|
FREE patent keyword monitoring and additional FREE benefits. |
|
|
Chemistry: Molecular Biology And Microbiology > Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip > Involving Virus Or Bacteriophage Involving Virus Or BacteriophageInvolving Virus Or Bacteriophage patent applications listed are from June 2005 to current and include Date, Patent Application Number, Patent Title, Patent Abstract summary and are linked to the corresponding patent application page.06/07/07 - 20070128589 - Substrates, sensors, and methods for assessing conditions in females Described herein are substrates, methods, articles, and kits that are useful for detecting a condition in a female mammal. The substrates interact with one or more proteins (e.g., an enzyme) produced by a microorganism or the female animal. The substrates are labelled in order to produce a visible signal (e.g., ... 06/07/07 - 20070128588 - Detection and typing of human papillomavirus using pna probes The invention provides methods for detection and typing of HPV infection using PNA probes. More specifically, methods are provided for detecting high-risk types of HPV infection with minimal numbers of PNA probes or using PNA probes to selectively amplify only high-risk types of HPV ... 06/07/07 - 20070128587 - Method of diagnosis of foot and mouth disease and the diagnostic kit The present invention provides a method for diagnosing foot-and-mouth disease virus infection, comprising the steps of applying a predetermined amount of a test sample to a loading region of a strip; coupling a detection reagent including a given labeling reagent to an analyte of interest in the test sample to ... 06/07/07 - 20070128586 - Therapeutic, prophylactic and diagnostic agents The present invention provides compounds useful in the treatment and prophylaxis of infection in mammals and avian species by pathogenic agents such as, but not limited to, viruses. The present invention further provides compounds useful in the treatment of other disease conditions such as cirrhosis and hepatocellular carcinoma. The present ... 05/31/07 - 20070122801 - Binding molecules capable of neutralizing west nile virus and uses thereof The invention provides human binding molecules specifically binding to West Nile virus and having West Nile virus neutralizing activity, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used ... 05/31/07 - 20070122800 - Methods for quantifying polymer attachment to a particle The present invention relates to improved methods for quantifying the degree of polymer attachment of particles with multiple polymer attachment sites. The disclosed methods are useful for gene therapy, particularly gene therapy using pegylated adenoviral vectors. ... 05/31/07 - 20070122799 - Method of isolation and self-assembly of small protein particles from blood and other biological materials Compositions and methods for the isolation and manipulation of misfolded, or partially misfolded, proteins present in blood and other biological materials are provided. In one aspect of the invention, the compositions, hereinafter termed “proteons” are misfolded or partially misfolded proteins surrounding a metallic nanocluster, termed “proteon nucleation center” (PNC). Also ... 05/31/07 - 20070122798 - Methods and tools for screening active rna in cellulo The invention relates to methods and compositions for screening active RNA in cellulo. The invention more particularly relates to methods of the preparation and selection of random RNA providing a cell with a desired phenotype, to random RNA banks and the production thereof, as well as to cellular populations which ... 05/24/07 - 20070117089 - Sol-gel coated glass microspheres for use in bioassay A microsphere for use in a bioassay comprising a glass core coated with a sol-gel comprising a bioactive probe is provided. The sol-gel coating enhances the density of bioprobe loading on the surface of the microspheres, resulting in enhanced dynamic range and sensitivity in bioassays. The particle may be used ... 05/24/07 - 20070117088 - Methods and kits for detection of prion diseases The invention relates to diagnostic methods and kits for detecting transmissible spongiform encephalopathies (TSEs) such as BSE, scrapie, chronic wasting disease and related diseases in animals and humans. The invention provides a method for determining whether an aberrant prion protein is present or absent in a mammalian sample comprising the ... 05/17/07 - 20070111202 - Electrochemical detection of nucleic acid sequences An electrochemical detection system which specifically detects selected nucleic acid segments is described. The system utilizes biological probes such as nucleic acid or peptide nucleic acid probes which are complementary to and specifically hybridize with selected nucleic acid segments in order to generate a measurable current when an amperometric potential ... 05/17/07 - 20070111201 - Reverse transfection of cell arrays for structural and functional analyses of proteins The present invention relates to articles and methods for determining the function of genes, gene products, and nucleic acid products. The present invention also relates to identifying ligands and binding partners or proteins and nucleic acid products. The present invention also relates to methods and compositions related to reverse-transfection. ... 05/17/07 - 20070111200 - Detection of hpv The present invention provides compositions and methods for the detection and characterization of HPV sequences. More particularly, the present invention provides compositions, methods and kits for using invasive cleavage structure assays (e.g. the INVADER assay) to screen nucleic acid samples, e.g., from patients, for the presence of any one of ... 05/10/07 - 20070105094 - Water-soluble cationic magnetic fine particles and method for separating or detecting lipid vesicle using the same A phospholipid vesicle such as a virus is to be rapidly separated (concentrated, roughly purified) and good detection (diagnosis) results can be obtained with suppressing inhibition of virus-denature, PCR inhibition, latex-aggregation inhibition, and the like. Moreover, the above operations are to be automated. A phospholipid vesicle is separated using a ... 