is in the field of pharmaceutical research tools. Specifically, the present invention provides methods for screening compounds or compositions with respect to their ability and/or specificity to modulate the activity of proteases. ...

02/15/07 - 20070037142 - Methods and apparatus for detecting viruses using an acoustic device
Methods for detecting viruses are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for the virus, is combined with the sample to form a plurality of analyte-particle complexes. The system also includes a transport arrangement for transporting the sample to the ...

02/15/07 - 20070037141 - Methods and compositions for inhibition of membrane fusion-associated events, including hiv transmission
The present invention relates to peptides which exhibit potent anti-retroviral activity. The peptides of the invention comprise DP178 (SEQ ID:1) peptide corresponding to amino acids 638 to 673 of the HIV-1LAI gp41 protein, and fragments, analogs and homologs of DP178. The invention further relates to the uses of such peptides ...

02/15/07 - 20070037140 - Methods and compositions for detecting sars virus
This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotide sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated. ...

02/15/07 - 20070037139 - Method of analyzing gene introduction site
A method of analyzing, in chromosomal DNA having a retroviral vector incorporated therein, DNA region derived from chromosome which is adjacent to the vector, characterized in that a primer extension reaction and a nucleic acid amplification reaction are carried out in the presence of a compound capable of lowering the ...

02/15/07 - 20070037138 - Standard for immunohistochemistry, immunocytochemistry and molecular cytogenetics
This application describes a method comprising: (a) providing a reference standard or a planar section thereof, the reference standard comprising (i) a support medium; and (ii) a quantity of a detectable entity supported by the support medium; in which the detectable entity has an elongate path; in which a predetermined ...

02/15/07 - 20070037137 - Method and kit for quantitative and qualitative determination of human papillomavirus
The present invention relates to a method and kit for quantitative and qualitative determination of human papillomavirus, HPV, in a sample. More precisely, for quantitative and qualitative determination of oncogenic HPV to predict the risk of HPV infection resulting in cervical carcinoma. The method and kit enable simultaneous measurement of ...

02/08/07 - 20070031828 - Assay
A process for identification of type-specific polynucleotide sequences in a sample, the process comprising the steps of (1) contacting polynucleotides from the sample, or derived from the sample, with a plurality of type-specific probes in the context of a solid support, and detection of any type-specific hybridisation; and (2) contacting ...

02/08/07 - 20070031827 - Method and detector for identifying subtypes of human papilloma viruses
A detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detector comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype ...

02/08/07 - 20070031826 - Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof
This invention relates to a kit and a method of use thereof to detect and determine the genotype of HPVs in a biological sample. The kit for detection and determination of the genotype of HPV, comprises PCR primers for HPV genes; HPV oligonucleotide chips having one or more probes immobilized ...

02/08/07 - 20070031825 - Methods and compositions for detecting bk virus
The invention provides methods and compositions for rapid, sensitive, and highly specific nucleic acid-based (e.g., DNA based) detection of a BK virus in a sample. In general, the methods involve detecting a target nucleic acid having a target sequence of a conserved region of BK viral genomes. The invention also ...

02/08/07 - 20070031824 - Simultaneous quantification of nucleic acids in diseased cells
A process for assessing mitochondrial toxicity of a compound that includes contacting nucleic acids from a host with an amplification reaction mixture that contains at least two primers that provide detectable signals, wherein: a first primer provides a first detectable signal upon amplification of a host mitochondrial nucleic acid; a ...

02/08/07 - 20070031823 - Bioinformatically detectable group of novel vaccinia regulatory genes and uses thereof
The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “genomic record” or “GR” genes. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive viral ...

02/08/07 - 20070031822 - Ndr kinase modulators
Methods of identifying agents that modulate NDR kinases, including those that modulate NDR1 and NDR2 kinases and methods of using those agents to inhibit retroviral pathogenesis are among the methods described herein. ...

02/01/07 - 20070026392 - Disease model incorporation into an artificial immune system (ais)
The present invention relates to methods for preparing an artificial immune system. The artificial immune system comprises a cell culture comprising a three-dimensional matrix comprising lymphoid tissue, a three-dimensional matrix comprising epithelial and/or endothelial cells, and diseased cells. The artificial immune system of the present invention can be used for ...

02/01/07 - 20070026391 - Methods and compositions for identifying chemical or biological agents using multiplexed labeling and colocalization detection
The present invention provides methods for detecting a target pathogenic agent, e.g., a virus, a bacterium, and/or a toxic substance, using colocalization detection. The invention also provides methods for parallel detection of different target pathogenic agents in a sample using multiplexed labeling and colocalization detection. The invention also provides kits ...

02/01/07 - 20070026390 - Development of diagnostic kit against the recombinant coat protein of prunus necrotic ringspot virus
The present invention deals with a set of primers of sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful for detection of Prunus necrotic ringspot virus in plants. It also relates to a method for detection of Prunus necrotic ringspot virus in plants by using ...

02/01/07 - 20070026389 - Methods for drug discovery, disease treatment, and diagnosis using metabolomics
The small molecule profiles of cells are compared to identify small molecules which are modulated in altered states. Cellular small molecule libraries, methods of identifying tissue sources, methods for treating genetic and non-genetic diseases, and methods for predicting the efficacy of drugs are also discussed. ...

02/01/07 - 20070026388 - Analyte detection using carbon nanotubes
A method for detecting analytes involves measuring the fluorescence of a sample of fluorescence-attenuated carbon nanotubes, then exposing the sample to a target analyte, and then measuring the fluorescence again. The fluorescence-attenuated nanotubes include a chemical having quenching portion that interacts with the nanotubes and attenuates the fluorescence, a receptor ...

02/01/07 - 20070026387 - Diagnosing and monitoring inflammatory diseases by measuring complement components on white blood cells
The invention is related to methods of diagnosing inflammatory diseases or conditions by determining levels of components of the complement pathway on the surface of white blood cells. ...

02/01/07 - 20070026386 - Method for the detection of newly acquired hiv infection
The present invention relates to the detection of a human immunodeficiency virus (HIV) infection. More particularly, the present invention relates to methods of distinguishing between early antibody responsesto HIV infection from matured responses. In one aspect, the present invention provides a method of distinguishing between a recent and an established ...

01/25/07 - 20070020620 - Compositions and methods for coupling a plurality of compounds to a scaffold
Compositions and methods are provided for coupling a plurality of compounds to a scaffold. Compositions and methods are further provided for catalyzing a reaction between at least one terminal alkyne moiety and at least one azide moiety, wherein one moiety is attached to the compound and the other moiety is ...

01/25/07 - 20070020619 - Method for identifying motifs and/or combinations of motifs having a boolean state of predetermined mutation in a set of sequences and its applications
Methods for identifying a motif or a combination of motifs having a Boolean state of predetermined mutations in a set of sequences including a) aligning a set of sequences of ordered motifs represented by a single-character code, b) comparing a reference sequence with the set of sequences aligned in step ...

01/25/07 - 20070020618 - Process to study changes in gene expression in t lymphocytes
Methods are disclosed to identify T lymphocyte genes that are differentially expressed upon exposure to a pathogen (viral or bacterial), immunogen, antigen, or in a sterile inflammatory disease, autoimmune disease, immunodeficiency disease, lymphocytic cancers, or graft versus host rejection. The method involves the preparation of a gene expression profile of ...

01/25/07 - 20070020617 - Gel microdrops in genetic analysis
The invention provides methods of nucleic acid analysis. Such methods entail forming a population of gel microdrops encapsulating a population of biological entities, each entity comprising a nucleic acid, whereby at least some microdrops in the population each encapsulate a single entity. The population of gel microdrops is then contacted ...

01/25/07 - 20070020616 - Parallel process for protein or virus separation from a sample
A sample is divided into a series of aliquots with the aliquots being subjected to at least two successive parallel separation steps in order to resolve protein or viral components thereof. The separation steps are performed not only on a sample but subsamples each containing a prelabeled tag to afford ...

01/25/07 - 20070020615 - Quantitative prediction method
The present invention concerns methods and systems for analysis of drug resistance in HIV-1. More specifically, the invention provides methods for predicting drug resistance by correlating genotypic information with phenotypic profiles. The methods allow the identification of primary and secondary resistance-associated mutations for new and existing drugs and for calculating ...

01/25/07 - 20070020614 - Development of novel anti-microbial agents based on bacteriophage genomics
A method for identifying suitable targets for antibacterial agents based on identifying targets of bacteriophage-encoded proteins is described. Also described are compositions useful in the identification methods and in inhibiting bacterial growth, and methods for preparing and using such compositions. ...

01/18/07 - 20070015143 - Preparation and use of mixed mode solid substrates for chromatography adsorbents and biochip arrays
For certain mixed mode resins having anionic character, a ligand is joined to a solid support via a linkage that includes a mercapto-, ether- or amino-containing moiety. A suitable ligand comprises an aromatic group, a heteroaromatic group, or a heterocyclic group, optionally fused, that is sulfate-, sulfonate-, phosphonate- or phosphate-substituted ...

01/18/07 - 20070015142 - Detection of hiv-1 by nucleic acid amplification
Nucleic acid sequences and methods for detecting HIV-1 nucleic acid (LTR and pol sequences) in biological samples by detecting amplified nucleic acids are disclosed. Kits comprising nucleic acid oligomers for amplifying HIV-1 nucleic acid present in a biological sample and detecting the amplified nucleic acid are disclosed. ...

01/18/07 - 20070015141 - Process for adjusting the diameter of gold particles and colloidal gold solution
A method for estimating the particle diameter distribution width of gold colloid based on the measurement of, in addition to the maximum absorption wavelength, a ratio (AλX/Aλmax) of the absorbance (AλX) at a wavelength differing from the maximum absorption wavelength to the absorbance (Aλmax) at the maximum absorption wavelength of ...

01/18/07 - 20070015140 - Method of examining specimen and specimen container to be used in the examination method
A method of immunologically examining a specimen which comprises attaching a cap having a filter impregnated with a labeled antibody enclosed therein to a container body containing a diluted liquid specimen, pouring the diluted liquid specimen from the container into a test device, observing the reaction and thus examining the ...

01/18/07 - 20070015139 - Biological reagents and methods to verify the efficiency of sample preparation and nucleic acid amplification and/or detection
This invention relates to reagent comprising: any one of cells, viral particles, organelles, parasites, cells comprising organelles, cells comprising viral particles, cells comprising parasites, cells comprising bacterial cells and any combination thereof, the cells, viral particles, organelles or parasites comprising at least one nucleic acid sequence serving as an internal ...

01/11/07 - 20070009885 - Methods and compositions for the detection of cervical disease
Methods and compositions for identifying high-grade cervical disease in a patient sample are provided. The methods of the invention comprise detecting overexpression of at least one biomarker in a body sample, wherein the biomarker is selectively overexpressed in high-grade cervical disease. In particular claims, the body sample is a cervical ...

01/11/07 - 20070009884 - Methods and apparatuses for detecting chemical or biological agents
The present invention provides methods and apparatuses for detection of pathogens or toxins in a sample. The invention also provides kits comprises reagents, including probes sets, and other consumables, such as surfaces, which can be used for detection of pathogens or toxins in a sample. ...

01/04/07 - 20070003925 - Multiplexed biological analyzer planar array apparatus and methods
A planar array having plurality of biological recognition molecules including at least two types of biological recognition molecules distributed about a substrate is disclosed. A first type of biological recognition molecules is distributed according to a first frequency and a second type of biological recognition molecules is distributed according to ...

01/04/07 - 20070003924 - Serial analysis of ribosomal and other microbial sequence tags
A simple and robust method for genetic analysis of complex microbial communities involves the steps of PCR amplification of V1 region of rrs genes in the community DNA sample using two universal primers, followed by cleavage by BsgI and removal of dual-biotinylated primers using streptavidin-coated magnetic beads to purify RSTs, ...

01/04/07 - 20070003923 - Modified fiber proteins for efficient receptor binding
Recombinant detargeted and retargeted adenovirus viral particles and vectors are provided. In particular, modified fibers from adenoviruses that bind to coxsackie-adenovirus receptor (CAR) in vivo that contain modifications in the fiber shaft are provided. Adenovirus (Ad) particles that express such fibers exhibit reduced binding to CAR. Hence detargeted Ad particles ...

12/28/06 - 20060292559 - Cell-based microarrays, and methods for their preparation and use
The present invention is in the field of chemistry and biotechnology. The present invention relates to cell-based microarrays, improved methods for forming such arrays, and methods for using such arrays in diagnostics, therapeutics and research. The invention particularly concerns microarrays in which ligands of a target cells are immobilized to ...

12/28/06 - 20060292558 - Methods and apparatus for protein assay diagnostics
Automated protein assay apparatus and methods for measuring antibodies against an analyte are described. A standard mixture of one or more analytes is loaded into a capillary, the analytes are resolved by isoelectric focusing and immobilized in the capillary. Serum from a human or non-human subject under analysis is flowed ...

12/28/06 - 20060292557 - Methods and compositions for detecting herpes simplex virus type 2
The invention provides methods for sensitive and specific detection of anti-HSV-2 antibodies by depletion of cross-reactive (non-specific) antibodies in a biological sample that can lead to a false positive result. The invention also features compositions, including nucleic acids, polypeptides, and kits, for use in the methods of the invention. ...

12/28/06 - 20060292556 - Method of detecting antibodies to hcv
A family of cDNA sequences derived from hepatitis C virus (HCV) are provided. These sequences encode antigens which react immunologically with antibodies present in individuals with non-A non-B hepatitis (NANBV), but which are absent from individuals infected with hepatitis A virus, or hepatitis B virus, and also are absent in ...

12/28/06 - 20060292555 - Biofunctional magnetic nanoparticles for pathogen detection
This invention provides a method of detecting pathogens comprising the steps of: (a) contacting a sufficient amount of biofunctional magnetic nanoparticles with an appropriate sample for an appropriate period of time to permit the formation of complexes between the pathogens in the sample and the nanoparticles; (b) using a magnetic ...

12/28/06 - 20060292554 - Major coat protein variants for c-terminal and bi-terminal display
The invention provides compositions and methods for enhanced display of heterologous proteins on viral particles. ...

12/28/06 - 20060292553 - Method for study of the genetic and functional variability of hiv and kit for using it
A method of analyzing a sample possibly containing an HIV virus, including a) extracting viral RNA in a biological sample that possibly contains an HIV virus; b) reverse transcription of the RNA obtained of (a) and amplification with a first pair of primers to obtain an amplified product of reverse ...

12/28/06 - 20060292552 - Method for the detection and multiplex quantification of analytes in a sample, using microspheres
The invention relates to a method for the detection and multiplex quantification of analytes in a sample, using functionalised microspheres, whereby said microspheres are magnetised after the sample has been brought into contact therewith. The inventive method is particularly suitable for the detection and multiplex quantification of several analytes by ...

12/28/06 - 20060292551 - Anti-viral activity of cathelicidin peptides
The disclosure provides methods and compositions useful in the treatment of dermatitis and viral infections. The compositions comprise cationic peptides of the cathelicidin family including LL-37, related homologues, and variants thereof. ...

12/21/06 - 20060286552 - Direct quantification of gene expression using capillary electrophoresis with laser-induced fluorescence
Provided is a method for direct quantification of gene expression using capillary electrophoresis with laser-induced fluorescence to measure RNA in a sample. Also provided is a method of diagnosing a disease in a subject, wherein the disease is caused by increased or decreased expression of a causative gene. ...

12/21/06 - 20060286551 - Rt-pcr detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (csfv) in samples
The present invention provides a rapid RT-PCR detection method and a diagnostic kit for differentiating field isolates of classical swine fever virus (CSFV) from lapinized CSF vaccine viruses in samples. In order to detecting different genotypes of CSF virus, this invention uses a pair (or pairs) of CSF virus specific ...

12/21/06 - 20060286550 - Substrates for isolating, reacting and microscopically analyzing materials
An immobilizing device for biological material comprises a rigid support (12) carrying a substrate layer (20, 20′) of polymer having biological immobilizing properties, e.g. for amino and nucleic acids. Substantially solid ultra-thin substrate layers (20′) having a thickness less than about 5 micron, preferably between about 0.1 and 0.5 micron, ...

12/21/06 - 20060286549 - Microfluidic system for identifying or sizing individual particles passing through a channel
An apparatus for characterizing and identifying individual particles, including: an input reservoir; at least one output reservoir; a channel connecting the input reservoir to the at least one output reservoir, wherein the channel is functionalized with at least one molecule selected to interact with a marker on a surface of ...

12/21/06 - 20060286548 - Method of making recombinant human antibodies for use in biosensor technology
According to the current invention and apparatus and methods are provided for the production of modified antibodies and calins for use in biosensor applications. ...

12/21/06 - 20060286547 - Time-of-addition assay for identifying anti-viral compounds
The present invention relates to a multi-well assay for identifying a compound inhibiting the replication cycle of a micro-organism, for example, HIV, and to an apparatus for carrying out an assay according to the present invention. The invention further relates to compounds identifiable with an assay according to the invention ...

12/21/06 - 20060286546 - Method and kit for the quantitative and/or qualitative detection of components in a sample
A method and kit for quantitatively and/or qualitatively detecting one or more components in samples, including the use of metal-particle labelled reagents and an antibody conjugate are disclosed. The components are capable of binding to a probe. A kit and method for staining components in cell and tissue sections, based ...

12/21/06 - 20060286545 - Viral vectors with improved properties
Methods to improve the tropism or other features of a virus is disclosed. Such methods can be used to prepare, e.g., DNA or plasmid libraries of variants of a gene encoding a viral capsid or envelope restriction site, libraries of viral clones with such variant genes with a randon-dy inserted ...

12/14/06 - 20060281077 - Label-free methods for performing assays using a colorimetric resonant reflectance optical biosensor
Methods are provided for detecting biomolecular interactions. The use of labels is not required and the methods can be performed in a high-throughput manner. The invention also relates to optical devices. ...

12/14/06 - 20060281076 - Substrate functionalization method for high sensitivity applications
A method for functionalizing substrates such as magnetic beads and glass slides is provided. The method involves providing substrate surfaces with activated polyacrylic acid (PAA) and attaching one or more desired capture probes. Substrates prepared by the method are particularly useful in ultrasensitive detection assays as they exhibit very low ...

12/14/06 - 20060281075 - Purification of viruses, proteins and nucleic acids
Viruses, virus-like particles and protein and nucleic acid components are extracted from biological material using high ionic strength, activated carbon and changes in pH. The purified compositions are stored in similar or different conditions preferably with a higher pH. ...

12/14/06 - 20060281074 - Affinity-based detection of biological targets
A method of biochemical identification by: providing a plurality of capture species bound to one or more substrates and suspected of having one or more biological targets affinity bound to at least one capture species; detecting which capture species contain bound biological targets to generate a binding pattern; and identifying ...

12/14/06 - 20060281073 - Broadening adenovirus tropism
Recombinant adenoviruses comprising modified fiber proteins which expand the tropism of the adenovirus in comparison to wild-type virus are disclosed. The modified fiber proteins described herein contain a peptide ligand for a cell surface binding site other than CAR comprising a 14 amino acid core sequence containing both fixed and ...

12/14/06 - 20060281072 - Agonistic binding molecules to the human ox40 receptor
The present invention provides binding molecules, such as human binding molecules, that bind to and stimulate the human OX40-receptor. The invention also provides nucleic acids encoding such binding molecules. Methods for producing such binding molecules are also provided by the present invention. The binding molecules and nucleic acids are useful ...

12/07/06 - 20060275754 - Method for a rapid test
The object of the invention is a method for a rapid test. In the method in accordance with the invention a particle reagent is placed into a separate sample or reagent receptacle or test tube, in which the particle reagent reacts with one or several analytes in the liquid sample, ...

12/07/06 - 20060275753 - Recovery of analytes using combinatorial libraries
The invention provides a method of binding multiple targets in samples by binding to multiple ligands. The method comprises providing ligands attached to a support, and contacting the ligands with targets to produce at least two target-ligand-support complexes. The method further comprises removal of non-bound targets followed by elution of ...

12/07/06 - 20060275752 - Multiparameteric method for assessing immune system status
The invention provides a multiparametric method of assessing the reaction of a patient's immune system to a test subject. The invention compares a patient sample reacted with a test sample and a third party sample and combines the assessments of the multiple parameters to correlate the test reaction with a ...

12/07/06 - 20060275751 - Methods and compositions for screening using diphtheria toxin constructs
The invention relates to methods and compositions utilizing diphtheria toxin for screening purposes. The invention is particularly useful in screening for modulators of IgE synthesis, secretion and switch rearrangement. ...

12/07/06 - 20060275750 - Bioreactive agents
This invention relates to agents and conjugates that can be used to detect and isolate target components from complex mixtures such as nucleic acids from biological samples, cells from bodily fluids, and nascent proteins from translation reactions. Agents comprise a detectable moiety bound to a photoreactive moiety. Conjugates comprise agents ...

12/07/06 - 20060275749 - Compositions for use in identification of orthopoxviruses
Oligonucleotide primers and compositions and kits containing the same for rapid identification of orthopoxviruses by amplification of a segment of viral nucleic acid followed by molecular mass analysis are provided. ...

12/07/06 - 20060275748 - Integrase cofactor
In a study of HIV-1 integrase (IN) complexes derived from nuclei of human cells stably expressing the viral protein from a synthetic gene it was demonstrated that in the nuclear extracts IN exists as part of a large distinct complex with apparent Stokes radius of 61 Å, which dissociates upon ...

12/07/06 - 20060275747 - Endogenous retrovirus up-regulated in prostate cancer
A specific member of the HERV-K family located in chromosome 22 at 20.428 megabases (22q11.2) has been found to be preferentially and significantly up-regulated in prostate tumors. The invention provides methods for diagnosing prostate cancer, comprising the step of detecting in a patient sample the presence or absence of an ...

12/07/06 - 20060275746 - Peptides which enhance transport across tissues and methods of identifying and using the same
A method of identifying a peptide which permits or facilitates the transport of an active agent through a human or animal tissue. A predetermined amount of phage from a random phage library or preselected phage library is plated unto or brought into contact with a first side, preferably the apical ...

11/30/06 - 20060269911 - Antisense antiviral compound and method for treating ssrna viral infection
The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Flaviviridae, Picomoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae families in the treatment of a viral infection. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides having a sequence ...

11/30/06 - 20060269910 - Assay methods for detection of a virus in an avian tissue sample
The invention relates to methods of detecting a virus in an avian tissue sample wherein genetic material derived from feathers is tested for the presence of genetic material from the virus. ...

11/23/06 - 20060263769 - Multiplex capture of nucleic acids
Methods of capturing two or more nucleic acids simultaneously from a single sample are provided. Different nucleic acids are captured through cooperative hybridization events on different subsets of particles or at different selected positions on a spatially addressable solid support. Compositions, kits, and systems related to the methods are also ...

11/23/06 - 20060263768 - Matrix screening method
The invention concerns a method which can be used to screen two or more repertoires of molecules against one another and/or to create combinatorial repertoires by combining two or more repertoires. In particular, the invention relates to a method whereby two repertoires of molecules can be screened such that all ...

11/23/06 - 20060263767 - Ultrasensitive detection of prions by automated protein misfolding cyclic amplification
A highly sensitive method is provided for the detection of prions in a sample. These methods may be used to diagnose prion mediated transmissible spongiform encephalopathies such as bovine spongiform encephalopathy, Creutzfeldt-Jakob disease, scrapie, or chronic wasting disease. In particular a method for serial automated cyclic amplification of prion is ...

11/23/06 - 20060263766 - Compositions and chromatography materials for bioseparation
The present invention relates to compositions and chromatography materials, such as materials for the separation of biomolecules. The composition can comprise granules comprising carbonaceous particles, and at least one carbonized substance selected from carbonized synthetic resins and carbonized pitches. The composition further comprises at least one organic group attached to ...

11/23/06 - 20060263765 - Peptides and mixtures thereof for use in the detection of severe acute respiratory syndrome-associated coronavirus (sars)
The present invention relates to novel peptides and mixtures thereof useful for detecting Severe Acute Respiratory Syndrome-associated coronavirus (SARS-CoV) infections in humans and animals. Therefore, the present invention provides SARS-CoV diagnostic methods and kits. ...

11/23/06 - 20060263764 - Methods and constructs for evaluation of rnai targets and effector molecules
Methods and constructs for selecting double-stranded RNA molecules capable of post-transcriptional gene silencing (PTGS) or RNA interference (RNAi); and methods of selecting targets susceptible to double-stranded RNA mediated PTGS or RNAi. ...

11/16/06 - 20060257863 - Viral detection method using viral encoded enzymes and chemiluminescent substrates
A chemiluminescent system for detecting the presence of influenza virus in a biological fluid sample is provided. An influenza diagnostic kit is provided which includes (1) a sampling device for obtaining the biological fluid from a subject, (2) a chemiluminescent substrate material which, in the presence of influenza virus in ...

11/16/06 - 20060257862 - A highly cost-effective analytical device for performing immunoassays with ultra high sensitivity
A simple easy to manufacture analytical device capable of performing membrane based immunoassays on batch of samples within 3 to 10 minutes wherein the method permits focused application of samples, costly labeled immunoassay and signal amplification reagents, said device includes an antibody-immobilized micro porous membrane, breadth corner layer of which ...

11/16/06 - 20060257861 - Screening assay for inhibitors of severe acute respiratory syndrome (sars) using seldi-tof mass spectrometry
Mass spectrometric methods directed to screening libraries of compounds for agents that inhibit entry of Severe Acute Respiratory Syndrome (SARS) coronavirus (CoV) into cells are provided, along with methods for comparatively evaluating inhibitors of the SARS CoV. ...

11/16/06 - 20060257860 - Compositions and assays to detect influenza virus a and b nucleic acids
Methods for detecting influenza virus A and influenza virus B nucleic acids in biological samples by using in vitro amplification and detection are disclosed. Compositions that are target-specific nucleic acid sequences and kits comprising target-specific nucleic acid oligomers for amplifying in vitro influenza virus A or influenza virus B nucleic ...

11/16/06 - 20060257859 - Recombinant enterovirus 71 neutralizing antibodies and applications thereof
Provided is an antibody against enterovirus 71 comprising the amino acid sequence shown in SEQ ID NOS: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or functionally active homologues thereof. Also provided are methods for obtaining the antibody comprising (a) selecting a yeast expressing ...

11/16/06 - 20060257858 - Methods and compositions for introducing biopolymers into cells
The invention relates to methods for introducing target biopolymers (e.g., nucleic acid molecules, proteins, etc.) and other compounds (e.g., non-polymeric organic molecules, such as steroids) into cells (e.g., eukaryotic cells). The invention further relates to compositions comprising target biopolymers and other compounds. In certain aspects, the invention relates to the ...

11/16/06 - 20060257857 - Methods for identifying functionally related genes and drug targets
The identification and evaluation of mRNA and protein targets associated with mRNP complexes and implicated in the expression of proteins involved in common physiological pathways is described. Effective targets are useful for treating a disease, condition or disorder associated with the physiological pathway. ...

11/16/06 - 20060257856 - Heterodimeric receptor libraries using phagemids
Filamentous phage comprising a matrix of cpVIII proteins encapsulating a genome encoding first and second polypeptides of an antogenously assembling receptor, such as an antibody, and a receptor comprised of the first and second polypeptides surface-integrated into the matrix via a filamentous phage coat protein membrane anchor domain fused to ...

11/16/06 - 20060257855 - Biological particulate matter analogue
The present invention provides a biological particle analogue, or biological analogue, that simulates a chosen biological organism or compound. The biological analogue includes a first portion that is not, in and of itself, recognized by the biological detection system, and a second portion, which provides the properties necessary for recognition ...

11/16/06 - 20060257854 - Membrane assay system including preloaded particles
Described herein is an analyte detection device and method related to a portable instrument suitable for point-of-care analyses. In some embodiments, a portable instrument may include a disposable cartridge, an optical detector, a sample collection device and/or sample reservoir, reagent delivery systems, fluid delivery systems, one or more channels, and/or ...

11/16/06 - 20060257853 - Autonomous surveillance system
A detection system includes a collector for capturing a first particle, a first device for determining a class of a second particle, a second device for determining an identity of the first particle, and a control system. The control system is configured to select a test to be performed by ...

11/16/06 - 20060257852 - Severe acute respiratory syndrome coronavirus
An outbreak of a virulent respiratory virus, now known as Severe Acute Respiratory Syndrome (SARS), was identified in Hong Kong, China and a growing number of countries around the world in 2003. The invention relates to nucleic acids and proteins from the SARS coronavirus. These nucleic acids and proteins can ...

11/16/06 - 20060257851 - Bioinformatically detectable group of novel viral regulatory genes and uses thereof
The present invention relates to a first group of novel genes, here identified as genomic address messenger or VGAM genes, and a second group of novel operon-like genes, here identified as viral genomic record or VGR genes. VGAM genes selectively inhibit translation of known ‘target’ genes, many of which are ...

11/16/06 - 20060257850 - Methods of treatment and diagnosis of patients with hepatitis c infection
Use of a compound capable of modulating the level of activity of the OAS gene and/or activity of the OAS protein, in the manufacture of a medicament for the treatment of a patient with or at risk of hepatitis C infection, wherein the compound is not an interferon or an ...

11/16/06 - 20060257849 - Method of screening for therapeutics for infectious diseases
The present invention relates to a method of screening for a host cell gene products which are useful as therapeutics for an infective disease. This method comprises identifying genes which are differentially expressed in infected cells, and screening the differentially expressed gene products for immunogenicity. ...

11/09/06 - 20060252033 - Carrier of a diamond fine particle for immobilizing virus
The present invention provides a carrier for immobilizing a bio-derived polymer, and especially, the present invention provides a carrier of diamond fine particle for immobilizing a DNA, RNA, protein and peptide, as well as a DNA chip substrate, a carrier for trapping virus and a vaccine. The carrier is prepared ...

11/09/06 - 20060252032 - Detection of human herpesviruses
The present invention provides methods, compositions, and kits related to nucleic acid detection assays for detecting human herpes virus. For example, the present invention provides detection assays for detecting human herpes virus subtypes HHV1- through HHV-8. ...

11/09/06 - 20060252031 - Bead based assays using a liquid crystal reporter
The present invention relates to the field of detection of analytes, and in particular to detection of viruses, cells, bacteria, lipid-membrane containing organisms, proteins, nucleic acids, carbohydrates and other biomolecules, organic molecules and inorganic molecules using a liquid crystal assay format. ...

11/09/06 - 20060252030 - Fabrication of carbohydrate chips by immobilizing unmodified carbohydrates on derivatized solid surfaces, and their uses
The present invention relates to the fabrication of carbohydrate chips wherein free carbohydrates are immobilized on a modified solid surface. More specifically, it relates to a fabrication method for carbohydrate chips wherein unmodified carbohydrates irrespective of their size are site-specifically and covalently attached to the solid surface derivatized by hydrazide ...

11/09/06 - 20060252029 - Detection of hpv-induced invasive cancers and their precursor lesions with invasive potential
The invention is in the field of medicine and is concerned with a molecular diagnostic marker for progression to invasiveness of HPV-induced premalignant lesions and future metastatic potential of HPV-induced premalignant lesions and carcinomas. In particular the present invention relates to the use of the TSLC1 gene as marker for ...

11/09/06 - 20060252028 - Method of assaying interaction between proteins
A novel method for determining interaction between VH fragment and VL fragment of the variable region of an antibody is provided by the present invention. The method according to this invention can be widely used for detection of protein interactions. If a phagemid vector containing an amber codon is used ...

11/02/06 - 20060246429 - Dot-elisa for the detection of animal viruses
A monoclonal antibody-based Dot-ELISA assay for the rapid detection of animal viruses such as avian influenza virus. The assay includes applying a specimen suspected of containing an animal virus on a porous membrane and treating the specimen with a solution of citric acid or lactic acid and a solution containing ...

11/02/06 - 20060246428 - Polynucleotide probe and primer derived from hepatitis e virus recovered from japanese, chip including the same, kit including the same, and method of detecting hepatitis e virus genome using the same
A polynucleotide probe that has a sequence of at least 8 nucleotides which can be hybridized with nucleotides from the hepatitis E virus JRA 1; a probe assay kit that includes the polynucleotide probe; and a chip on which the polynucleotide probe has been solid-phase fixed. ...

11/02/06 - 20060246427 - Method for determining the mechanism of hiv rt inhibitors
The present invention is directed to the field of HIV resistance to RT inhibitors and methods of determining the levels and mechanisms of action of HIV resistance. The methods of the present invention may be accomplished using a novel in vitro assay that provides a reaction well comprising a template ...

11/02/06 - 20060246426 - Recombinant fusion proteins with high affinity binding to gold and applications thereof
The present invention provides a method to firmly attach any polypeptide to a gold surface regardless of its intrinsic gold-binding properties. The method describes the production of recombinant fusion proteins consisting of polypeptides of interest and a high affinity gold binding peptide consisting of 1 to 7 repeats of a ...

11/02/06 - 20060246425 - Assay for porcine circovirus production
The present invention provides methods for the determination of the viral titer of a culture of host animal host cells infected with a circovirus. The FACS-based methods of the invention may include determining the viability of the host cells in a cell culture medium supernatant and of those cells that ...

11/02/06 - 20060246424 - Self-replicating rna molecule from hepatitis c virus
A unique HCV RNA molecule is provided having an enhanced efficiency of establishing cell culture replication. Novel adaptive mutations have been identified within the HCV non-structural region that improves the efficiency of establishing persistently replicating HCV RNA in cell culture. This self-replicating polynucleotide molecule contains, contrary to all previous reports, ...

11/02/06 - 20060246423 - Method and kit for the collection and maintenance of the detectability of a plurality of microbiological species in a single gynecological sample
A method and kit related thereto are described for the collection and maintenance of detectability of a plurality of species of microbiological agents selected from the group consisting of bacteria, fungi, viruses, and protozoa, in a single gynecological sample which comprises providing transport media in a resealable container and instructions ...

11/02/06 - 20060246422 - Methods and compositions for use in spliceosome mediated rna trans-splicing
The molecules and methods of the present invention provide a means for in vivo production of a trans-spliced molecule in a selected subset of cells. The pre-trans-splicing molecules of the invention are substrates for a trans-splicing reaction between the pre-trans-splicing molecules and a pre-mRNA that is uniquely expressed in the ...

11/02/06 - 20060246421 - Compounds and methods for inhibiting hepatitis c virus replication
The inventors have discovered that an ATPase-deficient dominant-negative mutant NS3 protein of hepatitis C virus inhibits activity of the wild-type NS3 protein and inhibits replication of hepatitis C virus (HCV). The solved crystal structure of a multi-enzyme NS3 complex on a DNA substrate is also provided. The inventors have tested ...

11/02/06 - 20060246420 - In vitro diagnostic test for enterovirus infections
The present invention is related to an in vitro diagnostic assay of enteroviruses, based on the revealing of an immunologic reaction of antigen-antibody recognition type, using antigens or epitopes thereof that do not induce antiviral neutralising antibodies but induce “facilitating” antibodies which increase the viral infection. ...

10/26/06 - 20060240415 - Screening compound libraries using an optical fiber array device capable of simultaneously performing multiple functional assays
Disclosed is a method of screening Compounds wherein target cells are coated onto a population of microbeads, and wherein each microbead is coated with several cells of the same cellular type and has an assay and an assay reporter associated with it. Each of the cell-coated microbeads are positioned in ...

10/26/06 - 20060240414 - Genetically engineered glutaminase and its use in antiviral and anticancer therapy
DNA encoding a therapeutically suitable glutaminase has been molecularly cloned. This allows one to obtain a polypeptide which is a therapeutically suitable glutaminase free of contaminating endotoxin. It has been found that this polypeptide is a potent anti-viral agent and when coupled to an anti-tumor monoclonal antibody is a potent ...

10/26/06 - 20060240413 - Medical test probe for cell sample collection
A device and method are disclosed for collecting biological samples. One embodiment includes a device for collecting biological samples comprising a probe having a cell collector located on a distal end, the probe having a plurality of distinct raised protrusions. ...

10/26/06 - 20060240412 - Compositions for use in identification of adenoviruses
The present invention provides compositions, kits and methods for rapid identification and quantification of adenoviruses by molecular mass and base composition analysis. ...

10/26/06 - 20060240411 - Multiplex microparticle system
Arrays of microparticle populations, each population labeled with a single fluorescent dye, are provided for use in multiplex assays. The populations form a virtual multidimensional array wherein each microparticle is identified by fluorescence intensity in two different fluorescence detection channels. The arrays are useful in a variety of assays, including ...

10/26/06 - 20060240410 - Retroviral protease inhibitor combinations
The present invention is directed to a method for the treatment of mammalian retrovirus infections, such as HIV, using combinations of retroviral protease inhibitors which are effective in preventing the replication of the retroviruses in vitro or in vivo. This invention, in particular, relates to protease inhibitor compounds used in ...

10/26/06 - 20060240409 - Method for extraction and identification of nucleic acids
The invention provides a method for extracting nucleic acids from a sample. The sample contains cells, viruses, or both cells and viruses. The method include adding a lysing solution containing a detergent to the sample to lyse the cells or viruses to form a lysate, adding alcohol to the lysate ...

10/26/06 - 20060240408 - Method of purifying nucleic acid using silver nanoparticles
Provided is a method of purifying a target substance using silver nanoparticles. The method includes: mixing a sample containing molecules having a thiol group with the silver nanoparticles to obtain a complex of the molecules having the thiol group with the silver nanoparticles; and isolating and removing the complex from ...

10/26/06 - 20060240407 - Detection and identification of enteroviruses
Disclosed herein are methods of using enterovirus-specific primers for the detection and identification of enterovirus infection. Also provided herein are isolated nucleic acid molecules and kits useful for detection and diagnostic testing of enterovirus infection in a subject. ...

10/26/06 - 20060240406 - Method for the detection of proteolytic enzymes
The present invention provides an improved protease assay in which the proteases are detected on basis of their capability to cleave a modified pro-caspase which will yield an activated caspase which can then further be detected. Also part of the invention are the modified pro-caspases and kits comprising said modified ...

10/26/06 - 20060240405 - Method for assaying replication of hbv and testing ... drugs
A method for measuring the replication capacity of HBV, e.g. HBV present in a biological sample, possibly in the presence of a pharmaceutical product, in particular an antiviral agent, the method comprising: (a) possibly extracting nucleic acids contained in the biological sample; (b) PCR amplifying HBV nucleic acids using at ...

10/19/06 - 20060234215 - Rapid exchange luminescence (rel) for high sensitivity detection
A bioswitch is described which includes a long-lived emitter such as a lanthanide luminophore for time gated detection of ligand binding without interfering background signal. ...

10/19/06 - 20060234214 - Methods of detecting hepatitis c virus
The present invention provides a sensitive and specific test for hepatitis C virus. The test detects the presence of particular core antigens of hepatitis C, which appear earlier after initial infection than antigens or viral genetic materials used in previously-developed assays. The invention test allows detection of hepatitis C infection ...

10/19/06 - 20060234213 - Synthetic peptides useful in biological essays for detecting infections caused by group o hiv-1 viruses
wherein Δis a biotinyl radical, a biocytinyl radical, a hydrogen atom, an acetyl (CH3CO—) radical, an aliphatic chain which may contain one or two thiol, an aldehyde functional group, or an amine functional group, Z represents peptide sequence -1-Ser-2-, -1-Gln-2-, or -1-Asn-2-, wherein -1 represents a peptide sequence of 0 ...

10/19/06 - 20060234212 - Hepatitis-b viral variants with reduced susceptibility to nucleoside analogs and uses thereof
The present invention relates generally to the field of Hepatitis B variants exhibiting a reduced sensitivity to nucleoside analogues, both in vivo and in vitro. More in particular, reverse transcriptase mutant rtA181S is provided. Present invention provides assays and methods for detecting such variant, which assays are useful in monitoring ...

10/19/06 - 20060234211 - Peptides for detection of antibody to porcine reproductive respiratory syndrome virus
The invention provides compositions and methods for the detection and quantification of PRRSV antibodies and antibody fragments using polypeptides. ...

10/19/06 - 20060234210 - Filtration device and method for removing selected materials from biological fluids
A filter and method for removing selected materials from a biological fluid sample are provided. The filter comprises an outer housing, inlet, and outlet. A plurality of filter surfaces are provided within the outer housing, and at least one coating is applied to the filter surfaces. The at least one ...

10/19/06 - 20060234209 - Microchip-based system for hiv diagnostics
The invention relates to microchip-based assays to measure HIV-associated analytes of interest (e.g., CD4 lymphocytes, HIV RNA and liver enzymes) in a sample from a subject infected with the HIV virus. Methods of the present invention are optimal for use in monitoring HIV disease in resource-poor settings. ...

10/19/06 - 20060234208 - Novel mechanism for hiv-1 entry into host cells and peptides inhibiting this mechanism
This invention relates to the finding that TAT interacts with gp120 at the cell surface and enhances HIV-1 entry into host cells. This invention also discloses modulators of this interaction, particularly peptides that mimic the region of gp120 involved in this interaction. These peptides interfere with TAT-mediated enhancement of infection ...

10/12/06 - 20060228702 - Polynucleotide probe and primer derived from hepatitis e virus recovered from japanese, chip including the same, kit including the same, and method of detecting hepatitis e virus genome using the same
A polynucleotide probe that has a sequence of at least 8 nucleotides and is used for detecting at least one hepatitis E virus selected from JSN-FH, JKN-Sap, JMY-Haw, JAK-Sai, and JRA1; a probe assay kit that includes the polynucleotide probe; and a chip on which the polynucleotide probe has been ...

10/12/06 - 20060228701 - Arrays of protein-capture agents and methods of use thereof
Arrays of protein-capture agents useful for the simultaneous detection of a plurality of proteins which are the expression products, or fragments thereof, of a cell or population of cells in an organism are provided. A variety of antibody arrays, in particular, are described. Methods of both making and using the ...

10/12/06 - 20060228700 - Novel retrovirus associated with myelodysplastic syndromes and uses thereof
The present invention relates first, to the identification of a novel retrovirus and the novel nucleotide sequences encoding a retroviral polymerase gene (POL nucleotides) associated with the existence of MDS and MDS associated disorders. The present invention further relates to methods for using the MDS associated retroviral nucleotides for the ...

10/12/06 - 20060228699 - Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the AIDS causing Human Immuno-deficiency Virus (HIV). With the present invention nucleotide sequences are provided that can be used as primers and probes in ...

10/12/06 - 20060228698 - Oligonucleotide for detection of hiv-1 and detection method
An oligonucleotide useful for detection of an RNA derived from HIV-1 consisting of at least 10 consecutive bases in any of SEQ ID NOS:1, 2, 4 to 10 and 13 to 17, which can bind to a specific site of the RNA. ...

10/12/06 - 20060228697 - Method to confer cell culture replication activity to different hepatitis c virus isolates
The present invention features methods for producing HCV replicons using HCV encoding sequences from different isolates. The featured methods are based on the discovered importance of NS3 amino acid position 470 in conferring cell culture replication activity to different HCV isolates. ...

10/12/06 - 20060228696 - Methods for detecting and inactivating a prion
A method for the isolation or detection of a prion in a sample is disclosed. Also disclosed are methods for the disinfection and/or decontamination and/or inactivation of TSE infectivity. ...

10/05/06 - 20060223058 - In vitro association studies
Cell and tissue autonomous phenotypes are correlated with genotype information. Correlated genotype information is used to screen individual traits. Methods and systems for correlating cell and tissue autonomous phenotypes to genotype information are provided. ...

10/05/06 - 20060223057 - Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the AIDS causing Human Immuno-deficiency Virus (HIV). With the present invention nucleotide sequences are provided that can be used as primers and probes in ...

10/05/06 - 20060223056 - Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the AIDS causing Human Immuno-deficiency Virus (HIV). With the present invention nucleotide sequences are provided that can be used as primers and probes in ...

10/05/06 - 20060223055 - Methods and compositions for treatment of viral lnfection
The present invention relates to methods and compositions for the treatment and/or prevention of diseases or disorders associated with viral infection. Accordingly, the nucleotide and amino acid sequences for a human Brd4 protein are provided. Also provided are complexes comprising Brd4 and an E2 protein or a functional equivalent of ...

10/05/06 - 20060223054 - Methods for identifying a peptide that binds a geometrical shape
Provided herein are methods, such as phage display assays, for bioengineering peptides that bind to geometrically and/or atomically structured molecular surfaces such as, for example, flat surfaces, smooth curved surfaces, as well as surfaces with periodic, random, or fractal atomic configurations. Surface-binding peptides are provided that are identified using the ...

10/05/06 - 20060223053 - Direct measurement of sorption on three-dimensional surfaces such as resins, membranes or other preformed materials using lateral dispersion to estimate rapid sorption kinetics or high binding capacities
Described are methods allowing measurement of adsorption and desorption of analytes with membranes or resins directly using surface plasmon resonance (SPR). Also described are methods for assembling intact resins or membranes on SPR surfaces. Such methods provide estimates of mass-action ion-exchange adsorption and desorption rates accounting for steric (σ) and ...

10/05/06 - 20060223052 - Technique for detecting microorganisms
A technique for detecting the presence of microorganisms in a simple, rapid, and efficient manner is provided. More specifically, the technique involves identifying one or more volatile compounds associated with a particular microorganism of interest. The volatile compounds may be identified, for instance, using solid phase microextraction in conjunction with ...

09/28/06 - 20060216704 - Water-soluble conjugates for electrochemical detection
The present invention provides methods of detecting the presence or amount of an analyte in a sample. The methods involve contacting a surface coated with a specific binding molecule to the analyte to be detected with the sample, contacting the surface coated with the specific binding molecule to the analyte ...

09/28/06 - 20060216703 - Extraction and concentration method
A method for extraction and concentration of antibodies, antigens, bacteria and virus from biological samples. The method also provides a preparation that is suitable for use as a vaccine. The method includes the addition of liquid carboxylic acids and a centrifugation step. ...

09/28/06 - 20060216702 - Virus-like particles, methods of preparation, and immunogenic compositions
Briefly described, virus-like particles, methods of preparing virus-like particles, immunogenic compositions that include virus-like particles, and methods of eliciting an immune response using immunogenic compositions that include virus-like particles are described herein. A virus-like particle (VLP) can include a viral core protein that can self assemble into the VLP core ...

09/28/06 - 20060216701 - Screening methods for identifying viral proteins with interferon antagonizing functions and potential antiviral agents
The present invention relates, in general, to a screening method for identifying novel viral proteins with interferon antagonizing function using a transfection-based assay, and the use of such proteins in isolating various types of attenuated viruses for the development of vaccine and pharmaceutical formulations. The invention also relates to the ...

09/28/06 - 20060216700 - Metapneumovirus strains and their use in vaccine formulations and as vectors for expression of antigenic sequences and methods for propagating virus
The invention relates to improved strains of mammalian negative strand RNA virus, metapneumovirus (MPV), within the sub-family Pneumoviridae, of the family Paramyxoviridae. The invention further related to methods for propagating mammalian MPV in the absence of trypsin. The methods and compositions of the invention can be used for the preparation ...