05/10/07 - 20070105093 - Uncoupling of dna insert propagation and expression of protein for phage display The present invention provides an advance in phage display technology by permitting the uncoupling of the propagation of phages containing inserted sequences encoding heterologous polypeptides from the expression of said polypeptides. The invention provides phage constructs and methods for their use to permit phage coat protein expression, and thus phage ... 05/10/07 - 20070105092 - Proteolytic and covalent antibodies Improved methods for the production, selection and inhibition of catalytic and covalent antibodies are disclosed. ... 05/10/07 - 20070105091 - Real time assay for rotavirus A highly sensitive quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) assay with wide linear dynamic range is useful as a high-throughput screening assay for detecting Rotavirus in clinical samples. The primers and probe specifically detect Rotavirus of all serotypes. The assay is particularly useful as a screening assay for determining ... 05/10/07 - 20070105090 - Amplification method The present invention combines the use of template switching with nucleic acid amplification—such as PCR—to generate amplification products representative of an entire RNA population. An RNA polymerase promoter sequence allows transcription-based amplification to be performed on the derived amplification products such that antisense amplified RNA (aRNA) or complementary RNA (cRNA) ... 05/03/07 - 20070099183 - Comparative ligand mapping from mhc positive cells The present invention relates generally to a methodology for the isolation, purification and identification of peptide ligands presented by MHC positive cells. In particular, the methodology of the present invention relates to the isolation, purification and identification of these peptide ligands from soluble class I and class II MHC molecules ... 05/03/07 - 20070099182 - Comparative ligand mapping from mhc class i positive cells The present invention relates generally to a methodology for the isolation, purification and identification of peptide ligands presented by MHC positive cells. In particular, the methodology of the present invention relates to the isolation, purification and identification of these peptide ligands from soluble class I and class 11 MHC molecules ... 05/03/07 - 20070099181 - Postweaning multisystemic wasting syndrome virus from pigs The cloning of a novel PCVII viral genome is described as is expression of proteins derived from the PCVII genome. These proteins can be used in vaccine compositions for the prevention and treatment of PCVII infections, as well as in diagnostic methods for determining the presence of PCVII infections in ... 05/03/07 - 20070099180 - Evanescent wave sensor with attached ligand The invention in particular embodiments provides an evanescent wave sensor which includes a ligand bound to a sensor substrate via a β-hydroxy-linker moiety, as defined herein. Methods of making the subject evanescent wave sensors are also provided which include contacting a first reactive moiety which has an epoxy-ring moiety with ... 05/03/07 - 20070099179 - Method for inducing hepatitis c virus (hcv) replication in vitro, cells and cell lines enabling robust hcv replication and kit therefor The present invention relates to hepatitis C virus (HCV). More particularly, the invention relates to the development of a tool suitable for the search, discovery and validation of novel HCV antiviral drugs and therapies (e.g. vaccine). The invention further relates to methods for inducing HCV replication in vitro, and more ... 05/03/07 - 20070099178 - Method for detecting sars coronavirus This invention provides: a method for detecting SARS pathogenic viruses with high sensitivity and rapidity for diagnosing severe acute respiratory syndrome (SARS); an oligonucleotide primer that can specifically hybridize with any nucleotide sequence constructed based on the nucleotide sequence of RNA polymerase of the SARS coronavirus; a method for nucleic ... 05/03/07 - 20070099177 - Agents and methods for detecting human adenoviruses The invention relates to labeled or unlabelled nucleic acids to specifically bind to DNA of human adenoviruses (HAdV DNA), whereby the nucleic acid a) possesses the sequence SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, b) possesses a sequence with a homology of greater than ... 04/26/07 - 20070092871 - Microarray for pathogen identification There is disclosed a microarray device for pathogen identification and for subtyping influenza A. Pools of primers are disclosed and used to amplify any subtype of influenza A. Pathogen identification includes influenza A, influenza B, parainfluenza virus, adenovirus, enterovirus, rhinovirus, human metapneumovirus, respiratory syncytal virus, herpes simplex viruses, SARS coronavirus, ... 04/26/07 - 20070092870 - Detection of biomolecules Compositions, systems and methods for the detection of analytes with labeled nanostructures are provided. In particular, compositions and systems including labeled nanostructures for detecting a biomolecule of interest, and methods of use thereof, are provided. ... 04/26/07 - 20070092869 - Spike-in controls and methods for using the same Methods, compositions, and kits for performing a one-color analysis of microarray data are provided. Also disclosed are compositions including control nucleic acid sequences, and methods for measuring the dynamic range of a microarray analysis. ... 04/26/07 - 20070092868 - Liquid crystal cassette A functional cassette for the detection of ligands comprises a first inner housing, a second middle housing and a third outer housing and each housing is at least partially rotatable relative to an adjoining housing. The first inner housing contains a central well adapted for receiving a sample, and the ... 04/26/07 - 20070092867 - Application using non-covalent bond between a cucurbituril derivative and a ligand Provided are a kit including a first component that is a compound of formula (1) below bound to a first material and a second component that is a ligand bound to a second material, wherein each of the first and second materials is independently selected from the group consisting of ... 04/26/07 - 20070092866 - Avian adenoassociated virus and uses thereof The present invention provides an Avian adeno-associated virus (AAAV) virus and vectors and particles derived therefrom. In addition, the present invention provides methods of delivering a nucleic acid to a cell using the AAAV vectors and particles. Methods of isolating the AAAV are provided. ... 04/19/07 - 20070087341 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087340 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087339 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087338 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087337 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087336 - Compositions for use in identification of influenza viruses The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis. ... 04/19/07 - 20070087335 - Human microrna targets in hiv genome and a method of identification thereof The present invention relates to human microRNA targets in HIV genome and a method of identification thereof. Using multiple software targets to six human microRNAs [miRNAs] were discovered in the net, vpr, env, and I vif genes. The miRNAs were identified as hsa-miR-29a, hsa-miR-29b, hsa-miR-29c, hsa-mir-149, hsa-mir-324-5p, hsa-mir-378. These miRNAs ... 04/19/07 - 20070087334 - Pkr activation via hybridization chain reaction The present application relates to the use of hybridization chain reaction (HCR) to form double stranded RNA polymers in the presence of a target, such as a nucleic acid associated with a disease or disorder. The RNA polymers are preferably able to activate the RNA-dependent kinase PKR. Activation of PKR ... 04/19/07 - 20070087333 - Method to detect antigen-specific cytolytic activity The invention relates to a novel non-radioactive method to detect cytolytic activity that provides a measure of the existence and magnitude of an immune response against a particular antigen or immunogen. Provided is a method for detecting cytolytic activity of cells or a substance against a population of target cells, ... 04/19/07 - 20070087332 - Pulmonary stem cells, related methods and kits of parts Isolated pulmonary stem cells, the isolated pulmonary stem cells being slowly dividing Oct-4 expressing cells forming individual colonies and able to undergoing terminal differentiation into a mature phenotype in vitro; a method to identify stem cells of a tissue; a kit for the identification of stem cell of a tissue; ... 04/19/07 - 20070087331 - Selection of b cells with specificity if interest: method of preparation and use The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides methods using a composition comprising an ordered and repetitive antigen or antigenic determinant array for visualization and selection of B cells specific for the antigen. These B cells are useful for the ... 04/19/07 - 20070087330 - Viral deconstruction through capsid assembly in vitro A cell-free method for translation and assembly of viral capsid and capsid intermediates is disclosed for use in deconstructing an unknown virus and for screening for compounds that inhibit assembly of viral capsids for the unknown virus. ... 04/12/07 - 20070082331 - Chemical processing cartridge and method of using same A cartridge capable of making effective use of a sample is provided. A blood sample is injected into a well via an injection path by use of a syringe, and so forth. A roller, in a state as kept pressed into contact with the cartridge, is rotated rightward, whereupon an ... 04/12/07 - 20070082330 - Compounds displayed on icosahedral phage and methods of using same Icosahedral phage and collections thereof that display various compounds are provided. In some instances, the icosahedral phage include nucleic acid tags that serve to record a characteristic of the compound or compounds that are attached to the phage. A number of different methods for using the icosahedral phage to screen ... 04/05/07 - 20070077555 - Adsorption system for the removal of viruses and viral components from fluids, in particular blood and blood plasma The present invention relates to an adsorption system for the removal of viruses and viral components, in particular hepatitis C viruses, from physiological fluids, in particular whole blood or blood plasma, by means of extracorporeal adsorption processes, as well as to an adsorber material for use in the adsorption system ... 04/05/07 - 20070077554 - Homologous viral internal controls for use in rt-pcr assays of enteric viruses Homologous viral internal controls have been developed for use in RT-PCR assays of a number for viruses. Two of these internal controls, such as for HAV and Norwalk virus, are cloned on a single plasmid, thereby making them useful for the multiplex detection of these viruses in a single reaction. ... 04/05/07 - 20070077553 - Bioinformatically detectable group of novel vaccinia regulatory genes and uses thereof The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “Viral genomic record” or “VGR genes”. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive ... 03/29/07 - 20070072177 - Binding molecules capable of neutralizing rabies virus and uses thereof The invention provides binding molecules that specifically bind to rabies virus and are capable of neutralizing the virus. The invention further provides nucleic acid molecules encoding the binding molecules, compositions comprising the binding molecules and methods of identifying or producing the binding molecules. The binding molecules can be used in ... 03/29/07 - 20070072176 - Novel peptide compositions and their use in particular in the preparation of pharmaceutical compositions active against the hepatitis c virus The invention relates to peptide compositions for use in the preparation of pharmaceutical compositions against hepatitis C virus, as well as corresponding methods. ... 03/29/07 - 20070072175 - Nucleotide array containing polynucleotide probes complementary to, or fragments of, cynomolgus monkey genes and the use thereof This invention relates to a nucleotide array containing polynucleotide probes complementary to, or fragments of, Cynomolgus monkey genes, and the use of such a nucleotide array to characterize the biological effects, including the actions, targets, and toxicities, of therapeutic agents in primates, e.g., a human, a Cynomolgus monkey, or a ... 