09/28/06 - 20060216699 - Peptides for the detection of hiv-1 group o
This invention relates to peptides and their preparation. The peptides each have a sequence that corresponds to the immunodominant region of the HIV-1 group O gp41 envelope protein. The sequence is characterized in that it does not correspond to any known naturally occurring group O sequence or variant. Furthermore, the ...

09/28/06 - 20060216698 - Fusion expression vector containing the his-tagged vitreoscilla hemoglobin coding gene
The present invention relates to method of providing color to aid in the expression and purification of proteins of E. coli. Vector according to the present invention includes the His-tagged Vitreoscilla hemoglobin (VHb) coding gene upstream of the multiple cloning site. The vector was designed to express target proteins as ...

09/28/06 - 20060216697 - Method of separating unattached raman-active tag from bioassay or other reaction mixture
A super-paramagnetic Raman-active complex that includes a Raman-active tag attached to a target and a super-paramagnetic bead attached to the target is disclosed. A method of separating a Raman or surface enhanced Raman-active tag unattached to a target from a Raman-active complex is also disclosed. The Raman-active complex includes a ...

09/28/06 - 20060216696 - Rapid plague detection system
The present invention provides a system including a compact biological agent detector that determines the presence and amount of a biological agent by a specific immunoassay and furnishes a rapid and convenient readout of the immunoassay results. In another aspect, the invention provides a method of determining the presence and ...

09/28/06 - 20060216695 - Diluent for norovirus or sapovirus specimen and method for detecting virus
The present invention relates to a diluent for a Norovirus or Sapovirus specimen, the diluent containing an alkaline buffer of pH 9.0 to 10.0, and to a method for detecting a Norovirus or a Sapovirus through use of the diluent. According to the present invention, a Norovirus or a Sapovirus ...

09/28/06 - 20060216694 - Use of a virus expressing a binding moiety to measure analytes in a sample
The use of a virus, which expresses and displays a binding moiety, as a means of detecting the presence or measuring the concentration of an analyte in a sample. The virus, which is typically a bacteriophage expressing a binding moiety, is used as a binding reagent in an immunoassay, and ...

09/28/06 - 20060216693 - Method of screening compounds which inhibit the initiation of the retrotranscription of the rna of virus hiv-1 and means for implementing same
The present invention relates to methods for screening compounds that can inhibit the early stage of an infection by the HIV-1 virus, that is to say the initiation step of viral genome reverse transcription, before integrating viral sequences into the cellular genome of the infected host organism. ...

09/28/06 - 20060216692 - Switchable nucleic acids for diagnostics, screening and molecular electronics
In one embodiment, the present invention relates to fluorescent nucleic acid constructs and methods of using these switchable constructs to rapidly screen for target molecule interactions. More particularly, an RNA/DNA chimera comprising a fluorophore-quencher pair and a nucleic acid construct is disclosed for the rapid screening of interactions between the ...

09/28/06 - 20060216691 - Method for isolating hepatitis c virus peptides
Described is a method for isolating Hepatitis C Virus peptides (HPs) which have a binding capacity to a MHC/HLA molecule or a complex comprising said HCV-peptide and said MHC/HLA molecule characterized by the following steps: —providing a pool of HCV-peptide, said pool containing HCV-peptides which bind to said MHC/HLA molecule ...

09/21/06 - 20060210970 - Methods, compositions and kits for biomarker extraction
The present invention is directed to methods for extracting markers from biological samples, and to systems, devices, kits and reagents for use in such methods. The invention is also to methods, kits, reagents and compositions for measuring a plurality of different organism types in a sample. One of the specific ...

09/21/06 - 20060210969 - Infectious, chimeric hepatitis c virus, methods of producing the same and methods of use thereof
The present invention provides infectious recombinant Hepatitis C Viruses (HCV), and vectors, cells and animals comprising the same. The present invention provides methods of producing infectious recombinant HCV, and their use in identifying anti-HCV therapeutic agents, as well as sequences of HCV associated with HCV pathogenesis. ...

09/21/06 - 20060210968 - Template reporter bacteriophage platform and multiple bacterial detection assays based thereon
The invention is a method for the development of assays for the simultaneous detection of multiple bacteria. A bacteria of interest is selected. A host bacteria containing plasmid DNA from a T even bacteriophage that infects the bacteria of interest is infected with T4 reporter bacteriophage. After infection, the progeny ...

09/21/06 - 20060210967 - Re-sequencing pathogen microarray
The present invention relates to pathogen detection and identification by use of DNA resequencing microarrays. The present invention also provides resequencing microarray chips for differential diagnosis and serotyping of pathogens present in a biological sample. The present invention further provides methods of detecting the presence and identity of pathogens present ...

09/21/06 - 20060210966 - Kits and methods for detecting bovine ephemeral fever virus
The present invention relates to a kit and method for detecting BEFV of suspected patient. The present invention also relates to primers and probe used to detect BEFV. ...

09/21/06 - 20060210965 - Efficient generation of adenovirus-based libraries by positive selection of adenoviral recombinants through ectopic expression of the adenovirus protease
Disclosed is a new system for generating recombinant adenovirus vectors and adenovirus-based expression libraries, by positive selection of recombinants deleted for the endogenous protease gene, which gene is expressibly cloned into another region of the adenoviral genome. In a preferred embodiment, the invention allows positive selection of E1-deleted, protease-deleted recombinant ...

09/14/06 - 20060204955 - Method for the production of bacterial toxins
Methods and compositions are provided for the enhanced production of bacterial toxins in large-scale cultures. Specifically, methods and compositions for reducing bacterial toxin expression inhibitors are providing including, but not limited to, addition of toxin expression inhibitor binding compounds, culture media having reduced concentrations of toxin inhibitor metabolic precursors and ...

09/14/06 - 20060204954 - Compositions and methods for binding agglomeration proteins
Amplibody compositions and methods used to interact with agglomeration proteins are disclosed herein. Compositions herein comprise one or more DNA or RNA molecules having affinity for at least one agglomeration protein. The nucleic acid component is a naturally or non-naturally occuring molecule with twenty or more ribonucleotide bases. For RNA, ...

09/07/06 - 20060199177 - T helper cell epitopes
The present invention provides T helper cell epitopes and compositions for use in inducing an immune response comprising at least one of these epitopes. The epitopes are contained within a peptide sequence selected from the group consisting of EPINQALTLMTKNVKPL (SEQ ID NO: 12); FAGVVLAGVALGVATAA (SEQ ID NO: 13); NLNAQAIQSLRTSLEQS (SEQ ...

09/07/06 - 20060199176 - Coronavirus s peptides
Isolated polypeptides containing SEQ ID NO: 3 and functional equivalents thereof. Also disclosed are isolated nucleic acids encoding the polypeptides, related expression vectors, related host cells, related antibodies, and related compositions. Methods of producing the polypeptide, diagnosing infection with a coronavirus, and identifying a test compound for treating infection with ...

09/07/06 - 20060199175 - Novel field testing method and device for detection of equine protozoal myeloencephalitis
The present invention discloses a quick, simple, qualitative and semi-quantitative immunologic method and device in a field test kit format for the detection and the stage of infection of certain protozoal, viral, bacterial, or nematodal pathogens in body fluids, using vaccines specific to such pathogens as antigens. The method comprises ...

09/07/06 - 20060199174 - Methods and compositions for identifying anti-hcv agents
The invention provides methods and compositions for identifying agents for treating infection by viruses that encode a nucleotide-binding NS4B protein, or functional equivalent thereof, e.g., hepatitis C virus (HCV) or other members of the family Flaviviridae. In general, the methods involve contacting an NS4B nucleotide binding motif (NBM)-containing polypeptide with ...

08/31/06 - 20060194198 - Use of fibrous protein fibers for chemical sensing and radiation detection
Fibrous protein fibers such as keratin fibers can be used to detect chemicals and radiation. One aspect of the invention is a method of detecting an analyte in a sample comprising the steps of: (1) providing a fiber of fibrous protein; (2) contacting the fiber of fibrous protein with an ...

08/31/06 - 20060194197 - Biosensors utilizing dendrimer-immobilized ligands and their use thereof
The present invention is directed to methods and compositions useful as biosensors that specifically interact with various pathogens and other target analytes. The biosensor itself, comprises functionalized dendritic tethers derivatized for attachment to a variety of surfaces as self-assembled monolayers (SAMs) as well as attached binding moieties (sometimes referred to ...

08/31/06 - 20060194196 - Novel surface protein (hbsag) variant of the hepatitis b virus
The invention relates to sequences of a novel variant of the Hepatitis B surface antigen (HBsAg) and to methods for detecting, in patient samples, nucleic acids, antigens and antibodies directed against the same. ...

08/31/06 - 20060194195 - Multiple antigenic peptide assay for detection of hiv or siv type retroviruses
A method for detecting at least one antibody directed against at least one primate immunodeficiency virus in a biological sample that includes contacting a biological sample with (i) at least one detection multiple antigenic peptide comprising a portion of an immunodominant region of a transmembrane protein of a primate immunodeficiency ...

08/24/06 - 20060188874 - Methods and compositions for colorimetrically assessing peptide characteristics
Methodologies and compositions useful for calorimetrically assessing peptide characteristics. By way of example, the methodologies can be used to qualitatively and quantitatively assess the degree to which a peptide sample incorporates beta sheet content. The colorimetric information also information is useful to predict solubility, formulating, and other peptide characteristics impacted ...

08/24/06 - 20060188873 - Method for detecting a target polynucleotide
A method of detecting a target polynucleotide using a solution phase nucleic acid sandwich assay, wherein the solid support is an optical planar waveguide, and the label is detected by measuring the luminescence that is excited in the evanescent field of the waveguide-A fully automated system may be used. The ...

08/24/06 - 20060188872 - Novel post-transcriptional regulatory elements and uses thereof
The invention provides a novel post-transcriptional regulatory element that can function as an RNA nucleo-cytoplasmic transport element. The invention also provides for an attenuated HIV-1 hybrid virus for use as a vaccine and a kit incorporating the hybrid virus. The kit also includes instructional material teaching the use of the ...

08/24/06 - 20060188871 - Detection of very virulent infectious bursal disease virus
Methods of identifying animals infected with a vvIBDV are provided. The methods comprise contacting a nucleic acid sample obtained from the animal or a nucleic acid product obtained by amplifying RNA obtained from the animal with one or more probe pairs, each of which comprises a mutation probe and an ...

08/17/06 - 20060183113 - Infectious cdna clone of north american porcine reproductive and respiratory syndrome (prrs) virus and uses thereof
The invention provides isolated polynucleotide molecules, including plasmids; viral vectors; and transfected host cells that comprise a DNA sequence encoding an infectious RNA sequence encoding a North American PRRS virus; and also North American PRRS viruses encoded thereby. The invention further provides isolated infectious RNA molecules encoding a North American ...

08/17/06 - 20060183112 - Method of separating biomolecules using nanopore
Provided is a method of separating particles, the method comprising: forming a first chamber and a second chamber separated by an interface with a pore, wherein the first and second chambers have electrodes with different polarities; placing particles to which a target biomolecule is bound from particles to which the ...

08/17/06 - 20060183111 - Primary human hepatocytes for native hepatitis c virus (hcv) replication
Novel methods are disclosed for the long-term culture of human primary hepatocytes in tissue culture system. This culture system supports the replication, gene expression and dissemination of a multitude of pathogenic agents that reside in, or pass through, the liver. Among these, the invention advantageously provides for efficient hepatitis C ...

08/17/06 - 20060183110 - Methods of evaluating cell surface receptor binding of a patient derived population of viral envelope protein constructs
The invention provides a method for identifying whether a compound inhibits entry of a virus into a cell which comprises: (a) obtaining nucleic acid encoding a viral envelope protein from a patient infected by the virus; (b) co-transfecting into a first cell (i) the nucleic acid of step (a), and ...

08/17/06 - 20060183109 - Cleavage of nucleic acids
The present invention relates to means for cleaving a nucleic acid cleavage structure in a site-specific manner. Enzymes, including 5′ nucleases and 3′ exonucleases, are used to detect and identify nucleic acids derived from microorganisms. Methods are provided which allow for the detection and identification of bacterial and viral pathogens ...

08/17/06 - 20060183108 - Method for diagnosis and monitoring of viral infection by analysis of viral transrenal nucleic acids in urine
The present invention relates to methods for diagnosis or monitoring of viral infection by detecting the presence of transrenal viral nucleic acids or nucleic acids of viral origin in urine sample, with or without isolation of nucleic acids from a urine sample. The analysis of the nucleic acids is performed ...

08/17/06 - 20060183107 - Method for diagnosis and monitoring of pathogenic infection by analysis of pathogenic transrenal nucleic acids in urine
The present invention relates to a method for diagnosing and/or monitoring a bacterial or parasitic infection by detection and quantification of the transrenal nucleic acids, derived from bacterial pathogenic agents or from parasites, in urine. The detection method optionally includes the isolation and the purification of the nucleic acids from ...

08/17/06 - 20060183106 - Processes for identifying quadruplex-targeted antiviral molecules
Featured herein are processes useful for identifying candidate molecules that interact with a quadruplex structure formed in the central flap nucleic acid of retroviruses. The candidate molecules identified by the process may be used as antiviral agents. ...

08/10/06 - 20060177820 - Srsv detection kit
This invention relates to an SRSV detection kit comprising all antibodies against SRSV-related virus constituting peptides selected from the following peptide groups (a) to (k), respectively: (a) a peptide having an amino acid sequence represented by SEQ ID NO: 1, and the like, (b) a peptide having an amino acid ...

08/10/06 - 20060177819 - Alphavirus replicon vector systems
The present invention provides compositions useful in and methods for producing populations of infectious, replication-defective alphavirus replicon particles that contain no replication competent alphavirus particles, as determined by passage on cells in culture. The compositions include helper and replicon nucleic acid molecules that can further reduce the predicted frequency for ...

08/10/06 - 20060177818 - Method of detection of classical swine fever
The invention relates to a multiplex real-time RT-PCR assay with a heterologous internal control system (i.e., EGFP-RNA) for the simple and fast diagnosis of classical swine fever virus (CSFV). Primers and FAM-labeled TaqMan probes, specific for CSFV were selected by analyzing the consensus sequence of the 5′-non translated region of ...

08/10/06 - 20060177817 - Codon-optimized papilloma virus sequences
Synthetic DNA molecules encoding the HPV31 L1 protein are provided. Specifically, the present invention provides polynucleotides encoding HPV31 L1 protein, wherein said polynucleotides are free from internal transcription termination signals that are recognized by yeast. Also provided are synthetic polynucleotides encoding HPV31 L1 wherein the polynucleotides have been codon-optimized for ...

08/03/06 - 20060172288 - Methods for the treatment of cellular proliferative disorders
The present invention relates to methods of identifying the susceptibility of cells to reovirus infection by measuring constitutive ras-MAP signaling. The invention also pertains to methods using reovirus for the treatment of cellular proliferative disorders, and particularly cellular proliferative disorders wherein the proliferating cells exhibit constitutive MAPK phosphorylation, in mammals. ...

08/03/06 - 20060172287 - Murine calicivirus
The invention disclosed herein relates to a newly discovered murine norovirus, and compositions and methods related thereto. ...

08/03/06 - 20060172286 - Diagnosis method of alcholic or non-alcoholic steato-hepatitis using biochemical markers
The present invention is drawn to a new diagnosis method for detecting the extent of alcoholic or non-alcoholic steato-hepatitis in a patient, in particular in a patient suffering from a disease involving alcoholic or non-alcoholic steato-hepatitis or who already had a positive diagnosis test of liver fibrosis and/or presence of ...

08/03/06 - 20060172285 - Hpv e6, e7 mrna assay and methods of use thereof
Provided is an HPV E6, E7 mRNA assay, referenced herein as the “In Cell HPV Assay,” that is capable of sensitive and specific detection of normal cervical cells undergoing malignant transformation as well as abnormal cervical cells with pre-malignant or malignant lesions. The In Cell HPV Assay identifies HPV E6, ...

08/03/06 - 20060172284 - Highly orthogonal universal sequences for use in nucleic acid assays
The invention provides a set of highly orthogonal six-code universal sequences for use in bDNA singleplex and multiplex nucleic acid hybridization assays. The six-code orthogonal sequences do not cross-hybridize and thus, minimize or eliminate the 3-mer cross-hybridization inherent in the second and third generation bDNA assays. The highly orthogonal universal ...

08/03/06 - 20060172283 - Method and apparatus to separate molecules according to their mobilities
A method and apparatus for separating molecules comprises placing different kinds of molecular species onto a probe; and introducing an electric field between the probe and a surface in proximity with the probe so that the different kinds of molecular species may be separated, wherein the different kinds of molecular ...

08/03/06 - 20060172282 - Peptide templates for nanoparticle synthesis obtained through pcr-driven phage display method
A method is provided for identifying and isolating peptides capable of binding of inorganic materials such as silica, silver, germanium, cobalt, iron, or oxides thereof, or other materials on a nanometric scale such as carbon nanotubes, using a combinatorial phage display peptide library and a polymerase-chain reaction (PCR) step to ...

08/03/06 - 20060172281 - Method for identifying and for extracting endotoxin
The invention relates to a method for identifying endotoxins for eliminating said endotoxins from a sample, with the aid of bacteriophage tail proteins. ...

07/27/06 - 20060166193 - Binding protein
HCV assays are described. The assays utilize a 24kd protein capable of binding the E2 envelope protein of hepatitis C virus (HCV), or functionally equivalent variants or fragments of the 24kd protein. ...

07/27/06 - 20060166192 - Detection of protease-resistant prion protein following a spontaneous transformation reaction
The present invention relates to a method for detecting infectious or pathogenic prion protein with an improved degree of sensitivity. For this, protease-resistant prion protein PrPSc is formed de novo by means of a spontaneous transformation reaction, with nonpathogenic prion protein PrPc in the sample interacting with protease-sensitive low molecular ...

07/27/06 - 20060166191 - Inhibition of ap-3/gag interactions in the treatment of human immunodeficiency virus infections
The present invention provides for methods of identifying potential inhibitors of HIV infection and replication. More specifically, the invention identifies complexes between the δ subunit of AP-3 and Gag, which facilitate HIV assembly. Screening for inhibitors of this interaction will identify lead compounds for the treatment of HIV and AIDS. ...

07/27/06 - 20060166190 - Magnetism based nucleic acid amplification
This invention relates generally to the field of nucleic acid amplification. In particular, the invention provides processes and kits for amplifying a nucleic acid of a target cell or virus using, using inter alia, binding between a target cell, cellular organelle or virus with a magnetic microbead. ...

07/27/06 - 20060166189 - Methods for detecting invasion of a cell
The present invention provides a rapid method to determine invasion of a cell by an invasion. ...

07/27/06 - 20060166188 - Methods of examining swine genetic resistance to rna virus-origin disease
The inventors investigated the impact of an 11-bp deletion in the swine Mx1 gene on the ability to suppress propagation of influenza viruses belonging to the myxovirus family, and revealed that the deletion led to a complete loss of the ability to suppress viral propagation. Through the detection of the ...

07/27/06 - 20060166187 - Hbv precore protein capable of forming particles
There is provided a HBV precore protein having an ability of forming particles, and a means for determining it. A novel HBV precore protein that forms the virus (like) particles of HBV was identified. The present invention provides this novel HBV precore protein. Furthermore, there are provided core-like particles and ...

07/27/06 - 20060166186 - Akap84 and its use for visualization of biological structures
A polynucleotide encoding a chimeric polypeptide is provided. The chimeric polypeptide includes (a) a first polypeptide region being capable of specifically binding at least one detectable molecule; and (b) a second polypeptide region being capable of specifically binding a biological component or macromolecule or targeting a cellular compartment. Methods utilizing ...

07/20/06 - 20060160073 - Efficient algorithm for pcr testing of blood samples
Systems, processes, and devices are provided which are useful for testing blood or plasma donations to detect those specific donations which are contaminated by a virus above a predetermined level. An apparatus and process is described which forms individual, separately sealed and connected sample containers from a flexible hollow tubing ...

07/20/06 - 20060160072 - Method for molecular cloning and polynucleotide synthesis using vaccinia dna topoisomerase
This invention provides a modified vaccinia topoisomerase enzyme containing an affinity tag which is capable of facilitating purification of protein-DNA complexes away from unbound DNA. This invention further provides a modified seauence specific topoisomerase enzyme. This invention provides a method of ligating duplex DNAs, a method of molecular cloning of ...

07/20/06 - 20060160071 - Association-based predictions
A system comprising a machine learning classifier trained on a plurality of associations between a host and a pathogen to predict a pathogen characteristic is described herein. The pathogen characteristic can relate to a disease state of the host. Computer-executable instructions for performing a method of forecasting a portion of ...

07/20/06 - 20060160070 - Association-based epitome design
Systems that facilitate immunogen design are described herein. An optimization component is provided to determine an immunogen according to at least one criterion. The immunogen comprises a set of overlapping sequences comprising sequences that are known to be and/or are likely to be immunogenic. At least one of the sequences ...

07/20/06 - 20060160069 - Methods and compositions for the diagnosis of cancer
In one embodiment, the invention relates to a method of detecting cervical cancer, and other types of cancer, using a combination of at least three genomic clones, or fragments thereof, of high risk Human Papilloma Virus. For example, the invention relates to a composition comprising at least three full length ...

07/20/06 - 20060160068 - Competitive immunoassay
The present invention provides ligand-detection reagents, ligand analogs and methods for determining the presence of a ligand in a sample. The ligand-detection reagent comprises a ligand-binding antibody and a ligand analog to form an antibody-ligand analog complex wherein the ligand analog is covalently bonded to a reporter molecule. This complex ...

07/20/06 - 20060160067 - Chimeric gb virus b (gbv-b)
The present invention relates generally to the fields of biochemistry, molecular biology, and virology. More particularly, it relates to the identification of GB virus B (GBV-B)/HCV chimeras. The invention involves nucleic acid constructs and compositions encoding GBV-B/HCV chimera, including at least part of a 5′ NTR derived from a HCV ...

07/13/06 - 20060154243 - Antigenic peptides of sars coronavirus and uses thereof
The present invention pertains to antigenic peptides of SARS-CoV and their use in diagnostic test methods and in the treatment of condition resulting from SARS-CoV. Furthermore, this invention provides antibodies capable of specifically recognizing the peptides of the invention. The antibodies can also advantageously be used in diagnostic test methods ...

07/13/06 - 20060154242 - Biomolecule chip and fabrication method thereof
Disclosed is a biomolecule chip and a fabrication method thereof The biomolecule chip of the invention includes: a substrate; an insulating layer formed on the substrate; an adhesive layer formed on the insulating layer; a seed layer formed on the adhesive layer; an opening patterned at a predetermined location within ...

07/13/06 - 20060154241 - Immunochromatographic test device
An immunochromatographic test device of the present invention comprises: a sample receiving member for receiving a sample; a label holding member for holding a labeling substance to bind to an analyte contained in the sample; and a chromatographic membrane having a detection zone at which an immobilization substance to bind ...

07/13/06 - 20060154240 - Compositions and methods related to modified retroviral vectors for restricted, site specific integration
Embodiments of the invention include compositions comprising and methods utilizing a retroviral integrase complex comprising a recombinant integrase having a domain comprising a non-native protein binding site, and a DNA binding protein comprising a DNA binding domain and a peptide binding domain that binds the non-native protein binding site of ...