03/29/07 - 20070072174 - Bioreporter for detection of microbes A recombinant phage system has been developed for the rapid detection of bacteria, particularly fecal coliform indicator bacteria. The systems of the invention link phage infection events to quorum sensing signal molecule biosynthesis and bioluminescent bioreporter induction, facilitating the detection of pathogens that may be present in low numbers. The ... 03/29/07 - 20070072173 - Utilization of nucleotide probes in elisa procedure for the quantitative determination of baculovirus titer To maximize the yield of protein from a baculovirus system, optimal infection of the host cell culture must be achieved; in order to obtain such optimal infection, the titer of the virus inoculation must be known. The present invention is the development of a simple, rapid, and universally applicable titration ... 03/22/07 - 20070065815 - Methods for genotyping hepatitis c virus The present invention relates to methods and compositions for analyzing nucleic acids. In particular, the present invention provides methods and compositions for the detection and characterization of nucleic acid sequences and sequence changes. The methods of the present invention permit the detection and/or identification of genetic polymorphism such as those ... 03/22/07 - 20070065814 - Detecting foot-and-mouth disease virus This document relates to methods and materials involved in determining whether or not an animal contains a foot-and-mouth disease virus. For example, nucleic acid primer pairs, combinations of nucleic acid primer pairs, nucleic acid arrays (e.g., diagnostic cards) containing nucleic acid primer pairs or combinations of nucleic acid primer pairs, ... 03/22/07 - 20070065813 - Assay for quantitative detection of respiratory syncytial virus (rsv) The present invention describes respiratory syncytial virus (RSV) primers and probes as reagents for detection of a RSV infection. Specifically, the invention provides nucleic acid sequences from the RSV nucleocapsid gene used with hybridization and PCR techniques to detect RSV infection. ... 03/22/07 - 20070065812 - Multiplexed rt-pcr assay for detection and separation of barley and cereal yellow dwarf viruses RT-PCR primer multiplexes and a method for detecting the presence of Subgroup I and II barley or cereal yellow dwarf viruses in a sample. A first multiplex includes a first primer pair that selectively amplifies Subgroup I viruses, and a second primer pair that selectively amplifies Subgroup II viruses. A ... 03/22/07 - 20070065811 - Method of detecting multiple analytes The invention relates to a a microtiter plate and its use in a method of the invention, which microtiter plate comprises a plurality of containers, wherein the bottom of each container comprises a (semi-)permeable membrane capable of directly or indirectly binding an analyte, and wherein each container is separated from ... 03/22/07 - 20070065810 - Diagnosis and treatment of cervical cancer In certain aspects, the invention relates to methods of diagnosing cervical cancer by using a combination of certain biomarkers such as hTERT, IGFBP-3, transferrin receptor, beta-catenin, Myc-HPV E6 interaction, HPV E7, and telomere length. In other aspects, the invention relates to methods of detecting immortalization of cervical cells by using ... 03/22/07 - 20070065809 - Compositions and methods screening using populations of surrogate antibodies Methods and compositions for the detection, identification, and quantification of compounds of interest in a sample are provided. The compositions and methods include arrays and kits comprising a population of surrogate antibodies that bind compounds of interest. The surrogate antibodies can be immobilized on to a solid support by means ... 03/15/07 - 20070059686 - Materials and methods for the detection of severe acute respiratory syndrome virus (sars) Disclosed are methods and kits for identifying a virus in a sample, which may include a coronavirus capable of causing Severe Acute Respiratory Syndrome (“SARS”) or SARS-like symptoms. The virus may be a SARS-Associated Coronavirus (“SARS-CoV”). Typically, the methods may include reacting a mixture that includes, in addition to nucleic ... 03/15/07 - 20070059685 - Method for producing improved results for applications which directly or indirectly utilize gene expression assay results A method for producing improved results for applications of any kind which directly or indirectly utilizes gene expression assay results. ... 03/15/07 - 20070059684 - Method of identifying an antiviral agent A method of identifying an antiviral agent effective against viruses, which utilize −1 programmed ribosomal frameshifting is provided. The method includes providing cells harboring a −1 frame plasmid including a translation start site followed by a −1 ribosomal frameshifting signal followed by a reporter gene which is in a −1 ... 03/15/07 - 20070059683 - Veterinary diagnostic system The invention relates to a method for diagnosing an animal for a condition by obtaining a fluid sample from the animal, enriching a first analyte having a concentration of less than 1×10−3 analytes/μL from said sample by a factor of at least 10,000 fold; and analyzing one or more enriched ... 03/15/07 - 20070059682 - Method to increase specificity and/or accuracy of lateral flow immunoassays The present invention relates to a method for detecting an analyte in a sample, wherein the sample to be analyzed is applied to a chromatographic carrier. After separating from an interfering substance which may be present in the sample, the analyte of interest is detected on the carrier by means ... 03/15/07 - 20070059681 - Method for production of bioresorable microparticles, microparticles thus obtained and use thereof The present invention relates to a method for preparing nonlamellar bioresorbable microparticles to which protein substances are bonded, characterized in that it comprises the steps of: (i) preparing said microparticles from at least one bioresorbable polymer without stabilizer and without surfactant, and (ii) bonding said protein substances to the microparticles ... 03/08/07 - 20070054264 - Methods and means relating to hepatitis b infection The present inventors have discovered that the presence of antibodies reactive with residues 94-117 of the PreS1 component of the hepatitis B surface antigen (HBsAg) in an individual with HBV infection correlates closely with the effectiveness of interferon (IFN) in treating the individual. Methods and means based on this finding ... 03/08/07 - 20070054263 - Method and kit for molecular identification of smallpox We have developed two new PCR based assays to detect Orthopoxvirus DNA which when tested under simulated clinical conditions, have proven to be very sensitive, rapid and robust. Importantly, we were able to construct artificial templates for use as positive controls in the RFLP analysis necessary to differentiate variola and ... 03/08/07 - 20070054262 - Methods of identifying optimal variants of peptide epitopes The present invention is directed to methods for selecting a variant of a peptide epitope which induces a CTL response against another variant(s) of the peptide epitope, by determining whether the variant comprises only conserved residues, as defined herein, at non-anchor positions in comparison to the other variant(s). The present ... 03/01/07 - 20070048736 - Hepatitis An isolated nucleic acid containing a mutant hepatitis B virus genome and related methods. ... 03/01/07 - 20070048735 - Methods for rapid detection and identification of biogents in epidemiological and forensic investigations The present invention provides methods for rapid forensic investigations by identification of bioagents associated with biowarfare and acts of terrorism or crime. The methods are also useful for epidemiological investigations by genotyping of bioagents. ... 02/22/07 - 20070042359 - Binding molecules capable of neutralizing west nile virus and uses thereof The invention provides human binding molecules specifically binding to West Nile virus and having West Nile virus neutralizing activity, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used ... 02/22/07 - 20070042358 - Method for improving cell permeability to foreign particles The present invention provides a method for allowing foreign particles to penetrate, very efficiently, the cell wall, cell membrane, organelle membrane and/or nuclear membrane of a cell and hybridizing or binding to the complimentary target in the cell. The cells may be from a culture or from specimens obtained from ... 02/22/07 - 20070042357 - Detection and identification of bacterial strains The present invention relates to a method to detect bacteria, the method comprising the following steps: coupling of the bacteriophages and/or bacteriophage proteins to a support, incubating the support coupled with the bacteriophages and/or bacteriophage proteins with a sample, optionally removing the sample and the bacteria in the sample not ... 02/22/07 - 20070042356 - Variants of hepatitis b virus resistant against some nucleoside analogues, but sensitive to others, and uses thereof The present invention relates generally to the field of Hepatitis B variants exhibiting a reduced sensitivity to nucleoside analogues both in vivo and in vitro. More in particular, reverse transcriptase mutant rt I233V is provided. Present invention provides assays and methods for detecting such variant, which assays are useful in ... 02/22/07 - 20070042355 - Integrated method for collection and maintenance of detectability of a plurality of microbiological agents in a single clinical sample and for handling a plurality of samples for reporting a sum of diagnostic results for each sample A method and kit related thereto are described for the collection and maintenance of detectability of a plurality of species of microbiological agents in a single clinical sample as well as an integral method for handling a plurality of the samples and managing information associated therewith for reporting a sum ... 02/22/07 - 20070042354 - Detecting pathogens in companion animals This document relates to methods and materials involved in determining whether or not an animal contains a pathogen. For example, nucleic acid primer pairs, combinations of nucleic acid primer pairs, nucleic acid arrays (e.g., diagnostic cards) containing nucleic acid primer pairs or combinations of nucleic acid primer pairs, methods for ... 02/22/07 - 20070042353 - Hcv polymerase suitable for crystal structure analysis and method for using the enzyme An HCV polymerase suitable for crystal structural analysis and a method for using the enzyme are provided. The HCV polymerase suitable for crystal structural analysis and/or comprising high HCV polymerase activity can be used for the three-dimensional structural analysis, and for rational identification of HCV polymerase inhibitors by computers. The ... 02/22/07 - 20070042352 - Retroviral vector and cell-based assay for measuring the mutations rate of retroviruses employing same Lentiviral-based retrovirus vectors and an in vivo mutation rate assay employing them. More particularly, an assay for directly determining the in vivo mutation rate of HIV-1. ... 02/22/07 - 20070042351 - Multi-allelic molecular detection of sars-associated coronavirus The subject invention relates to a multiple-allelic RT-real-time polymerase chain reaction (PCR) assay for coronaviruses including the SARS virus. Multiple target sequences within the SARS-CoV, S, E, M and N genes are identified. The use of the four different targets enhances the likelihood that the fundamental genetic drift of the ... 02/22/07 - 20070042350 - Methods and compositions for detecting sars virus and other infectious agents This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotides sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated. ... 02/22/07 - 20070042349 - Methods for assessing biologic diversity Methods for determining biologic diversity (e.g., lymphocyte receptor diversity or diversity of viral quasispecies) in a subject are described, as well as methods for monitoring a disease in a subject. ... 02/22/07 - 20070042348 - Colorimetric sensor A means for detecting a presence of a particular material in the air, a filter for an air conditioner which can confirm the presence of the particular material in the air, and a method for confirming a performance of the filter for an air conditioner about a removal of the ... 