07/13/06 - 20060154239 - Detection of protease-resistant prion protein after asymmetric spontaneous interaction
The present invention concerns methods for detecting infectious prion protein with improved sensitivity. For this purpose the heterologous non-pathogenic protease-sensitive prion protein PrPc is added to a sample to be examined and is transformed into protease-resistant prion aggregates by asymmetric spontaneous interaction when the infectious prion protein PrPSc is present ...

07/13/06 - 20060154238 - Compounds and methods of early diagnosis of cervical cancer and genital condyloma with hpv, chsp60 tumor suppressor h-ras, k-ras and pten derived peptides modified
An isolated sequence or peptide isolated from an E2, E4, E6, E7 early or late coding region of human papillomavirus (HPV) that is soluble in aqueous medium, and characterized by a linkage to another protein sequence or peptide isolated from the E2, E4, E6, E7 early or late coding region ...

07/13/06 - 20060154237 - Soluble rna polymerase protein and methods for the use thereof
A polymerase protein originating from a eukaryotic cell and involved in the RNA silencing pathway is for the first time provided in a purified soluble form that possesses a detectable RNA polymerization activity. This polymerase is useful in methods and kits for in vitro RNA synthesis. A polymerase of the ...

07/06/06 - 20060147906 - Anti-hpv-16 e7 antibodies and their use
The present invention relates to an anti-HPV-16 E7 antibody obtainable by (a) eliciting an in vivo humoral response against highly purified HPV-16 E7 protein or a fragment thereof in a non-human vertebrate; and (b) affinity-purifying antibodies as obtained in the eliciting-step (a). Furthermore, the invention provides for the use of ...

07/06/06 - 20060147905 - Method for the specific identification of orthopoxvirus with the aid of a miniature biological chip
The invention relates to an alternative express-method for specific identification of orthopoxviruses with the aid of microchips by hybridising DNA-DNA. Said method involves a two-stage PCR producing a single stained fluorescently labelled DNA fragment, a hybridisation on a biochip containing an original set of typing oligonucleotides and original procedures for ...

06/29/06 - 20060141450 - Magnetism based rapid cell separation
This invention relates generally to the field of. In particular, the invention provides processes and kits for isolating a target cell, cellular organelle or virus from a sample, using inter alia, non- or low-specific binding between a target cell, cellular organelle or virus with a magnetic microbead. ...

06/22/06 - 20060134616 - Sonication to selectively lyse different cell types
A sonication apparatus is directed to a microfluidic-based system to automate differential extraction of specific cell types within a mixed sample. The microfluidic-based system includes a sonication module for selective cell lysis, separating means to eliminate centrifugation, high surface area pillar chip modules to purify DNA from a cell lysate, ...

06/22/06 - 20060134615 - Method for the simultaneous detection of hpv rna and dna in a sample
A method is provided for the simultaneous detection of human papillomavirus DNA and RNA in a sample. ...

06/22/06 - 20060134614 - Screens for altered immune response capability
The invention relates to associations between genetic variation in the gene encoding CD45 and human disease and human immune responses. In particular the invention provides methods of screening human subjects for the presence of an “altered immune response capability”, which may in turn affect susceptibility to viral disease and/or autoimmune ...

06/22/06 - 20060134613 - Detection of microbe contamination on elastomeric articles
An elastomeric article that contains a chromogen that undergoes a detectable change in color in the presence of one or more microbes is provided. For example, in one embodiment, the chromogen is a solvatochromic dye (e.g., Reichardt's dye) that undergoes a color change in the presence of bacteria or other ...

06/22/06 - 20060134612 - Methods and compositions for retroviral preintegration complex-based assays
Disclosed are solution-based methods of screening for molecules that modulate the integration of retroviral cDNA into target DNA molecules. These methods can be used to identify molecules that modulate (e.g., inhibit) the integration of unintegrated retroviral cDNA. Such PIC activity modulators may have therapeutic application, for example, to treat or ...

06/22/06 - 20060134611 - Condom device for detecting std's
A condom device for detecting STD's comprising an outer layer having open pores positioned along the surface of the outer layer. The condom device includes an inner layer positioned opposite the outer layer. An intermediate layer is positioned between the outer layer and the inner layer. The intermediate layer receives ...

06/22/06 - 20060134610 - Chris-like virus, compositions, vaccines and uses thereof
A novel virus, the Chris-like virus, has been identified and characterised. Sequences derived from a new paramyxovirus, Chris-like virus (CV), are provided. These sequences encode viral proteins with similarity to recognized viral proteins in other known and characterized paramyxoviruses. The CV viral sequences and the polypeptides encoded therein are useful ...

06/22/06 - 20060134609 - Compositions and methods for determining the presence of sars coronavirus in a sample
The present invention relates to oligonucleotides useful for determining the presence of SARS coronavirus in a test sample. The oligonucleotides of the present invention may be incorporated into detection probes, capture probes and amplification oligonucleotides, or used in various combinations thereof. ...

06/22/06 - 20060134608 - Chemically amplified electrochemical detection of affinity reaction
This invention relates generally to the field of electrochemistry. In particular, the invention provides a method for assaying an analyte, using, inter alia, a reactant capable of binding and/or reacting with an analyte to be analyzed on an oxide electrode and a reducing agent not capable of being oxidized directly ...

06/22/06 - 20060134607 - Marker gene
A method of determining a predisposition to infection, especially infection with HIV, together with therapy for the infection is described. ...

06/22/06 - 20060134606 - Substrates for isolating reacting and microscopically analiyzing materials
An immobilizing device for biological material comprises a rigid support (12) carrying a substrate layer (20, 20′) of polymer having biological immobilizing properties, e.g. for amino and nucleic acids. Substantially solid ultra-thin substrate layers (20′) having a thickness less than about 5 micron, preferably between about 0.1 and 0.5 micron, ...

06/15/06 - 20060127888 - Compositions and methods for enhancing the identification of prion protein prpsc
The present invention provides compositions, methods and kits for enhancing the amplification of PrPSc for use in increasing the sensitivity of identifying the presence of PrPSc in a sample. ...

06/15/06 - 20060127887 - Isolation and purification method of biomolecules using hydrogel
Provided is a method of isolating and purifying biomolecules using a hydrogel, the method including: bring a sample containing charged biomolecules into contact with a hydrogel to bind the biomolecules to the hydrogel; washing the hydrogel bound with the biomolecules; and eluting the bound biomolecules using an elution solvent. According ...

06/15/06 - 20060127886 - Sample-efficient lateral flow immunoassay
There is provided a lateral flow assay device for detecting the presence or quantity of an analyte residing in a test sample where the lateral flow assay device has a porous membrane in communication with a conjugate pad and a wicking pad. The porous membrane has a detection zone which ...

06/15/06 - 20060127885 - Method and devices for rapid diagnosis of foot-and-mouth disease
A rapid immunoassay method and apparatus for detecting foot and mouth disease virus are disclosed. The method and test device permit pen-side testing of animals and provide test results within a relatively short time period. In a preferred embodiment, the method and apparatus provide a means for differentiating between FMDV-infected ...

06/08/06 - 20060121453 - Pre-incubation assay methods
Pseudo-positive data can be reduced by incubating a solution containing an enzyme in the absence of a test substance and a substrate of the enzyme. ...

06/08/06 - 20060121452 - Methods for detection of genetic disorders
The invention provides a method useful for detection of genetic disorders. The method comprises determining the sequence of alleles of a locus of interest, and quantitating a ratio for the alleles at the locus of interest, wherein the ratio indicates the presence or absence of a chromosomal abnormality. The present ...

06/08/06 - 20060121451 - Kit and method and device for the preparation of kit for detecting human cytomegalovirus (hcmv) nucleic acid in biological samples
The present invention is a kit and method and device for the preparation of a kit for detecting Human Cytomegalovirus (hCMV) in which the amplimers are transcripts of a glycoprotein B neutralization-related epitope gene of hCMV. The amplicons are hybridized to a specific oligonucleotide probe, which allows the amplicons to ...

06/08/06 - 20060121450 - Site specific system for generating diversity protein sequences
This invention relates to the diversification of nucleic acid sequences by use of a nucleic acid molecule containing a region of sequence that acts as a template for diversification. The invention thus provides nucleic acid molecules to be diversified, as well as those which act as the template region (TR) ...

06/08/06 - 20060121449 - Method for selection of compounds which inhibit clonal cell growth and use thereof
A three step method for selection and testing of compounds inhibiting clonal cell growth, consisting of 1) screening for substances that inhibit clonal growth in a culture, 2) in the same culture, testing whether a high local cell concentration (collocation) will decrease the inhibiting effect of such substances on clonal ...

06/08/06 - 20060121448 - Method for inducing complete hepatitis c virus (hcv) replication in vitro
The present invention relates to hepatitis C virus (HCV). More particularly, the invention relates to the development of a tool suitable for the search, discovery and validation of novel HCV antiviral drugs and therapies (e.g. vaccine). The invention further relates to methods for inducing HCV replication in vitro, and more ...

06/08/06 - 20060121447 - Purified subfragment codifying for neuroaminidase, recombinant neuroaminidase and its use in zooprophylaxis
Within the prophylaxis strategies for the control of type A avian influenza caused by viral infection with specific epidemic strain H7N1, a vaccination process is envisaged comprising the preparation of a heterologous vaccine that is administered to an animal population, said vaccine featuring the same subtype of viral haemoagglutinin HA7 ...

06/01/06 - 20060115810 - Microarrays of functional biomolecules, and uses therefor
Disclosed are products and methods to facilitate the identification of compounds that are capable of interacting with biological macromolecules of interest, especially when such macromolecules are attached to a support surface in microarray. Aspects of the invention concern attachment chemistry, peptide labeling, antibody preparation, applications and so on. ...

06/01/06 - 20060115809 - Microarrays of functional biomolecules, and uses therefor
Disclosed are products and methods to facilitate the identification of compounds that are capable of interacting with biological macromolecules of interest, especially when such macromolecules are attached to a support surface in microarray. Aspects of the invention concern attachment chemistry, peptide labeling, antibody preparation, applications and so on. ...

06/01/06 - 20060115808 - Microarrays of functional biomolecules, and uses therefor
Disclosed are products and methods to facilitate the identification of compounds that are capable of interacting with biological macromolecules of interest, especially when such macromolecules are attached to a support surface in microarray. Aspects of the invention concern attachment chemistry, peptide labeling, antibody preparation, applications and so on. ...

06/01/06 - 20060115807 - Episomal expression system
A cell which expresses a replication factor is transfected with a vector which requires the presence of the replication factor to be maintained episomally within the cell. This is then expanded into a plurality of cells; and a cell in the plurality of cells selected (i) which maintains the vector ...

06/01/06 - 20060115806 - Global analysis of transposable elements as molecular markers of cancer
The present invention provides methods of determining expression patterns, methylation patterns and chromatin status patterns for transposable element gene sequences. These methods can be utilized to diagnose, stage and treat cancer. ...

05/25/06 - 20060110726 - Polymerase chain reaction assays for monitoring antiviral therapy and making therapeutic decisions in the treatment of acouired immunodeficiency syndrome
The present invention relates to methods of monitoring, via polymerase chain reaction, the clinical progression of human immunodeficiency virus infection and its response to antiretroviral therapy. According to the invention, polymerase chain reaction assays may be used to predict immunological decline and to identify, at an early stage, patients whose ...

05/25/06 - 20060110725 - Apparatus for and method of purifying nucleic acids by different laser absorption of beads
An apparatus for and method of purifying nucleic acids of cells or viruses are provided. The nucleic acid purification apparatus includes: a cell lysis capillary having a sample inlet through which samples, magnetic beads, and a solid support are introduced; a vibrator attached to the capillary and mixing the samples, ...

05/25/06 - 20060110724 - Quantitative real-time assay for noroviruses and enteroviruses with built in quality control standard
A method is provided for reverse transcription-polymerase chain reaction (RT-PCR) comprising a) amplifying a reverse transcribed cDNA in a mixture comprising Norovirus Genogroup I and Norovirus Genogroup II primers and probes, wherein said Norovirus primers and probes distinguish between Genogroup I and Genogroup II viruses; b) quantifying virus; and c) ...

05/25/06 - 20060110723 - Multiplexed protein expression and activity assay
A system is for analyzing expression levels and activity of a plurality of proteins is provided. A bio-displayed polypeptide binding component associated with a predetermined marker is used to bind the proteins of interest. The predetermined marker components are then amplified and detected in a high throughput manner. ...

05/18/06 - 20060105327 - Inhibition of the src kinase family pathway as a method of treating hbv infection and hepatocellular carcinoma
The present invention relates to therapeutic protocols and pharmaceutical compositions designed to target HBx mediated activation of Src kinase, members of the Src tyrosine kinase family and components of the Src kinase family signal transduction pathways for the treatment of HBV infection and related disorders and diseases, such as HCC. ...

05/18/06 - 20060105326 - Method for isolating proteins or protein and nucleic acid associations, or particle and protein complexes, reagent and uses
The magnetic colloidal particles comprise a core and an envelope in which the core is magnetic and is coated with at least one polymer comprising functional groups X chosen from amine, hydroxyl, thiol, aldehyde, ester, anhydride, acid chloride, carbonate, carbamate, isocyanate and isothiocyanate groups, or mixtures thereof, at least one ...

05/18/06 - 20060105325 - Adsorbent with enhanced protein binding capacity and selectivity
The invention discloses an adsorbent composition in which each ligand has a cluster of functional groups. This adsorbent composition is designed to enhace binding affinity and specificity for biomolecules. The invention also discloses a method for adsorbing a biomolecule onto the disclosed adsorbent composition. A biomolecule can be adsorbed to ...

05/18/06 - 20060105324 - Methods and compositions for predicting the outcome of cervical intra-epithelial neoplasia
The present invention relates to methods and kits for predicting the outcome of cervical intra-epithelial neoplasia and methods for treating a cervical intra-epithelial neoplasia. More particularly, the methods comprise the determination of the presence of the HLA-DRB1*13 allele and the absence of a high risk human papillomavirus (HPV). ...

05/18/06 - 20060105323 - Multi-reporter gene model for toxicological screening
A system for the detection of gene activation events is provided which comprises a nucleic acid construct encoding a protein of the lipocalin protein family and a peptide tag in which the expression of the construct in a cell or in the cells of a transgenic animal demonstrates the activation ...

05/11/06 - 20060099574 - Detection and distinguishing infections bursal disease virus (ibdv) strains by molecular biology method
The present invention relates to a novel method to detect and differentiate different strains of infectious bursal disease virus (IBDV) in a chicken and other bird sample. RNA was obtained from said samples by using a pair of primer (Primer FVVC & RVVC) in a reverse transcriptase-polymerase chain reaction. Two ...

05/11/06 - 20060099573 - Diagnostic assays
Diagnostic assays using IgE for detecting HIV in a baby patient or a child patient that might be infected with HIV; distinguishing between classic dengue and dengue hemorrhagic fever in a patient that is believed to have either the classic or hemorrhagic version of dengue; and detecting cognitive impairment in ...

05/11/06 - 20060099572 - Crystallization reagent matrices and related methods and kits
This invention provides methods, kits and automated systems for identifying a reagent in which a compound crystallizes, and methods for crystallizing a compound. ...

05/04/06 - 20060094004 - Micro-reactor, biological material inspection device, and microanalysis system
A micro reactor for inspecting a biological material, comprising: a first substrate on which a minute flow path is formed; a second substrate laminated on the first substrate so as to cover the minute flow path; a detection section provided on the minute flow path formed between the first and ...

04/27/06 - 20060088820 - Detecting superantigen activity in a biological sample
Multiple sclerosis or a condition associated with multiple sclerosis is detected by detecting an amount of lymphocytes bearing a Vβ16, Vβ17 or Vβ7 determinant and calculating an amount of expansion or loss of these lymphocytes. ...

04/27/06 - 20060088819 - Truncated hepatitis c virus ns5 domain and fusion proteins comprising same
The invention provides truncated HCV NS5 polypeptides and fusion proteins comprising the truncated NS5 polypeptides, fused to at least one other HCV epitope derived from another region of the HCV polyprotein. The fusions can be used in methods of stimulating an immune response to HCV, for example a cellular immune ...

04/27/06 - 20060088818 - Optical detection of microorganisms and toxins
A method of detecting the presence of selected microorganisms within a fluid includes filtering the fluid to remove large particles prior to analyzing the fluid with an antibody matrix. Non-specific binding is eliminated by washing and the presence of biological material is detected. If biological material is detected within the ...

04/20/06 - 20060084052 - Detection of viable agents
A quantitative PCR method has been developed for the simultaneous detection and quantitation of an agent in samples of biologically derived materials. Unlike conventional quantitative PCR detection methods, this assay allows for the detection of viable agents. ...

03/30/06 - 20060068381 - Methods for identifying a peptide that binds a geometrical shape
Provided herein are methods, such as phage display assays, for bioengineering peptides that bind to geometrically and/or atomically structured molecular surfaces such as, for example, flat surfaces, smooth curved surfaces, as well as surfaces with periodic, random, or fractal atomic configurations. Surface-binding peptides are provided that are identified using the ...

03/30/06 - 20060068380 - Assay for detecting and quantifying hiv-1
Compositions, methods and kits for detecting HIV-1 nucleic acids using nucleic acid amplification. Particularly described are oligonucleotides that are useful as hybridization probes and amplification primers for detecting very low levels of HIV-1 nucleic acids by real-time monitoring of amplicon production. The invented assays are characterized by high levels of ...

03/30/06 - 20060068379 - Phage display of intact domains at high copy number
Disclosed is a phage display system in which the molecules to be displayed (i.e., molecules of interest) are bound to dispensable capsid polypeptides such as SOC (small outer capsid) and HOC (highly antigenic outer capsid) polypeptides that are, in turn, bound to a surface lattice protein, such as those on ...

03/30/06 - 20060068378 - Nanoparticles having oligonucleotides attached thereto and uses therefor
The invention provides methods of detecting a nucleic acid. The methods comprise contacting the nucleic acid with one or more types of particles having oligonucleotides attached thereto. In one embodiment of the method, the oligonucleotides are attached to nanoparticles and have sequences complementary to portions of the sequence of the ...

03/23/06 - 20060063151 - Porcine reproductive and respiratory syndrome isolates and methods of use
A method of predicting the virulence of a new or uncharacterized PRRS virus isolate is provided wherein the isolate is injected into swine and allowed to replicate for a period of from about 3-15 days. During this period, the rate of virus growth and/or the magnitude of viremia is determined, ...

03/23/06 - 20060063150 - Antisense antiviral compound and method for treating ssrna viral infection
The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae families in the treatment of a viral infection. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides having a sequence ...

03/23/06 - 20060063149 - Compositions and methods for detecting pathogen infection
The present invention generally features therapeutic and diagnostic compositions and methods for increasing or decreasing the binding of a lysozyme polypeptide to a Treponema pallidum P17 polypeptide (Tp17) or a Tp17-like polypeptide. More particularly, the invention relates to compositions and methods for detecting, treating, or preventing a pathogen infection or ...

03/23/06 - 20060063148 - Porcine reproductive and respiratory syndrome isolates and methods of use
A method of predicting the virulence of a new or uncharacterized PRRS virus strain is provided wherein the strain is injected into swine and allowed to replicate for a period of from about 3-15 days. During this period, the rate of virus growth and/or the magnitude of viremia is determined, ...

03/23/06 - 20060063147 - Omega-amino-peg-phosphoramidites and conjugates thereof
ω-Amino-PEG conjugates, and processes and reagents for preparing ω-amino-PEG conjugates are described. ...

03/23/06 - 20060063146 - Method for assessment of particles
The invention relates to imaging methods for assessing quality or quantity parameters of particles in a sample, wherein the particles contain less than 106 analyte detectable positions. The method comprises 1) mixing the sample with a targeting species capable of binding an analyte position and a labelling agent, 2) arranging ...

03/16/06 - 20060057563 - Peptides derived from capsid antigens of the epstein-barr virus and the use thereof
In the area of virus diagnosis, in particular Epstein-Barr virus (EBV) diagnosis, methods for the detection of EBV and agents suitable for this purpose are provided, including peptides which are derived from p18-VCA and permit discrimination between acute and past EBV infection. ...

03/16/06 - 20060057562 - Method, composition and kit for antigenic binding of norwalk-like viruses
A method for detecting a Norwalk-Like Virus (NLV) in a biological sample, comprising the steps of: obtaining a biological sample suspected of containing a NLV; contacting the biological sample with at least one human histo-blood group antigen to allow formation of a complex of the NLV with the antigen; and ...

03/16/06 - 20060057561 - Virus detection method, primers therefor and screening kit
Discloses a novel detection and typing method for viruses, such as human papillomaviruses, based on real-time PCR using self-probing amplicon fluorescent primers. The method comprises: (IA) contacting the sample with a self-probing amplicon (‘virus self-probing amplicon’) comprising (i) a virus primer capable of hybridising to at least one target viral ...

03/09/06 - 20060051747 - Production of vaccines
Means and methods for producing mammalian viruses, the method comprising infecting a culture of immortalized human cells with a virus, incubating the culture infected with virus to propagate the virus under conditions that permit growth of the virus, and to form a virus-containing medium, and removing the virus-containing medium. The ...

03/09/06 - 20060051746 - Peptides for inducing cytotoxic t lymphocyte responses to hepatitis b virus
Peptides are used to define epitopes that stimulate HLA-restricted cytotoxic T lymphocyte activity against hepatitis B virus antigens. The peptides are derived from regions of HBV polymerase, and are particularly useful in treating or preventing HBV infection, including methods for stimulating the immune response of chronically infected individuals to respond ...

03/09/06 - 20060051745 - Hcv non-structural protein mutants and uses thereof
Modified HCV non-structural proteins are described. The proteins include modified NS3 domains such that proteolytic activity of the NS3 molecule is inhibited. The modified proteins retain conformational epitopes. HCV immunoassays including the modified NS3 molecules are also described. ...

03/09/06 - 20060051744 - Feline infectious peritonitis (fip) and systemic multi-organ coronavirus biomarkers and screening methods
Methods for screening for FIP infection or other multi-organ coronaviruses are disclosed, as well as isolated antibodies and kits useful for performing such methods. Biomarkers for multi-organ coronavirus infections include soluble enolase; antibodies to enolase; and circulating immune complexes that contain enolase. The methods find application in diagnosis, treatment, vaccine-development, ...

03/09/06 - 20060051743 - Hepatitis b viral variants with reduced susceptibility to nucleoside analogs and uses thereof
The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance to nucleoside or nucleotide analogs and/or reduced interactivity with antibodies to viral ...

03/09/06 - 20060051742 - Novel assay for the separation and quantification of hemagglutinin antigens
The present invention relates to novel methods for separating hemagglutinin (HA) antigens, comprising the steps of applying a reduced and derivatized antigen preparation comprising solubilized HA antigens and a detergent in a pH controlled solution, on a Reversed-Phase High-Performance Liquid Chromatography column; and eluting the HA antigens from the column ...

03/09/06 - 20060051741 - Plate for mass spectrometry, process for preparing the same and use thereof
The present invention provides a plate for mass spectrometry comprising a support and a PVDF-containing coating (that is, a PVDF-deposited thin layer) thereon, and a method of preparing a plate for mass spectrometry, which comprises coating the support surface with PVDF. The present invention also provides a method of analyte ...

03/09/06 - 20060051740 - Method for the amplification and detection of hbv dna using a transcription based amplification
The present invention provides a method for the transcription based amplification of a target HBV nucleic acid sequence starting from HBV DNA optionally present in a sample, comprising the steps of,—incubating the sample, suspected to contain HBV, in an amplification buffer with one or more restriction enzymes capable of cleaving ...