02/15/07 - 20070037143 - Method for screening for protease modulators The present invention is in the field of pharmaceutical research tools. Specifically, the present invention provides methods for screening compounds or compositions with respect to their ability and/or specificity to modulate the activity of proteases. ... 02/15/07 - 20070037142 - Methods and apparatus for detecting viruses using an acoustic device Methods for detecting viruses are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for the virus, is combined with the sample to form a plurality of analyte-particle complexes. The system also includes a transport arrangement for transporting the sample to the ... 02/15/07 - 20070037141 - Methods and compositions for inhibition of membrane fusion-associated events, including hiv transmission The present invention relates to peptides which exhibit potent anti-retroviral activity. The peptides of the invention comprise DP178 (SEQ ID:1) peptide corresponding to amino acids 638 to 673 of the HIV-1LAI gp41 protein, and fragments, analogs and homologs of DP178. The invention further relates to the uses of such peptides ... 02/15/07 - 20070037140 - Methods and compositions for detecting sars virus This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotide sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated. ... 02/15/07 - 20070037139 - Method of analyzing gene introduction site A method of analyzing, in chromosomal DNA having a retroviral vector incorporated therein, DNA region derived from chromosome which is adjacent to the vector, characterized in that a primer extension reaction and a nucleic acid amplification reaction are carried out in the presence of a compound capable of lowering the ... 02/15/07 - 20070037138 - Standard for immunohistochemistry, immunocytochemistry and molecular cytogenetics This application describes a method comprising: (a) providing a reference standard or a planar section thereof, the reference standard comprising (i) a support medium; and (ii) a quantity of a detectable entity supported by the support medium; in which the detectable entity has an elongate path; in which a predetermined ... 02/15/07 - 20070037137 - Method and kit for quantitative and qualitative determination of human papillomavirus The present invention relates to a method and kit for quantitative and qualitative determination of human papillomavirus, HPV, in a sample. More precisely, for quantitative and qualitative determination of oncogenic HPV to predict the risk of HPV infection resulting in cervical carcinoma. The method and kit enable simultaneous measurement of ... 02/08/07 - 20070031828 - Assay A process for identification of type-specific polynucleotide sequences in a sample, the process comprising the steps of (1) contacting polynucleotides from the sample, or derived from the sample, with a plurality of type-specific probes in the context of a solid support, and detection of any type-specific hybridisation; and (2) contacting ... 02/08/07 - 20070031827 - Method and detector for identifying subtypes of human papilloma viruses A detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detector comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype ... 02/08/07 - 20070031826 - Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof This invention relates to a kit and a method of use thereof to detect and determine the genotype of HPVs in a biological sample. The kit for detection and determination of the genotype of HPV, comprises PCR primers for HPV genes; HPV oligonucleotide chips having one or more probes immobilized ... 02/08/07 - 20070031825 - Methods and compositions for detecting bk virus The invention provides methods and compositions for rapid, sensitive, and highly specific nucleic acid-based (e.g., DNA based) detection of a BK virus in a sample. In general, the methods involve detecting a target nucleic acid having a target sequence of a conserved region of BK viral genomes. The invention also ... 02/08/07 - 20070031824 - Simultaneous quantification of nucleic acids in diseased cells A process for assessing mitochondrial toxicity of a compound that includes contacting nucleic acids from a host with an amplification reaction mixture that contains at least two primers that provide detectable signals, wherein: a first primer provides a first detectable signal upon amplification of a host mitochondrial nucleic acid; a ... 02/08/07 - 20070031823 - Bioinformatically detectable group of novel vaccinia regulatory genes and uses thereof The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “genomic record” or “GR” genes. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive viral ... 02/08/07 - 20070031822 - Ndr kinase modulators Methods of identifying agents that modulate NDR kinases, including those that modulate NDR1 and NDR2 kinases and methods of using those agents to inhibit retroviral pathogenesis are among the methods described herein. ... 02/01/07 - 20070026392 - Disease model incorporation into an artificial immune system (ais) The present invention relates to methods for preparing an artificial immune system. The artificial immune system comprises a cell culture comprising a three-dimensional matrix comprising lymphoid tissue, a three-dimensional matrix comprising epithelial and/or endothelial cells, and diseased cells. The artificial immune system of the present invention can be used for ... 02/01/07 - 20070026391 - Methods and compositions for identifying chemical or biological agents using multiplexed labeling and colocalization detection The present invention provides methods for detecting a target pathogenic agent, e.g., a virus, a bacterium, and/or a toxic substance, using colocalization detection. The invention also provides methods for parallel detection of different target pathogenic agents in a sample using multiplexed labeling and colocalization detection. The invention also provides kits ... 02/01/07 - 20070026390 - Development of diagnostic kit against the recombinant coat protein of prunus necrotic ringspot virus The present invention deals with a set of primers of sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful for detection of Prunus necrotic ringspot virus in plants. It also relates to a method for detection of Prunus necrotic ringspot virus in plants by using ... 