03/09/06 - 20060051739 - Methods and composition for visualizing and interfering with chromosomal tethering of extrachromosomal molecules
The invention provides methods and compositions for visualizing and interfering with chromosomal tethering and segregation of extrachromosomal molecules. ...

03/02/06 - 20060046248 - Rna interference in avians
The invention relates to nucleotide sequences which encode therapeutic polynucleotides which correspond to one or more certain sequences in the genome of an avian pathogen. The invention also relates to transgenic avians whose cells contain such nucleotide sequences. ...

03/02/06 - 20060046247 - Protecting avians from pathogens
The invention relates to nucleotide sequences which encode therapeutic polynucleotides which correspond to one or more certain sequences in the genome of an avian pathogen. The invention also relates to transgenic avians whose cells contain such nucleotide sequences. ...

03/02/06 - 20060046246 - Genus, group, species and/or strain specific 16s rdna sequences
Materials and methods for identifying unique sites in bacterial 16S and 23S rDNA are provided, as well as specific unique sequences of 16S rDNA in select bacteria. The distinguishing moieties will enable rapid differentiation between families, genera, groups, species, strains, subspecies, and isolates of microorganisms. Such differentiation can be performed ...

02/23/06 - 20060040261 - Primers for isothermal amplification of hepatitis c virus
The present application relates to primers for isothermal amplification of HCV each include at least eighteen consecutive bases corresponding to a 3′ end region of one selected from base sequences of SEQ ID NOs: 1-10, 21 and 22. The primers are specific to HCV subtypes 1a, 1b, 2a, 2b and ...

02/23/06 - 20060040260 - Composition and method for monitoring in vitro conversion of full -length mammalian prion protein to amyloid form with physical properties of prpsc
The present invention relates to an automated in vitro method for converting a prion protein into multiple forms including β-oligomer or amyloid forms while monitoring the mechanism and progress of the molecular conversion. ...

02/23/06 - 20060040259 - Method for inhibition of viral infection
The invention is directed to inhibiting viral morphogenesis and viral infection. In particular, it concerns effecting such inhibition by inhibiting the prenylation or post prenylation reactions of a viral or host protein. ...

02/23/06 - 20060040258 - Water-soluble conjugates and methods of preparation
The present invention provides water-soluble conjugates and methods of using them in diagnostic and detection assays. Devices for performing detection and quantitation assays are also provided. In various embodiments the conjugates are useful in immunoassays and later flow assays. The invention also provides methods of preparing the conjugates that result ...

02/23/06 - 20060040257 - Immunoassay for hiv protease inhibitors
A non-isotopic immunoassay for an HIV protease inhibitor comprising incubating a sample containing the inhibitor with a receptor specific for the inhibitor or for a metabolite of said inhibitor and further with a conjugate comprising an analog of the inhibitor and a non-isotopic signal generating moiety. Signal generated as a ...

02/16/06 - 20060035214 - Screening methods for identifying inhibitors of herpesviral replication
This invention provides methods of screening for compounds that inhibit herpesviral transcription and replication. The methods comprise screening test compounds for ability to enhance the activity of homeodomain transcription factor SATB1 or CDP in repressing transcription of herpesviral genes (e.g., the IE gene of cytomegalovirus). Transcriptional repression by SATB1 or ...

02/16/06 - 20060035213 - Posh nucleic acids, polypeptides and related methods
The application discloses novel polypeptides and nucleic acids involved in a variety of biological processes, including viral reproduction. Related methods and compositions are also described. ...

02/16/06 - 20060035212 - Molecules inhibiting hepatitis c virus protein synthesis and method for screening same
The invention concerns a method for screening molecules which consists, in vitro: a) in incubating together the subunit p116 (SEQ ID4) of the elF3 protein, the nucleotide sequence of region II (SEQ ID2) of the HCV IRES or any sequence containing at least 10 successive nucleotides of the region II ...

02/09/06 - 20060029934 - Methods of assessing hiv integrase inhibitor therapy
The present invention relates to methods and products for the evaluation of HIV treatment. The methods are based on evaluating molecular events at the HIV integrase resulting in altered therapeutic efficacy of the investigated compounds. The methods rely on providing an integrase gene and evaluating either through genotyping or phenotyping ...

02/09/06 - 20060029933 - Branched and multi-chain nucleic acid switches for sensing and screening
Embodiments of the invention relate to a branched or multichain nucleic acid switch adapted to switch from a first conformation to a second conformation upon ligand binding. The switch includes a probe strand, P, which includes the ligand binding domain; a switching framework which includes a cover strand (C), and ...

02/09/06 - 20060029932 - Method for preventing hiv-1 infection of cd4+ cells
This invention provides methods for inhibiting fusion of HIV-1 to CD4− cells which comprise contacting CD4− cells with a non-chemokine agent capable of binding to a chemokine receptor in an amount and under conditions such that fusion of HIV-1 to the CD4+ cells is inhibited. This invention also provides methods ...

02/09/06 - 20060029931 - Cellular genes regulated by hiv-1 infection and methods of use thereof
This invention provides cellular gene products which have anti-apoptotic activity in HIV-1 infected cells and provides agents for the inhibition of the cellular gene products. ...

02/09/06 - 20060029930 - Detecting genotypes associated with congenital adrenal hyperplasia
The present invention provides methods of determining the genotype at a duplicated region of a genome. The methods involve (a) amplifying the DNA, preferably using four amplification primers. The exemplary methods produce a first amplicon corresponding to a first distinct region or gene by utilizing a first primer and a ...

02/09/06 - 20060029929 - Systems and methods for molecular recognition
Acoustic wave devices coated with a biolayer are described for the detection target bio-molecules. The acoustic wave device is connected in an oscillator circuit, and the frequency shift Δf resulting from a biomolecular event is recorded. Further described are the use of Rayleigh wave surface acoustic wave devices for vapor ...

02/09/06 - 20060029928 - Polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus (prrsv), proteins encoded by the polynucleic acids, vaccines based on the proteins and/or polynucleic acids, a method of protecting a pig from a prrsv and a method of de
The present invention provides a purified preparation containing a polynucleic acid encoding at least one polypeptide selected from the group consisting of proteins encoded by one or more open reading frames (ORF's) of an Iowa strain of porcine reproductive and respiratory syndrome virus (PRRSV), proteins at least 80% but less ...

02/02/06 - 20060024671 - Biopolymer marker indicative of disease state having a molecular weight of 1525 daltons
The instant invention involves the use of a combination of preparatory steps in conjunction with mass spectroscopy and time-of-flight detection procedures to maximize the diversity of biopolymers which are verifiable within a particular sample. The cohort of biopolymers verified within such a sample is then viewed with reference to their ...

02/02/06 - 20060024670 - Influenza virus vaccine composition and methods of use
The present invention is directed to enhancing the immune response of a human in need of protection against IV infection by administering in vivo, into a tissue of the human, at least one polynucleotide comprising one or more regions of nucleic acid encoding an IV protein or a fragment, a ...

02/02/06 - 20060024669 - System and method for identifying complex patterns of amino acids
A method and system are disclosed for identifying and/or locating complex patterns in an amino acid sequence stored in a computer file or database. According to an aspect of the present invention, techniques are provided to facilitate queries of protein databases. For protein descriptions received in response to the queries, ...

02/02/06 - 20060024668 - Coronavirus, nucleic acid, protein, and methods for the generation of vaccine, medicaments and diagnostics
A new coronavirus is disclosed herein with a tropism that includes humans. Means and methods are provided for diagnosing subjects (previously) infected with the virus. Also provided are among others vacines, medicaments, nucleic acids and specific binding members. ...

02/02/06 - 20060024667 - Compositions and methods for alzheimer's disease
The present invention concerns methods and compositions of use for treatment of Alzheimer's Disease (AD). In certain embodiments, the methods concern preparation of phage-display single chain antibody libraries and screening against amyloid-beta (Aβ) protein or peptide. Anti-Aβ antibodies are selected and sequenced. In certain embodiments, synthetic Aβ binding peptides are ...

02/02/06 - 20060024666 - Humanized antibodies against the venezuelan equine encephalitis virus
Humanized anti-VEEV antibodies can be used to prevent and/or neutralize viral infection. ...

01/26/06 - 20060019246 - Synthetic c-glycolipid and its use for treating cancer, infectious diseases, and autoimmune diseases
wherein X is O or NH; R′ is a hydrocarbon chain; R3 and R4 are hydrogen, OH or a monosaccharide; R5 is hydrogen or a monosaccharide; Q′ is optionally present and may be a C1-10 hydrocarbon; X′ is optionally present and may be O, S or NR8; and Q3 may ...

01/26/06 - 20060019245 - Hcv variants
HCV variants are described. The variants include polynucleotides comprising non-naturally occurring HCV sequences and HCV variants that have a transfection efficiency and ability to survive subpassage greater than HCV that have wild-type polyprotein coding regions. Expression vectors comprising the above polynucleotides and HCV variants are also described, as are the ...

01/26/06 - 20060019244 - Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including protein markers, pathogens and cellular debris
An assay element is described including recognition ligands bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the ...

01/26/06 - 20060019243 - Method and device for mixing samples on a support
A method for detecting analytes in a liquid is provided in which the liquid is subjected to a mixing treatment on an area of a support which has in particular immobilized reactants, wherein in the mixing treatment the liquid is impinged upon by a stream of gas that sweeps across ...

01/26/06 - 20060019242 - Detection of herpes simplex virus
The invention provides methods to detect herpes simplex virus (HSV) in biological samples and further to distinguish between HSV-1 and HSV-2. Primers and probes for the differential detection of HSV-1 and HSV-2 are provided by the invention. Articles of manufacture containing such primers and probes for detecting HSV are further ...

01/26/06 - 20060019241 - Na+ and ci-coupled transport system for endogenous opioid peptides
The present invention provides the identification and characterization of an endogenous opioid peptide transporter, and uses thereof. ...

01/26/06 - 20060019240 - Posh nucleic acids, polypeptides and related methods
The application discloses novel polypeptides and nucleic acids involved in a variety of biological processes, including viral reproduction. Related methods and compositions are also described. ...

01/26/06 - 20060019239 - Method of preventing infections from bioterrorism agents with immunostimulatory cpg oligonucleotides
The present disclosure relates to a method of preventing or treating an infection caused by a bioterrorism agent, specifically to a method of increasing an immune response to a bioterrorism agent using an oligodeoxynucleotide including a CpG motif, and a method of enhancing the immunogenicity of a vaccine against a ...

01/26/06 - 20060019238 - Method for identifying protein-protein interactions
The properties of yeast help, a type I ER membrane protein which is involved in the unfolded protein response (UPR), have been exploited to develop â. system for the detection and study of interactions between extracellular and/or membrane proteins. In the system, proteins of interest are fused to the lumenal ...

01/19/06 - 20060014143 - Preparation of potent macrophage activating factors derived from cloned vitamin d binding protein and its domain and their therapeutic usage for cancer, hiv-infection and osteopetrosis
Vitamin D-binding protein (Gc protein) and its small domain (approximately ⅕ of the Gc peptide also known as domain III) were cloned via a baculovirus vector. The cloned Gc protein and the cloned domain (Cd) peptide were treated with immobilized β-galactosidase and sialidase to yield macrophage activating factors, GcMAFc and ...

01/19/06 - 20060014142 - Compositions and methods for detection of hepatitis a virus nucleic acid
Nucleic acid oligomeric sequences and in vitro nucleic acid amplification and detection methods for detecting the presence of HAV RNA sequences in samples are disclosed. Kits comprising nucleic acid oligomers for amplifying and detecting HAV nucleic acid sequences are disclosed. ...

01/19/06 - 20060014141 - Method of detecting and quantifying cytomegalovirus
Combinations of oligonucleotide primers which allow specific amplification of the mRNA of the CMV β2.7 gene, RNA amplification using these combinations of oligonucleotide primers and a detection method which uses a fluorescent intercalative dye-labeled oligonucleotide probe to monitor the RNA amplification. ...

01/19/06 - 20060014140 - Molecular methods and compositions for detecting and quantifying respiratory viruses
The present invention relates to new methods and nucleic acid sequences for the detection and quantification of human metapneumovirus. ...

01/19/06 - 20060014139 - Five-helix protein
Five-Helix protein, which comprises the three N-helices and at least two, but not three, of the three C-helices of the trimer-of-hairpin structure of HIV gp41, separated by linkers, such as amino acid residue linkers, is disclosed. Six-Helix protein, which includes the three N-helices and the three C-helices of the trimer-of-hairpin ...

01/19/06 - 20060014138 - Phage microarray profiling of the humoral response to disease
The present invention relates to compositions and methods for cancer diagnostics, including but not limited to, cancer markers. In particular, the present invention provides methods and compositions for phage microarray profiling of cancer (e.g., prostate, lung, or breast cancer). The present invention further provides novel markers useful for the diagnosis, ...

01/12/06 - 20060008798 - Rabbit monoclonal antibodies to hepatitis b surface antigens and methods of using the same
Reagents, methods and immunodiagnostic test kits for the accurate detection of hepatitis B virus (HBV) infection are disclosed. The methods and kits employ novel rabbit monoclonal antibodies directed against HBV surface antigens (HBsAg) with mutations in the “a” determinant region of HBsAg. ...

01/12/06 - 20060008797 - Methods of suppressing microglial activation
Methods of suppressing the activation of microglial cells in the Central Nervous System (CNS), methods of ameliorating or treating the neurological effects of cerebral ischemia or cerebral inflammation, and methods of combating specific diseases that affect the CNS by administering a compound that binds to microglial receptors and prevents or ...

01/05/06 - 20060003321 - Expression monitoring for human cytomegalovirus (hcmv) infection
Certain human genes have been found to be induced or repressed in host cells infected with HCMV. A large set of such genes has been identified. These have diagnostic use in determining the extent of tissue damage caused by the infection as well as in determining the stage of disease ...

01/05/06 - 20060003320 - Exploring fluorophore microenvironments
Methods, apparatus, and system, implementing and using techniques for detecting a presence of one or more target analytes in particular regions of interest of one or more samples. One or more samples including objects and one or more target analytes are provided. Some of the target analytes are labeled with ...

01/05/06 - 20060003319 - Compositions and methods for determining resistance to inhibitors of virus entry using recombinant virus assays
The invention provides a method for determining whether a human immunodeficiency virus is resistance to a viral entry inhibitor. The methods are particularly useful for determining resistance to inhibitors that act by a non-competitive mechanism. In certain aspects, the methods comprise determining whether an HIV population is resistant to an ...

01/05/06 - 20060003318 - Influenza sensor
A sensor for the detection of tetrameric multivalent neuraminidase within a sample is disclosed, where a positive detection indicates the presence of a target virus within the sample. Also disclosed is a trifunctional composition of matter including a trifunctional linker moiety with groups bonded thereto including (a) an alkyl chain ...

01/05/06 - 20060003317 - Drug discovery method
The present invention relates to drug discovery methods, particularly antiviral drug discovery methods. ...

01/05/06 - 20060003316 - Immunogenic compositions derived from poxviruses and methods of using same
Immunogenic compostions composed of poxvirus immunogens and related methods are disclosed. Specifically, immunogenic compostions useful in eliciting immune responses in animals are disclosed. In one embodiment the immunogenic compostions include viral antigens derived from vaccinia and/or variola that elicit cross-reactive immune responses. The immunogens can be made synthetically, by using ...

01/05/06 - 20060003315 - Membrane-anchored beta2 microglobulin covalently linked to mhc class 1 peptide epitopes
The invention provides a polynucleotide comprising a sequence encoding a polypeptide comprising a beta2-microglobulin molecule linked through its carboxyl terminal to a polypeptide stretch that allows the anchorage of the beta2-microglobulin molecule to the cell membrane, and through its amino terminal to at least one antigenic peptide comprising a MHC ...

01/05/06 - 20060003314 - Methods for peptide and protein display in nucleic acid arrays
Virus displayed peptides or proteins can be integrated and presented in a nucleic acid array format. The present invention makes it possible to generate naked nucleic acidvirion protein display complexes in which the individual nucleic acid template is freely and covalently linked to the very same virion proteins it coded ...

12/29/05 - 20050287524 - Differential serological diagnosis of equine infectious anemia virus infected and vaccinated horses using recombinant s2 protein
We describe here the development and optimization of an embodiment of a new serologic EIAV diagnostic ELISA assay to detect serum antibodies to the EIAV S2 protein that are produced in infected horses, but not in horses inoculated with the EIAVUKΔS2 vaccine virus. An embodiment of the test S2 protein ...

12/29/05 - 20050287523 - Functionalized platform for individual molecule or cell characterization
A system for characterization of a single molecule or cell sample by directing a beam onto the sample to produce energy emanating from the sample. A periodic sample holder with through-pores containing the sample is positioned to receive the beam. At least one pore is provided in the sample holder ...

12/29/05 - 20050287522 - Detection of protein translocation by beta-galactosidase reporter fragment complementation
Methods and compositions are provided for detecting molecular translocations, particularly protein translocations within and between subcellular copartments, using at least two components that exhibit a localization-dependent difference in complementation activity. In particular, alpha-complementing β-galactosidase fragments are provided. These β-galactosidase reporter fragments display significantly enhanced enzymatic activity when one fragment is ...

12/29/05 - 20050287521 - Oligonucleotides from sequences coding for the surface component of ptlv envelope proteins and uses thereof
The invention relates to the use of oligonucleotides from the nucleotide sequences coding for the amino-terminal region of the surface component (SU) of envelope proteins of PTLV viruses in order to perform methods of detecting every PTLV strain or PTLV-related viruses, e.g. for the detection of novel PTLV variants or ...

12/22/05 - 20050282156 - Methods for making a device for concurrently processing multiple biological chip assays
Methods for concurrently processing multiple biological chip assays by providing a biological chip plate comprising a plurality of test wells, each test well having a biological chip having a molecular probe array; introducing samples into the test wells, subjecting the biological chip plate to manipulation by a fluid handling device ...

12/22/05 - 20050282155 - Viral libraries from uncultivated viruses and polypeptides produced therefrom
Provided is a method for producing viral genomic and complementary DNA expression libraries and novel viral polypeptides without requiring virus cultivation prior to library construction. The method includes direct isolation of viral particles from the environment by differential filtration and centrifugation. The viral nucleic acids are extracted and used to ...

12/22/05 - 20050282154 - Angiotensin-converting enzyme-2 as a receptor for the sars coronavirus
The present invention is based upon the identification of human angiotensin-converting enzyme-2 (ACE-2) as a functional receptor for the SARS coronavirus. Transfection of cells with ACE-2 confers upon them the ability to support viral replication. In addition, assays performed using ACE-2 together with the S protein of the SARS virus ...

12/22/05 - 20050282153 - Quantification of microorganism
A method for quantifying a microorganism and related primers and nucleic acids. ...

12/15/05 - 20050277114 - System and method for detecting west nile virus
The present invention relates to a system for detecting West Nile Virus (WNV) in a sample by detecting nucleic acids having been amplified and comprising the coding region of the membrane protein of WNV. Further, a method and a kit for the detection of amplified nucleic acids comprising the coding ...

12/15/05 - 20050277113 - Saliva immunoassay for detection of exposure to infectious agents
A method for diagnosing the exposure to infectious agents in a patient is disclosed. The method determines the levels of antibodies against infectious agents, including bacterial, parasitic, and viral agents. It then compares the results to normal levels to determine the exposure to infectious agents. ...

12/15/05 - 20050277112 - Novel therapeutic processes for treating infectious agents using same epitope specific antigens, and useful compositions therefor
This invention provides novel processes for therapeutic applications, including the treatment of subjects carrying infectious agents or having impaired autoimmunity or impaired immune condition. The therapeutic applications disclosed herein are also directed at the treatment of cancerous subjects with malignant tumors containing cancerous cells or malignant or cancerous cells. Vaccination ...

12/08/05 - 20050272032 - Internal control for in situ hybridization
The invention provides a method for monitoring the quality of in situ hybridization analysis of a nuclear DNA target in a tissue or cell sample using a mitochondrial DNA probe as an internal control. The invention also provides a reagent for in situ hybridization detection of a nuclear DNA target ...

12/08/05 - 20050272031 - Viral variants and uses therefor
Disclosed are viral variants exhibiting reduced sensitivity to particular agents including nucleoside analogues and immunological mediators such as immunoglobulins and immune cells. Also provided are hepatitis B virus (HBV) variants which exhibit a level of replication fitness in the presence of a nucleoside analogue similar to or greater than in ...

12/08/05 - 20050272030 - Nucleic acid constructs for gene expression
Nucleic acid constructs comprising viral genomic nucleic acid which comprises at least two endogenous gene expression regulatory units which each comprise an endogenous promoter where the endogenous promoters of the units are active at the same phase in the viral life cycle of the virus the viral genomic nucleic acid ...

12/08/05 - 20050272029 - Hepatitis c viral-like particle purification
Methods for obtaining HCV complexes and HCV-like particles comprising HCV structural genes are provided. In one method, cells containing HCV-like particles are lysed with digitonin in the presence of protease inhibitors. Polyethylene glycol is slowly added to the lysate, to provide a precipitate that comprises complexes of the HCV structural ...

12/01/05 - 20050266402 - Compositions and methods for binding agglomeration proteins
Amplibody compositions and methods used to interact with agglomeration proteins are disclosed herein. Compositions herein comprise one or more DNA or RNA molecules having affinity for at least one agglomeration protein. The nucleic acid component is a naturally or non-naturally occuring molecule with twenty or more ribonucleotide bases. For RNA, ...

12/01/05 - 20050266401 - Compositions and methods for binding agglomeration proteins
Amplibody compositions and methods used to interact with agglomeration proteins are disclosed herein. Compositions herein comprise one or more DNA or RNA molecules having affinity for at least one agglomeration protein. The nucleic acid component is a naturally or non-naturally occuring molecule with twenty or more ribonucleotide bases. For RNA, ...

12/01/05 - 20050266400 - Novel sequences encoding hepatitis c virus glycoproteins
The present invention concerns a modified nucleic acid molecule comprising a nucleotide sequence coding for a full length hepatitis C virus (HCV) glycoprotein selected from the group consisting of E1 glycoprotein and E1/E2 glycoprotein heterodimer, this molecule having at least one nucleotide alteration, wherein, due to this alteration, at least ...

12/01/05 - 20050266399 - Hcv regulated protein expression
The present invention relates to novel host cell targets for antiviral, preferably anti-hepatitis C virus (HCV), compounds identified by analysis of HCV replicon-regulated polypeptide expression, to prognostic markers for the prediction of the outcome of a viral infection, to in vitro methods for the prediction of the outcome of a ...

12/01/05 - 20050266398 - Method and device for rapid detection and quantitation of macro and micro matrices
The present invention provides a method and device for rapidly detecting the presence of analytes in a sample. Quantitative and qualitative measurements of analyte concentration in a sample may be rapidly obtained. A sample including the analyte and analyte metabolites produced by the analyte are introduced into a vessel that ...

12/01/05 - 20050266397 - Methods for identification of coronaviruses
The present invention provides a method for rapid identification and quantitation of bacteria by amplification of a segment of bacterial nucleic acid followed by analysis by mass spectrometry. The compositions provide for characterization of the molecular masses and base compositions of bacterial nucleic acids which are used to rapidly identify ...

11/24/05 - 20050260569 - Method, device and system for detecting the presence of microorganisms
A method, device and system for detecting the presence of microorganisms in an air sample taken from either a gaseous or liquid environment are described. The method including the steps of a) capturing with a filter microorganisms from the air sample; b) recovering from the filter with a liquid at ...

11/24/05 - 20050260568 - Hepatitis c virus assays
The present invention includes assays useful for identifying inhibitors of Hepatitis C virus (HCV) activity. Particularly, the present invention is directed to a HCV assay useful for high throughput screening that quantifies both the amount of HCV RNA replication inhibitory activity associated with a test compound and the amount of ...

11/24/05 - 20050260567 - Ns5a nucleotide sequence variation as a marker for interferon response
Methods and reagents for determining a nucleotide variation at position 937 of the HCV-1a NS5A gene useful in predicting an individual's response to interferon treatment are presented. ...

11/24/05 - 20050260566 - Methods and compositions for the detection of cervical disease
Methods and compositions for identifying high-grade cervical disease in a patient sample are provided. The methods of the invention comprise detecting overexpression of at least one biomarker in a body sample, wherein the biomarker is selectively overexpressed in high-grade cervical disease. In particular claims, the body sample is a cervical ...

11/24/05 - 20050260565 - Method of screening for modulators of hiv infection
The present invention provides polynucleotides that encode the chemokine receptors 88-2B or 88C and materials and methods for the recombinant production of these two chemokine receptors. Also provided are assays utilizing the polynucleotides which facilitate the identification of ligands and modulators of the chemokine receptors. Receptor fragments, ligands, modulators, and ...

11/24/05 - 20050260564 - Non-cytotoxic orip replicon
The invention provides a vector encoding a derivative of EBNA-1 that is not cytotoxic when expressed efficiently in cells, which supports extrachromosomal replication, maintenance and transcription from extrachromosomal oriP containing vectors but does not substantially activate transcription from host cell genes. Also provided is a vector having oriP and encoding ...

11/24/05 - 20050260563 - Methods for measurement of lymphocyte function
A method for measuring the responses of sets or subsets of lymphocytes to mitogens or antigens in a sample is disclosed comprising incubating a population of cells with a mitogen or antigen, separating the desired subset of cells by means of the interaction of a specific binding reagent that is ...

11/24/05 - 20050260562 - Oligonucleotides for use in determining the presence of human papilloma virus in a test sample
The present invention describes oligonucleotides targeted to HPV Type 16 and/or Type 18 nucleic acid sequences which are particularly useful to aid in detecting HPV type 16 and or 18. The oligonucleotides can aid in detecting HPV Type 16 and/or Type 18 in different ways such as by acting as ...

11/24/05 - 20050260561 - Method for detecting and typing of cutaneous hpv and primers and probes for use therein
The present invention relates to a method for detecting and typing of human papillomavirus (HPV). In particular, the invention relates to a method for detecting and typing cutaneous HPVs of supergroup B and to primers and probes for use in a method of the invention. An important advantage of the ...

11/24/05 - 20050260560 - Novel therapeutic processes for treating cancer with trained or adopted immune cells, and useful compositions therefor
This invention provides novel processes for therapeutic applications, including the treatment of subjects carrying infectious agents or having impaired autoimmunity or impaired immune condition. The therapeutic applications disclosed herein are also directed at the treatment of cancerous subjects with malignant tumors containing cancerous cells or malignant or cancerous cells. Vaccination ...

11/24/05 - 20050260559 - Assay for anti-viral agent
There is provided an assay for selecting an anti-viral agent effective against picornavirus infection. The assay selects an agent which disrupts the association between picornavirus protein 2C and the host cell protein D-AKAP2, which association has been found to be essential for successful viral replication. Also disclosed are anti-viral agents ...

11/17/05 - 20050255462 - Compounds displayed on replicable genetic packages and methods of using same
Replicable genetic packages and collections thereof that display various compounds are provided. In some instances, the replicable genetic packages include nucleic acid tags that serve to record a characteristic of the compound or compounds that are attached to the replicable genetic package. The invention further provides a number of different ...

11/17/05 - 20050255461 - Avian hepatitis e virus, vaccines and methods of protecting against avian hepatitis-splenomegaly syndrome and mammalian hepatitis e
The present invention relates to a novel isolated avian hepatitis E virus having a nucleotide sequence set forth in SEQ ID NO:1 or its complementary strand. The invention further concerns immunogenic compositions comprising this new virus or recombinant products such as the nucleic acid and vaccines that protect an avian ...

11/17/05 - 20050255460 - Methods of diagnosing cervical cancer
The invention provides reagents and methods for detecting pathogen infections in human samples. This detection utilizes specific proteins to detect the presence of pathogen proteins or abnormal expression of human proteins resulting from pathogen infections. Specific methods, compositions and kits are disclosed herein for the detection of oncogenic Human papillomavirus ...

11/17/05 - 20050255459 - Process and apparatus for using the sets of pseudo random subsequences present in genomes for identification of species
Our research conducted with the genome sequences of more than 250 species of organisms (including viral, microbial, and multi-cellular organisms, and human) results in the discovery that the occurrence of a particular subsequence (the so-called “motifs” or “n-mers,” (n being the length of the subsequences), which can be up to ...

11/17/05 - 20050255458 - Drug discovery assays based on the biology of chronic disease
Using the recently discovered biology of chronic disease, the invention presents new methods for evaluating the effectiveness of a compound for use in modulating the progression of chronic disease, for determining whether a subject has a chronic disease, or has an increased risk of developing clinical symptoms associated with such ...

11/17/05 - 20050255457 - Nucleic acids encoding mirafiori lettuce virus protein and utilization thereof
The coat protein of Mirafiori lettuce virus was purified from highly purified Mirafiori lettuce virus, and its partial amino acid sequences were determined. DNA encoding the coat protein of Mirafiori lettuce virus was cloned by the polymerase chain reaction using primers designed based on the determined amino acid sequence information, ...

11/17/05 - 20050255456 - Method and apparatus for detection of bioaerosols
A method and apparatus for evaluating a bioaerosol sample is provided which includes detecting frequency and/or time resolution factors that allow discriminate between a plurality of signals emitted by the bioaerosol to selectively detect biological materials contained in the bioaerosol sample from materials of non-biological origin and potentially associated with ...

11/17/05 - 20050255455 - Eif4e gene mutations and potyvirus resistance
The invention concerns a method for obtaining potyvirus resistant plants exhibiting one or several mutations in a preserved region of the eIF4E translation factor, defined by the following general sequence (I): DX1X2X3X4KSX5QX6AWGSSX7RX8X9YTFSX10VEX11FWX12X13YNNIHX14P SKLX15X16GAD wherein:—X1, X2, X3, X4, X6, X7, X8, X9, X10, X12, X13, X15, et X16 represent each a ...

11/17/05 - 20050255454 - Novel therapeutic processes for enhancing immunized states of vaccinated subjects
This invention provides novel processes for therapeutic applications, including the treatment of subjects carrying infectious agents or having impaired autoimmunity or impaired immune condition. The therapeutic applications disclosed herein are also directed at the treatment of cancerous subjects with malignant tumors containing cancerous cells or malignant or cancerous cells. Vaccination ...

11/10/05 - 20050250096 - Microorganism detection using bacteriophage amplification
A method of detecting the presence or absence of a target microorganism in a sample to be tested comprising: combining with the sample, bacteriophage capable of infecting the target microorganism to create a bacteriophage exposed sample; providing conditions to the bacteriophage exposed sample sufficient to allow the bacteriophage to infect ...

11/10/05 - 20050250095 - Electrophoretic interactive spectral methods and devices for the detection and/or characterization of biological particles
Methods for identifying a biological particle in a sample medium include generating an Electrophoretic Quasi-elastic Light Scattering (EQELS) spectrum for the biological particle in the sample medium. The EQELS spectrum is compared to a reference database comprising a plurality of spectra, and each of the plurality of spectra correspond to ...

11/10/05 - 20050250094 - Method for detecting analytes based on evanescent illumination and scatter-based detection of nanoparticle probe complexes
The invention provides methods of detecting one or more specific binding analytes, such as nucleic acids and proteins, in the presence of a neutral or anionic polysaccharide, through light scattering techniques, where a change in light scattering caused by the formation of nanoparticle label complexes within the penetration depth of ...

11/10/05 - 20050250093 - Hepatitis c virus sub-genomic replicons
The present invention relates generally to the construction of sub-genomic HCV replicon systems that may provide the foundation for generating HCV replicons of all six major genotypes and subtypes to facilitate screening, testing, and evaluating anti-infective agents for HCV disease(s). ...

11/10/05 - 20050250092 - Amplification-hybridisation method for detecting and typing human papillomavirus
The present invention provides amplification and hybridisation method for detecting and typing human papillomavirus (HPV), and the primers and hybridisation probes used in the method. The invention relates to a concrete part of the HPV genome, which is suitable for designing HPV genus-specific and HPV genotype-specific hybridisation oligonucleotide probes. ...

11/03/05 - 20050244820 - Detecting molecular binding by monitoring feedback controlled cantilever deflections
The present methods and apparatus concern the detection and/or identification of target analytes using probe molecules. In various embodiments of the invention, the probes or analytes are attached to one or more cantilevers. Binding of a probe to an analyte results in deflection of the cantilever, detected by a detection ...

11/03/05 - 20050244819 - Assay system for screening protease inhibitors
Compositions and methods for identifying agents that inhibit protease activity are provided. In particular, polynucleotides, recombinant expression vectors, and host cells are provided that may be used in a bacterial cell-based assay for identifying agents that are inhibitors of protease activity, such as inhibitors of HIV protease activity. The bacterial ...

11/03/05 - 20050244818 - Single cell analysis of hiv replication capacity and drug resistance
A novel single-cell-level phenotypic assay is described, which can simultaneously analyze HIV-1 drug susceptibility and intrinsic replication capacity. This allows quantitative dissection of the functions of antiretroviral drugs into suppression of viral replication and selection of resistant viruses with diminished replication capacities. The disclosed assay provides a tool for the ...

11/03/05 - 20050244817 - Mammalian genes involved in viral infection and tumor suppression
The present invention provides methods of identifying cellular genes necessary for viral growth and cellular genes that function as tumor suppressors. Thus, the present invention provides nucleic acids related to and methods of reducing or preventing viral infection or cancer. The invention also provides methods of producing substantially virus-free cell ...

11/03/05 - 20050244816 - Immunoassays, haptens, immunogens and antibodies for anti-hiv therapeutics
This invention provides compounds, methods, immunoassays, and kits relating to active, metabolically sensitive (“met-sensitive”) moieties of anti-HIV therapeutics, such as HIV protease inhibitors (PI) and HIV non-nucleoside reverse transcriptase inhibitors (NNRTI). ...

11/03/05 - 20050244815 - Compositions and methods for viral resistance genes
The present invention is directed to methods and compositions for identifying viral resistance genes and for identifying individuals having resistant or susceptible genotypes. Once identified as either resistant or susceptible, appropriate actions, such as vaccination, can be undertaken by the individuals. In particular, methods and compositions for identifying genes associated ...

11/03/05 - 20050244814 - Detection of west nile virus
A method and device for detecting a West Nile Virus (WNV) infection including contacting a biological sample from a subject with an anti-IgM antibody and a recombinant WNV E polypeptide and detecting whether the polypeptide substantially binds to an antibody in the sample. The invention also includes a method and ...

11/03/05 - 20050244813 - Detection of human papillomavirus e6 mrna
An oligonucleotide molecule for use in the detection of mRNA transcribed from the E6 gene of a human papillomavirus, the oligonucleotide comprising any one of sequence numbers 1-133. ...

10/27/05 - 20050239058 - Method for the detection, identification, enumeration and confirmation of virally infected cells and other epitopically defined cells in whole blood
A method for analyzing blood enables one to isolate, detect, enumerate and confirm under magnification the presence of target cells which have expressed surface epitopes that indicate intracellular infection by various viruses or other infectious agents, and also cells which have expressed surface epitopes that indicate the presence of non-infectious ...

10/27/05 - 20050239057 - Multiplex rt-pcr/pcr for simultaneous detection of bovine coronavirus, bovine rotavirus, cryptosporidium parvum, and escherichia coli
The present invention provides a multiplex RT-PCR/PCR method, which enables in a single assay the simultaneous detection of any combination of bovine rotavirus, bovine coronavirus, Cryptosporidium parvum, and optionally, Escherichia coli strains producing K99 pili or heat-stable enterotoxin STa. ...

10/27/05 - 20050239056 - Methods and kits for predicting an infectious disease state
The present invention discloses methods for predicting an infectious disease state of a subject. The methods are rapid, simple, and do not require culturing of the causative infectious agent. ...

10/27/05 - 20050239055 - Enterovirus primers and probes
The present invention provides methods, primers and probes for the detection of enteroviral nucleic acids in biological fluids and tissue. In the methods of the invention, at least a portion of enteroviral nucleic acid present in a biological sample suspected of containing an enterovirus is amplified and the amplified enteroviral ...

10/27/05 - 20050239054 - Method and compositions for identifying anti-hiv therapeutic compounds
Methods are provided for identifying anti-HIV therapeutic compounds substituted with carboxyl ester or phosphonate ester groups. Libraries of such compounds are screened optionally using the novel enzyme GS-7340 Ester Hydrolase. Compositions and methods relating to GS-7340 Ester Hydrolase also are provided. ...

10/27/05 - 20050239053 - New mutational profiles in hiv-1 reverse transcriptase correlated with phenotypic drug resistance
The present invention is directed to the field of nucleic acid diagnostics and the identification of base variation in target nucleic acid sequences. More particularly, the present invention relates to the use of such genotypic characterization of a target population of HIV and the subsequent association, i.e., correlation, of this ...

10/27/05 - 20050239052 - Cloning of rhadinovirus genome and methods for its use
An isolated virus is provided (Japanese Macaque Herpesvirus, JMHV), as deposited with ATCC as deposit accession number PTA-1884, as are viral particles including this virus and host cells infected with this virus. A purified polypeptide is also provided that includes an amino acid sequence that has at least 95% sequence ...

10/20/05 - 20050233317 - Modulate aptamer and method of detecting target protein by using the same
The object of the present invention is the development of a novel strategy for providing an effective biosensor which forms a conjugate and stabilizes only in the presence of a target protein or substance to be analyzed. That is, the present invention provides a modulate aptamer which specifically binds with ...

10/20/05 - 20050233316 - Major neutralization site of hepatitis e virus and use of this neutralization site in methods of vaccination and in methods of screening for neutralizing antibodies to hepatitis e virus
The invention describes the identification of a major neutralization site of hepatitis E virus (HEV) and the use of this neutralization site in methods of vaccination and in methods of screening for neutralizing antibodies to HEV. The invention also describes the isolation and characterization of neutralizing chimpanzee monoclonal antibodies reactive ...

10/20/05 - 20050233315 - Cloned genes encoding reverse transcriptase lacking rnase h activity
The invention relates to a gene which encodes reverse transcriptase having DNA polymerase activity and substantially no RNase H activity. The invention also relates to vectors containing; the gene and hosts transformed with the vectors of the invention. The invention also relates to a method of producing reverse transcriptase having ...

10/20/05 - 20050233314 - Sensitive and quantitative detection of pathogens by real-time nested pcr
The invention describes compositions and methods for detecting and/or quantifying an RNA or DNA pathogen in a sample. The method comprises a two-round real-time nested PCR, which allows detection of less than 10 copies of RNA or DNA of the pathogen in a sample. The method of the invention is ...

10/20/05 - 20050233313 - Methods and reagents for identifying inhibitors of viral protease activity
The present invention provides reagents and methods for identifying inhibitors of retrovirus protease activity. In particular embodiments, the retrovirus is HIV. Also provided are kits, nucleic acids and proteins for carrying out the methods of the invention. ...

10/20/05 - 20050233312 - Mutational profiles in hiv-1 protease correlated with phenotypic drug resistance
The present invention is directed to the field of nucleic acid diagnostics and the identification of base variation in target nucleic acid sequences. More particularly, the present invention relates to the use of such genotypic characterization of a target population of HIV and the subsequent association, i.e., correlation, of this ...

10/20/05 - 20050233311 - Family of picornaviruses
The present invention relates to a new family of viruses within the Picornavirus family. The present invention also relates to an isolated nucleic acid from said virus or fragments of said nucleic acid. The present invention also relates to an isolated protein of said virus or an immunogenic fragment thereof. ...

10/20/05 - 20050233310 - Screening method
The present invention relates to a method of screening a protein for involvement in cancer. The method involves the steps of: exposing the protein to a first viral oncoprotein; assaying for interaction of the protein and the first viral oncoprotein; exposing the protein to a second viral oncoprotein; and assaying ...

10/13/05 - 20050227227 - Amplification of hiv-1 gag sequences for detection of sequences associated with drug-resistance mutations
Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are ...

10/13/05 - 20050227226 - Surrogate cell-based system and method for assaying the activity of hepatitis c virus ns3 protease
The present invention concerns the development of a cell-based assay system having improved sensitivity to HCV NS3 protease activity when compared to known assays, which is useful for screening test compounds capable of modulating (particularly inhibiting) HCV NS3 protease activity. This system provides a first construct comprising a transactivator domain ...

10/13/05 - 20050227225 - Stabilization of biomolecules in samples
This invention generally relates to stabilized non-blood-based samples in which microbial biomolecules in non-blood-based samples are stable at high temperatures. The stabilized non-blood-based samples include effective amounts of stabilization components to stabilize the microbial biomolecules in the samples. Stabilization components are typically effective at low levels in these stabilized non-blood-based ...

10/13/05 - 20050227224 - Infectious cdna of an approved vaccine strain of measles virus, use for immunogenic compositions
The invention relates to a cDNA molecule which encodes the nucleotide sequence of the full length antigenomic (+)RNA strand of a measles virus (MV) originating from an approved vaccine strain. It also concerns the preparation of immunogenic compositions using said cDNA. ...

10/13/05 - 20050227223 - Method of judging viral infection
A method for diagnosing a viral infection without complicating bacterial infection, which comprises determining a C-reactive protein and an MxA protein in a biological sample; a kit for judging viral infection without complicating bacterial infection, which comprises a reagent for determining a C-reactive protein and a reagent for determining an ...

10/06/05 - 20050221301 - Reference clones and sequences for non-subtype b isolates of human immunodeficiency virus type 1
The nucleotide sequences of the genomes of eleven molecular clones for non-subtype B isolates of human immunodeficiency virus type 1 are disclosed. The invention relates to the nucleic acids and peptides encoded by and/or derived from these sequences and their use in diagnostic methods and as immunogens. ...

10/06/05 - 20050221300 - Diagnostic assays for parvovirus b19
Human parvovirus B19 primers and probes derived from conserved regions of the parvovirus B19 genome are disclosed. Also disclosed are nucleic acid-based assays using the primers and probes. ...

10/06/05 - 20050221299 - Peptide from the glycoprotein b from human herpesvirus 7 for use in a serological elisa test
The invention concerns an immunogenic peptide comprising at least six consecutive amino acids of a hydrophilic region of the glycoprotein B (gB) of the human herpesvirus-7 (HIV-7), and reacting specifically with antibodies directed against HHV-7, and diagnosis kit containing it. ...

10/06/05 - 20050221298 - Anti-idiotypic antibody and its use in diagnosis and therapy in hiv-related disease
The present invention provides an anti-idiotypic antibody having specific reactivity with an idiotope common to more than one type of anti-HIV-1 antibody, and having no specific reactivity with non-HIV-1 antibodies. The present invention provides methods of diagnosis, monitoring and treatment of HIV-related diseases through the use of this antibody or ...

10/06/05 - 20050221297 - Diagnostic reagent for hepatitis c virus infection
A diagnostic reagent for hepatitis C virus infection obtained by sensitizing a solid phase with HCV antigen and a conjugated antigen prepared by chemical bonding of HCV antigen and a carrier protein, and a method of diagnosing hepatitis C virus infection, which comprises adding the diagnostic reagent for hepatitis C ...

10/06/05 - 20050221296 - Hepatitis-c virus type 4, 5 and 6
The present invention relates to a polynucleic acid composition comprising or consisting of at least one polynucleic acid containing 8 or more contiguous nucleotides corresponding to a nucleotide sequence from the region spanning positions 417 to 957 of the Core/E1 region of HCV type 3; and/or the region spanning positions ...

10/06/05 - 20050221295 - Peptides from the e7 protein of human papilloma viruses 16 and 18 for detecting and/or diagnosing cervical and other human papilloma virus associated cancers
An isolated protein sequence or peptide from the E2, E6 or E7 early coding region of human papillomavirus (HPV) that is soluble in an aqueous medium, and characterized by a relative paucity of tryptophan, methionine and cysteine residues, and a relative abundance of glycine and asparagine residues. Also disclosed are ...

10/06/05 - 20050221294 - Inhibitors of hiv membrane fusion
Inhibitors of HIV membrane fusion and a method of identifying drugs or agents which inhibit binding of the N-helix coiled-coil and the C helix of HIV gp41 envelope protein. ...

10/06/05 - 20050221293 - Dna virus microrna and methods for inhibiting same
The invention relates to isolated nucleic acid molecules comprising the sequence of any one of the DNA virus microRNAs shown in Table A1. In another embodiment, the invention relates to single stranded DNA virus microRNA molecules and anti-DNA virus microRNA molecules. ...

10/06/05 - 20050221292 - Vectors with modified protease-dependent tropism
The present invention provides cell fusogenic vectors having replicative ability, whose protease-dependent tropism has been modified. M gene-deficient viral vectors encoding modified F proteins, in which the cleavage site of the F protein of paramyxovirus is modified to be cleaved by different proteases, were produced. In cells transfected with these ...

10/06/05 - 20050221291 - Dc-sign isoforms, related compositions and methods for their use in disease therapy
The present invention provides polypeptides of DC-SIGN 1, DC-SIGN2 and DC-SIGN3 isoforms, nucleic acids encoding these polypeptides, and methods of use in treating disease and modulating immune responses. ...

10/06/05 - 20050221290 - Identification and validation of novel targets for agrochemicals
The invention relates to a method for identifying and validating plant targets for agrochemicals, comprising the steps of determining gene or protein expression profiles in function of the progression of an essential biological process in a plant, and the subsequent downregulation of expression of said gene or protein in a ...

10/06/05 - 20050221289 - Altering viral tropism
Methods of altering retroviral tropism have been discovered. Such methods are useful, e.g., for developing retroviral vectors for gene therapy. ...

10/06/05 - 20050221288 - Variant tat proteins and methods for use thereof
Variants of the HIV-1 Tat protein exhibiting higher transcriptional activation and stronger P-TEFb binding than wild-type Tat are provided. In addition variants that can inhibit transcription activation by wild-type Tat are provided. Nucleic acid sequences encoding these variants, vectors and host cells for expression of these variants, and antibodies raised ...

10/06/05 - 20050221287 - Functional inactivation of cxcr4-mediated responses in growth hormone transgenic mice through socs53 upregulation
A method is provided of identifying compounds for use in a pharmaceutical composition having an anti-viral effect against CXCR4-dependent HIV activity comprising: providing a first aliquot of CXCR-4-expressing GH-Tg cells; contacting said first aliquot with HIV particles; providing a second aliquot of CXCR4-expressing GH-Tg cells; contacting said second aliquot with ...

10/06/05 - 20050221286 - Protease assay for therapeutic drug monitoring
The present invention concerns a further development and use of biological assays to determine the amount or concentration of an active ingredient present in a sample. The enzyme assay of the present invention determines the amount or concentration of protease inhibitors, including retroviral protease inhibitors such as HIV inhibitors. ...

10/06/05 - 20050221285 - Method for identifying or screening anti-viral agents
Anti-viral agents which may be effective for treating, for example, respiratory infections by Respiratory Syncytial Virus (RSV). A three-dimensional structure model of the RSV-F protein has been generated and described which can be used to identify, screen, and/or develop anti-viral agents, including RSV neutralising antibodies. The structure model may also ...