02/01/07 - 20070026389 - Methods for drug discovery, disease treatment, and diagnosis using metabolomics The small molecule profiles of cells are compared to identify small molecules which are modulated in altered states. Cellular small molecule libraries, methods of identifying tissue sources, methods for treating genetic and non-genetic diseases, and methods for predicting the efficacy of drugs are also discussed. ... 02/01/07 - 20070026388 - Analyte detection using carbon nanotubes A method for detecting analytes involves measuring the fluorescence of a sample of fluorescence-attenuated carbon nanotubes, then exposing the sample to a target analyte, and then measuring the fluorescence again. The fluorescence-attenuated nanotubes include a chemical having quenching portion that interacts with the nanotubes and attenuates the fluorescence, a receptor ... 02/01/07 - 20070026387 - Diagnosing and monitoring inflammatory diseases by measuring complement components on white blood cells The invention is related to methods of diagnosing inflammatory diseases or conditions by determining levels of components of the complement pathway on the surface of white blood cells. ... 02/01/07 - 20070026386 - Method for the detection of newly acquired hiv infection The present invention relates to the detection of a human immunodeficiency virus (HIV) infection. More particularly, the present invention relates to methods of distinguishing between early antibody responsesto HIV infection from matured responses. In one aspect, the present invention provides a method of distinguishing between a recent and an established ... 01/25/07 - 20070020620 - Compositions and methods for coupling a plurality of compounds to a scaffold Compositions and methods are provided for coupling a plurality of compounds to a scaffold. Compositions and methods are further provided for catalyzing a reaction between at least one terminal alkyne moiety and at least one azide moiety, wherein one moiety is attached to the compound and the other moiety is ... 01/25/07 - 20070020619 - Method for identifying motifs and/or combinations of motifs having a boolean state of predetermined mutation in a set of sequences and its applications Methods for identifying a motif or a combination of motifs having a Boolean state of predetermined mutations in a set of sequences including a) aligning a set of sequences of ordered motifs represented by a single-character code, b) comparing a reference sequence with the set of sequences aligned in step ... 01/25/07 - 20070020618 - Process to study changes in gene expression in t lymphocytes Methods are disclosed to identify T lymphocyte genes that are differentially expressed upon exposure to a pathogen (viral or bacterial), immunogen, antigen, or in a sterile inflammatory disease, autoimmune disease, immunodeficiency disease, lymphocytic cancers, or graft versus host rejection. The method involves the preparation of a gene expression profile of ... 01/25/07 - 20070020617 - Gel microdrops in genetic analysis The invention provides methods of nucleic acid analysis. Such methods entail forming a population of gel microdrops encapsulating a population of biological entities, each entity comprising a nucleic acid, whereby at least some microdrops in the population each encapsulate a single entity. The population of gel microdrops is then contacted ... 01/25/07 - 20070020616 - Parallel process for protein or virus separation from a sample A sample is divided into a series of aliquots with the aliquots being subjected to at least two successive parallel separation steps in order to resolve protein or viral components thereof. The separation steps are performed not only on a sample but subsamples each containing a prelabeled tag to afford ... 01/25/07 - 20070020615 - Quantitative prediction method The present invention concerns methods and systems for analysis of drug resistance in HIV-1. More specifically, the invention provides methods for predicting drug resistance by correlating genotypic information with phenotypic profiles. The methods allow the identification of primary and secondary resistance-associated mutations for new and existing drugs and for calculating ... 01/25/07 - 20070020614 - Development of novel anti-microbial agents based on bacteriophage genomics A method for identifying suitable targets for antibacterial agents based on identifying targets of bacteriophage-encoded proteins is described. Also described are compositions useful in the identification methods and in inhibiting bacterial growth, and methods for preparing and using such compositions. ... 01/18/07 - 20070015143 - Preparation and use of mixed mode solid substrates for chromatography adsorbents and biochip arrays For certain mixed mode resins having anionic character, a ligand is joined to a solid support via a linkage that includes a mercapto-, ether- or amino-containing moiety. A suitable ligand comprises an aromatic group, a heteroaromatic group, or a heterocyclic group, optionally fused, that is sulfate-, sulfonate-, phosphonate- or phosphate-substituted ... 01/18/07 - 20070015142 - Detection of hiv-1 by nucleic acid amplification Nucleic acid sequences and methods for detecting HIV-1 nucleic acid (LTR and pol sequences) in biological samples by detecting amplified nucleic acids are disclosed. Kits comprising nucleic acid oligomers for amplifying HIV-1 nucleic acid present in a biological sample and detecting the amplified nucleic acid are disclosed. ... 01/18/07 - 20070015141 - Process for adjusting the diameter of gold particles and colloidal gold solution A method for estimating the particle diameter distribution width of gold colloid based on the measurement of, in addition to the maximum absorption wavelength, a ratio (AλX/Aλmax) of the absorbance (AλX) at a wavelength differing from the maximum absorption wavelength to the absorbance (Aλmax) at the maximum absorption wavelength of ... 01/18/07 - 20070015140 - Method of examining specimen and specimen container to be used in the examination method A method of immunologically examining a specimen which comprises attaching a cap having a filter impregnated with a labeled antibody enclosed therein to a container body containing a diluted liquid specimen, pouring the diluted liquid specimen from the container into a test device, observing the reaction and thus examining the ... 