10/06/05 - 20050221284 - Heteropolymer complexes and methods for their use
The present invention relates to an improved heteropolymer complex. The improved heteropolymer complex comprises a first monoclonal antibody specific for a C3b-like receptor (known as complement receptor (CR1) or CD35 in primates and Factor H in other mammals, e.g., dog, mouse, rat, pig, rabbit) site chemically crosslinked (covalently linked) to ...

10/06/05 - 20050221283 - Biochip
Improved biochips comprise a matrix layer coupled to a substrate, wherein the matrix layer includes a plurality of ligands in a plurality of predetermined positions and wherein ligands bind to an anti-ligand disposed in a sample fluid. Preferred matrix layers are multi-functional matrix layers that reduce autofluorescence, incident-light-absorption, charge-effects, and/or ...

09/29/05 - 20050214752 - Compositions and methods for determining epistatic relationships between hiv mutations that affect replication capacity
This invention relates to methods for predicting replication capacity of a virus based on its genotype. It also relates to determining epistatic relationships between viral mutations, including those that affect replication capacity. It also relates to identifying targets for antiviral therapy by identifying mutations associated with altered replication capacity. The ...

09/29/05 - 20050214751 - Inhibition of viral maturation, methods and compositions related thereto
The application relates to methods of inhibiting a Nef-mediated process in a cell infected with HIV. The application also provides methods and compositions for treating POSH-associated and HERPUD1-associated diseases such as viral disorders. ...

09/29/05 - 20050214750 - Compositions and methods for determining the replication capacity of a pathogenic virus
This invention relates to methods for predicting replication capacity of a virus based on genotype and identifying targets for antiviral therapy by identifying mutations associated with altered replication capacity. The methods are useful, for example, for identifying previously unknown interactions among viral molecules or between viral molecules and host cell ...

09/29/05 - 20050214749 - Method for determining reduced susceptibility of hiv to protease inhibitor treatment
The present invention provides methods and devices for predicting whether a HIV variant will be resistant to an antiviral drug based on the variant's genotype. In one aspect, methods are provided comprising determining whether a combination of protease inhibitor resistance mutations meet certain conditions, as disclosed herein, thereby assessing the ...

09/29/05 - 20050214748 - Peptide-based diagnostic reagents for sars
The present invention is directed to antigenic peptides and peptide compositions selected from the Membrane glycoprotein (M), the Spike glycoprotein (S), and the Nucleocapsid (N) protein antigens of the SARS coronavirus (SCoV). The present invention is also directed to methods of use of the peptides of the invention, e.g., for ...

09/29/05 - 20050214747 - Compositions and methods for analysis of target analytes
Compositions and methods are provided for analyzing a sample for the presence or absence of one or more target analytes. ...

09/29/05 - 20050214746 - Compositions and methods for determining anti-viral drug susceptibility and resistance and anti-viral drug screening
This invention provides a method for determining susceptibility for an anti-viral drug comprising: (a) introducing a resistance test vector comprising a patient-derived segment and an indicator gene into a host cell; (b) culturing the host cell from (a); (c) measuring expression of the indicator gene in a target host cell; ...

09/29/05 - 20050214745 - Gas-borne matter collection device
A device for collecting viable gas-borne matter includes an inlet and an outlet and a plate provided intermediate the inlet and the outlet and having a first surface facing the inlet and a second surface facing the outlet. A substance is provided on the first surface of the plate for ...

09/29/05 - 20050214744 - New mutational profiles in hiv-1 reverse transcriptase correlated with phenotypic drug resistance
The present invention is directed to the field of nucleic acid diagnostics and the identification of base variation in target nucleic acid sequences. More particularly, the present invention relates to the use of such genotypic characterization of a target population of HIV and the subsequent association, i.e., correlation, of this ...

09/29/05 - 20050214743 - Compositions and methods for evaluating viral receptor/co-receptor usage and inhibitors of virus entry using recombinant virus assays
The present invention provides a method for identifying whether a compound inhibits entry of a virus into a cell which comprises: (a) obtaining nucleic acid encoding a viral envelope protein from a patient infected by the virus; (b) co-transfecting into a first cell (i) the nucleic add of step (a), ...

09/22/05 - 20050208483 - Kits for detecting anti-sirs antibodies
The invention includes kits for producing and using immunogenic compositions that include swine infertility and respiratory virus. The invention also includes vaccines and sera for treatment of Mystery Swine Disease (MSD), a method for producing the vaccine, methods for diagnosis of MSD, a viral agent that will mimic “mystery swine ...

09/22/05 - 20050208482 - Tat-based immunomodulatory compositions and methods for their discovery and use
A method for identifying new immunomodulatory chemical entities (NICE) comprising reacting a candidate NICE with a Tat SH3 binding domain, identifying the bound candidate NICE and determining whether the candidate NICE induces monocytes to differentiate into dendritic cells (DC) or regulatory macrophages (AReg). In particular, the present invention relates to ...

09/22/05 - 20050208481 - Diagnostic device using gp40
Assay methods and devices for detecting antibodies to Feline Immunedeficiency Virus (FIV) using an FIV envelope polypeptide such as recombinant gp40. ...

09/22/05 - 20050208480 - Apl immunoreactive peptides, conjugates thereof and methods of treatment for apl antibody-mediated pathologies
aPL analogs that (a) bind specifically to B cells to which an aPL epitope binds and are disclosed. Optimized analogs lack T cell epitope(s) are useful as conjugates for treating aPL antibody-mediated diseases. Conjugates comprising aPL analogs and nonimmunogenic valency platform molecules are provides as are novel nonimmunogenic valency platform ...

09/22/05 - 20050208479 - Human antibodies for use as a therapeutic agent against vaccinia or small pox
Fully human antibodies or antibody fragments have a binding affinity to one or more vaccinia or variola antigens and the ability to neutralize the virus. ...

09/15/05 - 20050202418 - Hcv peptide compositions
A family of cDNA sequences derived from hepatitis C virus (HCV) are provided. These sequences encode antigens which react immunologically with antibodies present in individuals with non-A non-B hepatitis (NANBV), but which are absent from individuals infected with hepatitis A virus, or hepatitis B virus, and also are absent in ...

09/15/05 - 20050202417 - Method of detecting and quantifying hepatitis c virus
Methods, reagents, and kits for detecting hepatitis C virus (HCV) in biological samples. ...

09/15/05 - 20050202416 - Mouse hepatitis virus detection
The present invention relates to the identification of a nucleotide sequence that is conserved in the genome of the Mouse Hepatitis Virus (MHV) and to the design and construction of synthetic nucleotide primers and probes that target this conserved region. The invention further provides for methods and kits that use ...

09/15/05 - 20050202415 - Replikin peptides and uses thereof
The present invention provides a new class of peptides related to rapid replication and high human mortality, and their use in diagnosing, preventing and treating disease. ...

09/15/05 - 20050202414 - Apparatus and methods for detecting a microbe in a sample
Apparatus for detecting one or more microbes in a sample includes a substrate having a plurality of microbe identification sites with nucleic acid probes disposed thereon, each nucleic acid probe having a nucleotide sequences that is complementary to nucleotide sequences of nucleic acids of one or more microbes. Nucleotide sequences ...

09/15/05 - 20050202413 - Varicella zoster virus (vzv) immunoreactive protein vp26 and its diagnostic use
Varicella zoster virus (VZV) immunoreactive protein VP26 and its diagnostic use are described. The invention relates to immunoreactive peptides which are homologous with the region of amino acid positions 12 to 235 of the varicella zoster virus protein VP26, to nucleic acids which encode these peptides and to the use ...

09/08/05 - 20050196750 - Determination of hepatitis c virus genotype
The present invention provides compositions and methods for the detection and characterization of HCV sequences. More particularly, the present invention provides compositions, methods and kits for using invasive cleavage structure assays (e.g. the INVADER assay) to screen nucleic acid samples, e.g., from patients, to determine HCV genotype. ...

09/08/05 - 20050196749 - Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment
The present invention encompasses novel antibodies and fragments thereof which immunospecifically bind to one or more RSV antigens and compositions comprising said antibodies and antibody fragments. The present invention encompasses methods preventing respiratory syncytial virus (RSV) infection in a human, comprising administering to said human a prophylactically effective amount of ...

09/01/05 - 20050191622 - Compositions, methods and kits for detection of an antigen on a cell and in a biological mixture
The present invention relates to novel methods for detecting a member of a known binding pair in a sample, including a cell, where one member of the pair (termed the “receptor”) is expressed by a bacteriophage, which phage is then used to detect the presence of the other member of ...

09/01/05 - 20050191621 - Cd4-independent hiv envelope proteins as vaccines and therapeutics
The invention relates to novel CD4-independent HIV Envelope proteins and uses therefor. ...

09/01/05 - 20050191620 - Particle on membrane assay system
Described herein is an analyte detection device and method related to a portable instrument suitable for point-of-care analyses. In some embodiments, a portable instrument may include a disposable cartridge, an optical detector, a sample collection device and/or sample reservoir, reagent delivery systems, fluid delivery systems, one or more channels, and/or ...

09/01/05 - 20050191619 - Dna purification and recovery from high particulate and solids samples
This invention relates to methods for rapid nucleic acid purification from sources heavily contaminated with high particulate material, such as cellular debris, and solids, including suspended solids. In particular, this invention provides methods for rapid, quantifiable recovery and purification of nucleic acids from a variety of sources heavily contaminated with ...

09/01/05 - 20050191618 - Rna interference mediated inhibition of human immunodeficiency virus (hiv) gene expression using short interfering nucleic acid (sina)
This invention relates to compounds, compositions, and methods useful for modulating human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of human immunodeficiency virus ...

09/01/05 - 20050191617 - Pramyxovirusl vectors encoding antibody and utilization thereof
The present invention provides paramyxoviral vectors expressing polypeptides that comprise antibody variable regions. A vector of this invention, encoding antibody variable regions of the H and L chains, succeeded in simultaneously expressing these antibody chains to form a Fab, and further succeeded in expressing a single chain antibody at a ...

08/25/05 - 20050186565 - Method and spectral/imaging device for optochemical sensing with plasmon-modified polarization
The invention discloses a method and spectral-imaging device for optochemical sensing with plasmon-modified multiband fluorescence polarization and with plasmon-modified polarization phase shift changes of a light beam reflected and/or passed through a total internal reflection conducting structure. The optochemical sensing is performed for molecules placed nearby the conducting structure and ...

08/25/05 - 20050186564 - Production of proteins
The present invention relates to a process for the recombinant production of a desired heterologous polypeptide with a clearly defined homogenous N-terminus in a bacterial host cell. A fusion protein comprising a peptide with the autoproteolytic activity of an autoprotease Npro of a pestivirus and the heterologous polypeptide is initially ...

08/25/05 - 20050186563 - Dna transfection system for the generation of infectious influenza virus
The present invention is based on the development of a dual promoter system (preferably a RNA pol I-pol II system) for the efficient intracellular synthesis of viral RNA. The resultant minimal plasmid-based system may be used to synthesize any RNA virus, preferably viruses with a negative single stranded RNA genome. ...

08/25/05 - 20050186562 - Assay for the diagnosis of flaviviral infection using antibodies with high affinity for ns1 protein of flavivirus in hexameric form
The invention concerns a method for early detection of a flavivirus-induced infection, comprising the detection of the flavivirus non-structural glycoprotein NS1 in a biological sample during the clinical phase of the infection, by an immumological method using at least two identical or different antibodies, the first antibody consisting of polyclonal ...

08/25/05 - 20050186561 - Methods of diagnosing tissue fibrosis
The present invention provides a method of diagnosing the presence or severity of tissue fibrosis in an individual by detecting α2-macroglobulin (α2-MG) in a sample from the individual; detecting hyaluronic acid (HA) in a sample from the individual; detecting tissue inhibitor of metalloproteinases-1 (TIMP-1) in a sample from the individual; ...

08/25/05 - 20050186560 - Retrovirus isolated from mantle histiocytes in mantle cell lymphoma
The present invention features an isolated, intact virus associated with human lymphoma, and originally isolated from a mantle cell lymphoma, referred to herein as a mantle histiocyte retrovirus (MHRV). The invention also features compositions and methods for detecting MHRV, as well as methods and compositions for propagating MHRV in vitro, ...

08/18/05 - 20050181359 - Compositions of erythropoietin isoforms comprising lewis-x structures and high sialic acid content
Disclosed are immortalized human embryonic retina cells, having a nucleic acid sequence encoding an adenoviral E1A protein integrated into the genome of the cells, and further comprising a nucleic acid sequence encoding an enzyme involved in post-translational modification of proteins, such as a sialyltransferase, wherein said nucleic acid sequence encoding ...

08/18/05 - 20050181358 - Soluble complex comprising a retroviral surface glycoprotein
The present invention relates to the diagnosis of HIV infections. It especially teaches the production of a soluble retroviral surface glycoprotein-(or transmembrane glycoprotein)-chaperone complex and the advantageous use of a chaperone-antigen complex especially in the detection of antibodies to HIV in immunoassays, preferably according to the double antigen bridge concept, ...

08/18/05 - 20050181357 - High-throughput diagnostic assay for the human virus causing severe acute respiratory syndrome (sars)
The present invention relates to a high-throughput diagnostic assay for the virus causing Severe Acute Respiratory Syndrome (SARS) in humans (“hSARS virus”). In particular, the invention relates to a high-throughput reverse transcription-PCR diagnostic test for SARS associated coronavirus (SARS-CoV). The present assay is a rapid, reliable assay which can be ...

08/18/05 - 20050181356 - Hepatitis c virus assay systems
The present invention features assays employing a beta-lactamase reporter system, an HCV replicon enhanced cell, and/or a chimeric HCV replicon containing a 3′ UTR based on the HCV-1a 3′ UTR. These features can be employed alone or together, and are preferably combined together to measure HCV replicon activity and the ...

08/18/05 - 20050181355 - Compositions and methods for the modulation of viral maturation
This application describes a family of nucleic acid sequences and proteins encoded thereby that play a role in viral maturation: the Alternate Viral Maturation Scaffolding Protein, or the AVMSP family of proteins. ...

08/11/05 - 20050175992 - Method for the rapid diagnosis of targets in human body fluids
More particularly, the present invention relates to a method for the detection of a target, e.g. pathogen in a human body fluid wherein a body fluid sample is collected with a swab member. ...

08/11/05 - 20050175991 - Method for produce sanitation using bacteriophages
A method for produce sanitation using bacteriophages is disclosed. According to one embodiment of the present invention, the method includes the steps of (1) providing at least one bacteriophage; and (2) applying the bacteriophage to the produce. The produce may include fruits and vegetables. The produce may be freshly-cut produce, ...

08/11/05 - 20050175990 - Method for typing and detecting hbv
The present invention relates to a method for detection and/or genetic analysis of HBV in a biological sample, comprising hybridizing the polynucleic acids of the sample with a combination of at least two nucleotide probes, with said combination hybridizing specifically to a mutant target sequence chosen from the HBV RT ...

08/11/05 - 20050175989 - Method and detector for identifying subtypes of human papilloma viruses
A detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detector comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype ...

08/11/05 - 20050175988 - Multiple virus reaction assay
A method of assay for the outcome of a reaction comprises conducting a reaction between a first reactant and a second reactant to produce from the first reactant a product having at least one new structural feature not present in the first reactant or the second reactant, e.g. by cleaving ...

08/11/05 - 20050175987 - Fluorescent multiplex hpv pcr assays using multiple fluorophores
The present invention relates a fluorescent multiplex PCR assay for detecting the presence of an HPV subtype in a sample using multiple fluorophores to simultaneously detect a plurality of HPV genes of the same HPV subtype. The present invention also relates to primer pairs and probes specific to HPV subtypes ...

08/11/05 - 20050175986 - Human monoclonal antibody
This invention relates to novel human monoclonal antibodies (mAbs) and to the genes encoding same. More specifically, this invention relates to human monoclonal antibodies specifically reactive with an epitope of the fusion (F) protein of Respiratory Syncytial Virus (RSV). Such antibodies are useful for the therapeutic and/or prophylactic treatment of ...

08/11/05 - 20050175985 - Cold-adapted equine influenza viruses
The present invention provides experimentally-generated cold-adapted equine influenza viruses, and reassortant influenza A viruses comprising at least one genome segment of such an equine influenza virus, wherein the equine influenza virus genome segment confers at least one identifying phenotype of the cold-adapted equine influenza virus, such as cold-adaptation, temperature sensitivity, ...

08/04/05 - 20050170339 - Method and kit for detecting resistance to anitviral drugs
Assays and kits for the detection of phenotypic resistance of a retrovirus to reverse transcriptase inhibitor-drugs in a biological sample. The assays are based on the direct analysis of the susceptibility of retroviral reverse transcriptase to inhibition by a reverse transcriptase inhibitor drug. The enzymatic activity of the reverse transcriptase ...

08/04/05 - 20050170338 - Norovirus detection reagent
The present invention provides a combination of oligonucleotides preferable for composing a gene testing reagent capable of detecting all subtypes of norovirus rapidly and with high sensitivity. More specifically, the present invention provides a detection method in which only norovirus is specifically amplified and an oligonucleotide that binds to a ...

08/04/05 - 20050170337 - Oligomerization of hepatitis delta antigen
This invention relates to HDAg peptides, including mutants, derivatives fragments and fusion molecules, including fusion proteins, coiled-coil oligomers, nucleic acid molecules, vectors comprising HDAg nucleic acid molecules, cells comprising said molecules, methods of multivalent expression and association of binding moieties of HDAg fusion molecules, and methods of use involving the ...

08/04/05 - 20050170336 - Multifunctional biomaterials as scaffolds for electronic, optical, magnetic, semiconducting, and biotechnological applications
One-dimensional ring structures form M13 viruses were constructed by two genetic modifications encoding binding peptides and synthesis of a heterobifunctional linker molecule. The bifunctional viruses displayed an anti-streptavidin peptide and hexahistidine (SEO ID NO: 4) peptide at opposite ends of the virus as pIII and pIX fusions. Stoichiometic addition of ...

08/04/05 - 20050170335 - Detection of prrsv
This invention provides compositions and methods for the detection of porcine reproductive and respiratory syndrome viruses (PRRSV). The invention provides oligonucleotides containing sequences complementary to those in ORF 7 and the 3′-UTR (untranslated region) of PRRSV which oligonucleotides may be used to detect the presence of PRRSV sequences, and thus ...

08/04/05 - 20050170334 - Human monoclonal antibodies to influenza m2 protein and methods of making and using same
Human, humanized and chimeric monoclonal antibodies that bind to influenza M2 protein. The antibodies are useful for, among other things, treatment, diagnostics, purifying and isolating M2 or influenza virus, and identifying the presence of M2 or influenza virus in a sample or a subject. ...

08/04/05 - 20050170333 - Identification of etiology of autism
Disclosed herein is a method for following up a prognosis of children with autism before and after treatment with different modalities administered by their clinicians, confirming the involvement of infectious agents, dietary proteins, and toxic chemicals in development of autism. The method utilizes detection of increased amounts of antibodies against ...

07/28/05 - 20050164176 - Nucleic acid and amino acid sequences of infectious salmon anaemia virus and their use as vaccines
The present invention provides the use of nucleic acid sequences and/or amino acid sequences in the preparation of a vaccine for the protection of fish against infectious salmon anaemia virus. Specifically, such vaccines contain at least one nucleic acid sequence which is derived from ISAV or synthetically prepared analogues thereof, ...

07/28/05 - 20050164175 - Recombinant rsv virus expression systems and vaccines
The present invention relates to genetically engineered recombinant RS viruses and viral vectors which contain heterologous genes which for the use as vaccines. In accordance with the present invention, the recombinant RS viral vectors and viruses are engineered to contain heterologous genes, including genes of other viruses, pathogens, cellular genes, ...

07/28/05 - 20050164174 - Methods to identify polynucleotide and polypeptide sequences which may be associated with physiological and medical conditions
The present invention provides methods for identifying evolutionarily significant polynucleotide and polypeptide sequences in human and/or non-human primates which may be associated with a physiological condition, such as enhanced resistance to HCV infection. The invention also provides methods for identifying evolutionarily significant polynucleotides with mutations that are correlated with susceptibility ...

07/28/05 - 20050164173 - Combined treatments and methods for treatment of mycoplasma and mycoplasma-like organism infections
Methods of treating, and pharmacological formulations and administration methods for treating, mycoplasma-like organism infections in pathological situations. Combinations of antibiotics, targeting different mycoplasma metabolic pathways, are combined with antioxidants to reduce oxidative stresses. This treatment improves host cell resistance to oxidative stress while reducing mycoplasma infection levels. ...

07/28/05 - 20050164172 - Modulation of hsv infection
Toll-like receptor 2 (TLR2) has been found to mediate certain effects of HSV infection, particularly in neonates. Compounds that decrease TLR2 expression or activity are useful for ameliorating such deleterious effects. ...

07/28/05 - 20050164171 - High-throughput assay for virus entry and drug screening
The present invention provides a rapid virus entry/binding detection assay. An enzyme such as luciferase was incorporated at the C-terminal end of viral envelope proteins of the HIV Nef protein that would specifically associate with cell membranes to deliver the enzyme into viral particles upon viral assembly. Virus entry/binding can ...

07/28/05 - 20050164170 - Neurovirulent strain of the west nile virus and uses thereof
Neuroinvasive and neurovirulent strain of the West Nile virus, named IS-98-ST1, nucleic acid molecules derived from its genome, proteins and peptides encoded by said nucleic acid molecules, and uses thereof. ...

07/28/05 - 20050164169 - Method of plasmon-enhanced properties of materials and applications thereof
Methods and applications of surface plasmon resonance-enhanced antibacterial, anti-adhere, adhere, catalytic, hydrophilic, hydrophobic, spectral change, biological and chemical decomposition properties of materials with embedded nanoparticles are disclosed. A method of the nonlinear generation of surface plasmon resonance enables the use of light with wavelengths from X-Ray to IR to enhance ...

07/28/05 - 20050164168 - Method for the rapid diagnosis of infectious disease by detection and quantitation of microorganism induced cytokines
The inventive subject matter relates to a competitive method for the diagnosis of latent infectious disease, such as Mycobacterium tuberculosis, by estimating, the concentration of cytokine, such as interferon-gamma produced by stimulated immune cells, collected from whole blood, by Fluorescence Polarization (FP), Fluorescence Resonance Energy Transfer (FRET) or Fluorescence Lifetime ...

07/28/05 - 20050164167 - Method of discovery and development of broad-spectrum antiviral drugs
Method for identifying a broad-spectrum antiviral lead compound. Also methods for marketing and delivering a broad-spectrum antiviral compound and methods for treating patients with antiviral infections with a broad-spectrum antiviral drug are disclosed. ...

07/28/05 - 20050164166 - Identification of novel broadly cross-reactive hiv-1 neutralizing human monoclonal antibodies
The present invention provides an antibody to human immunodeficiency virus (HIV) envelope glycoprotein that can recognize one or more strains of HIV, wherein the epitope of HIV recognized by the antibody is inducible, and wherein the antibody binding to the epitope is enhanced by the presence of CD4 and the ...

07/28/05 - 20050164165 - Methods of detecting hcv genotype 1 (hcv-1) by using primers specific for the 5' non-coding region (ncr) of the hcv genome
The present invention provides a method of detecting HCV genotype 1 (HCV-1) in a sample which is based on the finding that the 5′ non-coding region (NCR) of the HCV genome is conserved between HCV-1 quasi-species but not between other HCV subgroups. The method comprises subjecting the sample to an ...

07/28/05 - 20050164164 - Hiv-1 virus tat-protein mutants
The invention relates to the use of a protein mutation method for preparing detoxified and immunogenic mutants of the wild-type HIV-1 virus Tat-protein. The invention also relates to a method for preparing detoxified and immunogenic mutants of the wild-type HIV-1 virus Tat-protein, comprising a first step in which wild-type Tat-protein ...

07/28/05 - 20050164163 - Assay for screening for an anti-viral agent
An antiviral agent capable of disrupting the association of two viral proteins required for DNA replication in herpesviruses. The agents disrupt the association of UL8 and POL in HSV-1 or the association of equivalent homologues of these proteins in other herpesviruses (for example UL 102 and UL54 in HCMV) Suitable ...

07/21/05 - 20050158713 - Fitness assay and associated methods
R1, R2, R3, R5, or R6 is H, or an optionally substituted and/or heteroatom-bearing alkyl, alkenyl, alkynyl, or cyclic group; Y and/or Z are CH2, O, S, SO, SO2, amino, amides, carbamates, ureas, or thiocarbonyl derivatives thereof, optionally substituted with an alkyl, alkenyl, or alkynyl group; n is from 1 ...

07/21/05 - 20050158712 - Methods for purifying viral particles for gene therapy
Novel methods of purifying and concentrating viral particles are disclosed for use in gene therapy, vaccines and viral standards preparation and other possible applications involving preparation and purification of viral particles. The viral particles are purified after the addition of a peptide tag to a protein on the surface of ...

07/21/05 - 20050158711 - Compositions and methods for protein isolation
The invention provides for polynucleotides and vectors comprising at least two tag sequences. In particular, preferred vectors are viral vectors. The invention also provides for polynucleotides and vectors comprising a streptavidin binding peptide sequence and a calmodulin binding peptide sequence. The invention also provides for polynucleotides and vectors wherein a ...

07/21/05 - 20050158710 - Detection of enterovirus nucleic acid
Amplification primers, hybridization probes and associated assay methods of the invention allow the detection and quantification of enterovirus nucleic acids. A broad range of enteroviruses serotypes may be detected. The amplification methods are highly specific and selective for enterovirus, compared to rhinovirus nucleic acids, for example. Further, the high sensitivity ...

07/21/05 - 20050158709 - Methods for determinging the influence of protein binding on antiretroviral activity
The present invention relates to methods for determining the influence of human plasma or serum protein binding on antiretroviral activity at physiologically achieved conditions, by using specific virus strains in a cell-based antiviral assay. ...

07/21/05 - 20050158708 - Methods and compositions related to tagging of membrane surface proteins
This invention relates to methods and reagents for selectively labeling membrane surface proteins using a labeling agent. The label may be used to isolate preparations of membrane surface proteins. Preparations of membrane surface proteins may be analysed by a variety of high-throughput techniques to allow rapid profiling of membrane surface ...

07/21/05 - 20050158707 - Full - length genomic rna of papaya leaf - distortion mosaic virus
The purpose of the present invention is to determine the nucleotide sequence of the full-length genomic RNA of papaya leaf-distortion mosaic virus. The present invention provides the full-length genomic RNA of papaya leaf-distortion mosaic virus, a method for diagnosing infection with papaya leaf-distortion mosaic virus using the full-length genomic RNA, ...

07/14/05 - 20050153282 - Compositions, methods and kits for detecting the nucleic acids of hiv-1 and hiv-2
Compositions, methods and kits for detecting the nucleic acids of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2. Particularly described are oligonucleotides that are useful as hybridization probes and amplification primers, including cross-reacting hybridization probes and cross-reacting amplification primers, for detecting very low levels of viral nucleic acids. ...

07/14/05 - 20050153281 - Replication competent hepatitis c virus and methods of use
The present invention provides a replication competent hepatitis C virus that includes a heterologous polynucleotide. The invention also includes methods for modifying a hepatitis C virus polynucleotide, selecting a replication competent hepatitis C virus polynucleotide, detecting a replication competent hepatitis C virus polynucleotide, and identifying a compound that inhibits replication ...

07/14/05 - 20050153280 - Viral propagation system and uses thereof
Trans-differentiation induced by dexamethasone with or without oncostatin M results in cells that are capable of propagating and replicating hepatitis virus. Such trans-differentiated cells are useful for screening drugs that may affect the propagation and replication of hepatitis virus such as hepatitis B virus or hepatitis C virus. ...

07/14/05 - 20050153279 - Viral variants with altered susceptibility to nucleoside analogs and uses thereof
The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance to nucleoside analogs and/or reduced interactivity with antibodies to viral surface components ...

07/14/05 - 20050153278 - Quantitative epstein barr virus pcr rapid assay
The present invention provides novel compositions comprising Epstein-Barr virus-specific oligonucleotides that are useful as primers to amplify particular regions of the genome during enzymatic nucleic acid amplification. The invention also provides a rapid, sensitive and specific method for the detection and quantitation of the virus which may be present in ...

07/14/05 - 20050153277 - Immunochemical assay device
An immunochemical assay device is proposed. The immunochemical assay device includes a base member, a liquid-flowing layer disposed on the base member and a light-permissible member attached on the liquid-flowing layer. A gap is interposed between the light-permissible member and the liquid-flowing layer, wherein at least an immobilized substance is ...

07/14/05 - 20050153276 - System and methods for discriminating an agent
A system and methods for discriminating an agent. In one embodiment of the present invention, the method includes the steps of (a) constructing a decision tree having a plurality of branches, each branch corresponding to at least one defined action, wherein each branch includes a plurality of successive branches, each ...

07/07/05 - 20050147966 - Differential pcr-rflp assay for detecting and distinguishing between nonpathogenic pcv-1 and pathogenic pcv-2
The present invention relates to a method for detecting and differentiating PCV infections in a biological sample taken from a pig which involves amplifying a fragment from an extracted nucleic acid; digesting the fragment with a suitable restriction enzyme such as the unique NcoI restriction enzyme; forming a restriction fragment ...

07/07/05 - 20050147965 - Compositions and methods for detecting reverse transcriptase in a sample
The present invention provides methods for detecting the presence and enzymatic activity of reverse transcriptase (RT) in a sample. The methods generally involve conducting a reverse transcriptase PCR assay in the presence of labeled deoxynucleotides. The deoxynucleotides are incorporated into a molecular structure or complex containing the RNA template and ...

07/07/05 - 20050147964 - Methods for identifying a peptide that binds a geometrical shape
Provided herein are methods, such as phage display assays, for bioengineering peptides that bind to geometrically and/or atomically structured molecular surfaces such as, for example, flat surfaces, smooth curved surfaces, as well as surfaces with periodic, random, or fractal atomic configurations. Surface-binding peptides are provided that are identified using the ...

07/07/05 - 20050147963 - Composite organic-inorganic nanoparticles and methods for use thereof
Composite organic-inorganic nanoparticles (COIN) are provided that produce surface-enhanced Raman signals when excited by a laser. The nanoparticles include metallic colloids and a Raman-active organic compound. The metal required for achieving a suitable SERS signal is inherent in the nanoparticle, and a wide variety of Raman-active organic compounds can be ...

07/07/05 - 20050147962 - Display of dimeric proteins on phage
Expression vectors for expressing multimeric polypeptides that are anchored on surfaces of genetically replicable packages are disclosed. The expression vectors include a vector segment encoding a polypeptide sequence having three polypeptide segments. One of the segments contains a cleavable peptide sequence cleavable by a proteolytic agent, and another segment has ...

07/07/05 - 20050147961 - Human papillomavirus multiplexed assay
The present invention relates to an immunoassay for simultaneously measuring the presence of antibodies to a plurlity of HPV types that utilizes particle-based flow cytometric analysis. The presence and/or titre of neutralizing antibodies in a test sample are determined in a competitive format, where known, type-specific, fluorescently labeled neutralizing monoclonal ...

06/30/05 - 20050142541 - Antibodies for oncogenic strains of hpv and methods of their use
The subject invention provides antibodies, including polyclonal and monoclonal antibodies, that bind to E6 proteins from at least three oncogenic strains of HPV. In general, the antibodies bind to amino acids motifs that are conserved between the E6 proteins of different HPV strains, particularly HPV strains 16 and 18. The ...

06/30/05 - 20050142540 - Methods and reagents for molecular detection of hiv-1 groups m, n and o
Reagents and assays for detecting HIV-1 groups M and O and optionally HIV-1 group N and SIVcpz are provided. The reagents are nucleic acid primers for the hybridization to, amplification and subsequent detection of HIV-1 groups M, N and O and SIVcpz in a biological sample. The primers are oligonucleotides ...

06/30/05 - 20050142539 - Targeted ligands
The invention contemplates a composition containing a multispecific ligand containing at least a first ligand binding moiety and a second ligand binding moiety. The first ligand binding moiety specifically binds with a pre-selected first affinity to at least a first ligand. The first ligand has a first biodistribution. The second ...

06/30/05 - 20050142538 - Viral receptor protein
The invention provides a human viral receptor protein (ACVRP) and polynucleotides which identify and encode ACVRP. The invention also provides expression vectors, host cells, agonists, antibodies and antagonists. The invention also provides methods for treating disorders associated with expression of ACVRP ...

06/30/05 - 20050142537 - System and method for rapid detection of metabolic deviations of a biological sample
A system for rapid detection of metabolic deviations of a biological sample including at least one control chamber having spaced electrodes for receiving a biological sample, at least one target chamber having spaced electrodes for receiving the biological sample and a biological reagent, and a measuring and detection device responsive ...

06/30/05 - 20050142536 - Method and kit for the detection of a novel coronoavirus associated with the severe acute respiratory syndrome (sars)
The instant invention relates to an efficient, sensitive and reliable quantitative real time RT-PCR method for detecting Severe Acute Respiratory Syndrome-associated virus (SARS-associated virus), to oligonucleotides and kits for detecting SARS-associated virus. ...

06/30/05 - 20050142535 - Ogligonucleotides comprising alternating segments and uses thereof
The invention relates to oligonucleosides having alternating segments of sugar-modified nucleosides and 2′-deoxynucleosides, and uses thereof. The invention further relates to oligonucleotides having alternating segments of sugar-modified nucleotides and 2′-deoxynucleotides, and uses thereof. Such uses include the preparation of antisense oligonucleotides and their use for the prevention or depletion of ...

06/23/05 - 20050136401 - Method and device for detecting feline immunodeficiency virus
A method and device for determining a feline immunodeficiency virus infection or vaccination in an animal. The method includes contacting a biological sample from a felid with various FIV polypeptides and determining the binding of antibodies in the sample to the polypeptides. The determination of whether an animal is infected ...

06/23/05 - 20050136400 - Ns3-ns4a protease resistance mutants
The present invention is directed to mutants of HCV NS3/4A protease. More particularly, the present invention identifies mutant of HCV NS3/4A protease that are resistant to drug treatment. ...

06/23/05 - 20050136399 - Compositions, methods and kits for detection of an antigen on a cell and in a biological mixture
The present invention relates to novel methods for detecting at least one member of a known binding pair in a sample, including a cell, where one member of the pair (termed the “receptor”) is expressed by a bacteriophage, which phage is then used to detect the presence of the other ...

06/23/05 - 20050136398 - Methods and compositions for identifying therapeutic compounds
By the present invention, enzymes responsible for prodrug activation are identified and utilized for the identification of candidate compounds as prodrugs. The present invention includes methods for identifying a candidate compound as a suitable prodrug as well as methods of screening candidate compounds for suitability as therapeutic agents. ...

06/23/05 - 20050136397 - Methods and compositions for identifying therapeutic compounds
By the present invention, enzymes responsible for prodrug activation are identified and utilized for the identification of candidate compounds as prodrugs. The present invention includes methods for identifying a candidate compound as a suitable prodrug as well as methods of screening candidate compounds for suitability as therapeutic agents. ...

06/23/05 - 20050136396 - Methods and compositions for identifying therapeutic compounds
By the present invention, enzymes responsible for prodrug activation are identified and utilized for the identification of candidate compounds as prodrugs. The present invention includes methods for identifying a candidate compound as a suitable prodrug as well as methods of screening candidate compounds for suitability as therapeutic agents. ...

06/23/05 - 20050136395 - Methods for genetic analysis of sars virus
The invention provides arrays and probes for resequencing a SARS virus using an array of probes that are complementary to a SARS reference sequence and to each possible single nucleotide substitution of the reference sequence. Methods of identifying mutations in viral sequences and methods of characterizing viral isolates are also ...

06/16/05 - 20050130135 - Hepatitis a virus nucleotide sequences, recombinant proteins and uses thereof
Hepatitis A virus primers and probes derived from the capsid proteins and junction between the capsid precursor P1 and 2A of the HAV genome are disclosed. Also disclosed are nucleic acid-based assays using the primers and probes, antigen detection of HAV, and immunoassay for detecting the antibodies that bind to ...

06/16/05 - 20050130134 - Means and methods for monitoring non-nucleoside reverse transcriptase inhibitor antiretroviral therapy and guiding therapeutic decisions in the treatment hiv-aids
This invention relates to antiviral drug susceptibility and resistance tests to be used in identifying effective drug regimens for the treatment of human immunodeficiency virus (HIV) infection and acquired immunodeficiency syndrome (AIDS) and further relates to the means and methods of monitoring the clinical progression of HIV infection and its ...

06/16/05 - 20050130133 - Oligonucleotides and methods for detection of west nile virus
The invention provides methods of detecting West Nile virus and oligonucleotide reagents derived from a West Nile virus consensus sequence that are useful in the methods of the invention. ...

06/16/05 - 20050130132 - Compositions and methods for the diagnosis and treatment of herpes simplex virus infection
Compounds and methods for the diagnosis and treatment of HSV infection are provided. The compounds comprise polypeptides that contain at least one antigenic portion of an HSV polypeptide and DNA sequences encoding such polypeptides. Pharmaceutical compositions and vaccines comprising such polypeptides or DNA sequences are also provided, together with antibodies ...

06/16/05 - 20050130131 - Method for isolation and replication of infectious human hepatitis-c virus
The present invention provides methods and compositions for replicating infectious Hepatitis C virus in vitro. ...

06/16/05 - 20050130130 - Polypeptides associated with activatory receptors and their biological applications
The invention concerns novel means for diagnosing, preventing, compensating, treating an abnormal or unwanted functioning of KAR receptors (Killer cell Activatory Receptor, counterparts of non-inhibiting KIR receptors (Keller cell Inhibitory Receptors) of the immunoglobulin or lectin type. The invention concerns in particular, novel KARAP (KAR-Associated Proteins) polypeptides and their biological ...

06/16/05 - 20050130129 - Targeting gene transfer vectors to certain cell types by pseudotyping with viral glycoprotein
The present invention provides compositions and methods for targeting gene transfer vectors to certain cell types by pseudotyping with a transmembrane form of viral glycoprotein, such as that from Ebola virus. The methods comprise the step of administering to a cell population a gene to be transferred operatively linked to ...

06/16/05 - 20050130128 - Methods and compositions for the treatment of human immunodeficiency virus infection
Materials and methods are provided to inhibit HIV replication in targeted host cells. ...

06/16/05 - 20050130127 - Coronavirus-like particles comprising functionally deleted genomes
The invention relates to the field of coronaviruses and diagnosis, therapeutic use, and vaccines derived therefrom. The invention provides replicative coronaviruses and virus-like particles (VLPs) from which large parts of their genome are (at least functionally) deleted without abolishing their replicative capacities. The deletion preferably results in at least a ...

06/16/05 - 20050130126 - Abiz phage resistance gene
A first aspect of the present invention is an isolated nucleic acid encoding a phage abortive defense protein, the isolated nucleic acid selected from the group consisting of: (a) isolated nucleic acid having the sequence or coding sequence given in SEQ ID NO: 1 (by “coding sequence” is meant nucleotides ...

06/16/05 - 20050130125 - End of aids for general virology, based on profound science as protein foldings: safe vaccines, universal antimicrobial means, mad cow end
All AIDS principal mysteries are resolved. “One step” AIDS is successive contaminations.(with low [anti-env]). Strong sole lethal animal doses are confirming. Mobility macrophage (mφ) receptors contaminate at 1st stage with nonproductive entry with nonintegrated and heterogenous (due to nef) HIV DNA and proteins and preudoinfectious A particles. Such heterogeneity is ...

06/16/05 - 20050130124 - Phagemid display system
The present invention provides a novel helper phage and phagemid and phagemid display system that comprises an amber mutation in gene 3 of the helper phage so that it is not expressed in the non-permissive bacteria and an in-frame stop codon in the phagemid prior to the gene 3 coding ...

06/16/05 - 20050130123 - Methods of examining (-) strand rna virus vectors having lowered ability to form grains and method of constructing the same
The present invention provides methods for testing and producing (−) strand RNA virus vectors with reduced or eliminated particle formation ability or cytotoxicity. It was revealed that a deficiency in M protein localization in cells introduced with such a (−) strand RNA virus vector could result in the suppression of ...

06/09/05 - 20050123908 - Typing of human enteroviruses
The present invention discloses a method for detecting the presence of an enterovirus in a clinical sample. The invention additionally discloses a method for typing an enterovirus in a clinical sample. Both methods employ a set of primer oligonucleotides for reverse transcription and amplification that hybridize to conserved regions of ...

06/09/05 - 20050123907 - Methods for making a device for concurrently processing multiple biological chip assays
Methods for concurrently processing multiple biological chip assays by providing a biological chip plate comprising a plurality of test wells, each test well having a biological chip having a molecular probe array; introducing samples into the test wells; subjecting the biological chip plate to manipulation by a fluid handling device ...

06/09/05 - 20050123906 - Protein modulation
The present invention provides methods for screening and identifying compounds that inhibit a pathway affecting protein levels, and methods and compounds for treating viral, e.g., HIV, infection. ...

06/09/05 - 20050123905 - Methods and compositions for cloning amplified nucleic acid molecules
The present invention is directed generally to methods facilitating the cloning of nucleic acid molecules. In particular, the invention relates to the use of polymerase inhibitors, including but not limited to anti-polymerase antibodies (such as anti-Taq antibodies) and fragments thereof, to inactivate residual polymerase activity remaining after the amplification (particularly ...

06/09/05 - 20050123904 - Methods and compositions for modulating herpesviral replication and transcription activator
This invention provides novel polypeptides that modulate activities of the replication and transcription activator (RTA) of Kaposi's sarcoma-associated herpesvirus (KSHV). The invention also provides methods for screening modulators of RTA activities. The methods comprise first screening test agents for modulators of an RTA-modulatory polypeptide and then further screening the identified ...

06/09/05 - 20050123903 - Methods and compositions for modulating marginally indiscriminant hybridizations
The invention relates to the field of molecular biology, nucleic acid chemistry and medical diagnostics. More specifically, it relates to methods and compositions for promoting the hybridization of a nucleic acid probe with a target nucleic acid sequence which is not perfectly matched to the probe. ...

06/09/05 - 20050123902 - Human papillomavirus inhibitors
The present invention provides systems for identifying anti-viral agents. In particular, the invention encompasses reagents and strategies for identifying agents that inhibit or disrupt key protein-protein interactions that are important in the life cycle of papillomaviruses. The invention allows identification, production, and/or use of agents that reduce or inhibit the ...

06/09/05 - 20050123901 - Method and device for the rapid clinical diagnosis of hepatitis c virus (hcv) infection in biological samples
There is provided a method and kit for rapid clinical diagnosis of HCV in which the amplimers are transcripts of a polyprotein gene of HCV. The amplicons are hybridized to a specific oligonucleotide probe, which allows the amplicons to be detected. ...

06/09/05 - 20050123900 - Identification of novel broadly cross-reactive neutralizing human monoclonal antibodies using sequential antigen panning of phage display libraries
The present invention provides a method of identifying novel broadly crossreactive neutralizing monoclonal antibodies using sequential antigen panning of phage display libraries, antibodies obtained in accordance with such a method, as well as fusion proteins and conjugates comprising same, and related isolated or purified nucleic acid molecules, vectors, host cells, ...

06/09/05 - 20050123899 - Anti-hiv agent
Disclosed are anti-HIV agents which comprise a mannose binding protein (MBP) as an active component and are useful for effectively inhibiting progress of diseases state in and useful in therapy for individuals infected with human immunodeficiency virus (HIV). Also disclosed are a method for evaluating an anti-HIV activity of MBP ...

06/09/05 - 20050123898 - System for producing clonal or complex populations of recombinant adenoviruses, and the application of the same
The invention relates to a novel system for producing recombinant adenoviruses (rAd). The areas of application of said system are medicine, veterinary medicine, biotechnology, genetic engineering, and functional genomic analysis. The inventive system for producing rAds preferably consists of a donor virus, the packaging signal of which is (i) partially ...

06/02/05 - 20050118573 - Nucleic sequence and deduced protein sequence family with human endogenous retroviral motifs, and their uses
The invention concerns a novel nucleic sequence and deduced protein sequence family with whole or partial human endogenous retroviral motifs. The invention also concerns the detection and/or the use of said nucleic sequences and said corresponding protein sequences or fragments of said sequences, for diagnostic, prophylactic and therapeutic uses, in ...

06/02/05 - 20050118572 - Single cell assessment of viral infection/replication
This invention relates to methods of separating virally infected viable cells from dead cells using antibodies specific for intracellular proteins and a covalent nucleic acid binding agent. The method can be readily adapted for assessing viral infection and/or replication in viable cells, identifying anti-viral agent, and monitoring anti-viral therapy ...

06/02/05 - 20050118571 - Production of replicative hepatitis c virus
A nucleic acid having a first nucleotide sequence encoding an infectious hepatitis C virus, a second nucleotide sequence encoding a ribozyme, and an inducible promoter operably linked to the first and second nucleotide sequences, the ribozyme being configured to remove a 3′ sequence unnecessary for replication of the infectious hepatitis ...

06/02/05 - 20050118570 - Sample preparation methods and devices
The present invention provides improved methods, compositions, and devices for separating and/or detecting targets from biological, environmental, or chemical samples. ...

06/02/05 - 20050118569 - Genetic engineering of streptavidin-binding peptide tagged single-chain variable fragment antibody to venezuelan equine encephalitis virus
A recombinant gene encoding a single-chain variable fragment (scFv) antibody against Venezuelan equine encephalitis virus (VEE) being cloned into a prokaryotic T7 RNA polymerase-regulated expression vector was disclosed. A streptavidin-binding peptide (SBP) sequence fused to a 6His tag is then attached downstream to the scFv gene. The recombinant fusion protein ...

06/02/05 - 20050118568 - Method for detecting human papillomavirus mrna
An in vitro method is provided for screening human female subjects to assess their risk of developing cervical carcinoma which comprises screening the subject for expression of mRNA transcripts from the E6 and optionally the L1 gene of human papillomavirus, wherein subjects positive for expression of L1 and/or E6 mRNA ...

06/02/05 - 20050118567 - Method for determining sensitivity to a bacteriophage
This disclosure provides methods of selecting a therapeutic bacteriophage and identifying bacteria in a sample. The sample may be obtained from a plant or animal subject diagnosed with a disease caused by a bacterial infection or an object suspected of being exposed to a bacterium. The activity of reporter molecules, ...

06/02/05 - 20050118566 - Replicons derived from positive strand rna virus genomes useful for the production of heterologous proteins
The present invention relates to replicons or self-replicating RNA molecules, derived from the genome of cardioviruses and aphtoviruses, which can be used to express heterologous proteins in animal cells. When injected in an animal host, for example in the form of naked RNA, these replicons permit the translation of the ...



###

FreshPatents.com Support