01/18/07 - 20070015139 - Biological reagents and methods to verify the efficiency of sample preparation and nucleic acid amplification and/or detection This invention relates to reagent comprising: any one of cells, viral particles, organelles, parasites, cells comprising organelles, cells comprising viral particles, cells comprising parasites, cells comprising bacterial cells and any combination thereof, the cells, viral particles, organelles or parasites comprising at least one nucleic acid sequence serving as an internal ... 01/11/07 - 20070009885 - Methods and compositions for the detection of cervical disease Methods and compositions for identifying high-grade cervical disease in a patient sample are provided. The methods of the invention comprise detecting overexpression of at least one biomarker in a body sample, wherein the biomarker is selectively overexpressed in high-grade cervical disease. In particular claims, the body sample is a cervical ... 01/11/07 - 20070009884 - Methods and apparatuses for detecting chemical or biological agents The present invention provides methods and apparatuses for detection of pathogens or toxins in a sample. The invention also provides kits comprises reagents, including probes sets, and other consumables, such as surfaces, which can be used for detection of pathogens or toxins in a sample. ... 01/04/07 - 20070003925 - Multiplexed biological analyzer planar array apparatus and methods A planar array having plurality of biological recognition molecules including at least two types of biological recognition molecules distributed about a substrate is disclosed. A first type of biological recognition molecules is distributed according to a first frequency and a second type of biological recognition molecules is distributed according to ... 01/04/07 - 20070003924 - Serial analysis of ribosomal and other microbial sequence tags A simple and robust method for genetic analysis of complex microbial communities involves the steps of PCR amplification of V1 region of rrs genes in the community DNA sample using two universal primers, followed by cleavage by BsgI and removal of dual-biotinylated primers using streptavidin-coated magnetic beads to purify RSTs, ... 01/04/07 - 20070003923 - Modified fiber proteins for efficient receptor binding Recombinant detargeted and retargeted adenovirus viral particles and vectors are provided. In particular, modified fibers from adenoviruses that bind to coxsackie-adenovirus receptor (CAR) in vivo that contain modifications in the fiber shaft are provided. Adenovirus (Ad) particles that express such fibers exhibit reduced binding to CAR. Hence detargeted Ad particles ... 12/28/06 - 20060292559 - Cell-based microarrays, and methods for their preparation and use The present invention is in the field of chemistry and biotechnology. The present invention relates to cell-based microarrays, improved methods for forming such arrays, and methods for using such arrays in diagnostics, therapeutics and research. The invention particularly concerns microarrays in which ligands of a target cells are immobilized to ... 12/28/06 - 20060292558 - Methods and apparatus for protein assay diagnostics Automated protein assay apparatus and methods for measuring antibodies against an analyte are described. A standard mixture of one or more analytes is loaded into a capillary, the analytes are resolved by isoelectric focusing and immobilized in the capillary. Serum from a human or non-human subject under analysis is flowed ... 12/28/06 - 20060292557 - Methods and compositions for detecting herpes simplex virus type 2 The invention provides methods for sensitive and specific detection of anti-HSV-2 antibodies by depletion of cross-reactive (non-specific) antibodies in a biological sample that can lead to a false positive result. The invention also features compositions, including nucleic acids, polypeptides, and kits, for use in the methods of the invention. ... 12/28/06 - 20060292556 - Method of detecting antibodies to hcv A family of cDNA sequences derived from hepatitis C virus (HCV) are provided. These sequences encode antigens which react immunologically with antibodies present in individuals with non-A non-B hepatitis (NANBV), but which are absent from individuals infected with hepatitis A virus, or hepatitis B virus, and also are absent in ... 12/28/06 - 20060292555 - Biofunctional magnetic nanoparticles for pathogen detection This invention provides a method of detecting pathogens comprising the steps of: (a) contacting a sufficient amount of biofunctional magnetic nanoparticles with an appropriate sample for an appropriate period of time to permit the formation of complexes between the pathogens in the sample and the nanoparticles; (b) using a magnetic ... 12/28/06 - 20060292554 - Major coat protein variants for c-terminal and bi-terminal display The invention provides compositions and methods for enhanced display of heterologous proteins on viral particles. ... 12/28/06 - 20060292553 - Method for study of the genetic and functional variability of hiv and kit for using it A method of analyzing a sample possibly containing an HIV virus, including a) extracting viral RNA in a biological sample that possibly contains an HIV virus; b) reverse transcription of the RNA obtained of (a) and amplification with a first pair of primers to obtain an amplified product of reverse ... 12/28/06 - 20060292552 - Method for the detection and multiplex quantification of analytes in a sample, using microspheres The invention relates to a method for the detection and multiplex quantification of analytes in a sample, using functionalised microspheres, whereby said microspheres are magnetised after the sample has been brought into contact therewith. The inventive method is particularly suitable for the detection and multiplex quantification of several analytes by ... 12/28/06 - 20060292551 - Anti-viral activity of cathelicidin peptides The disclosure provides methods and compositions useful in the treatment of dermatitis and viral infections. The compositions comprise cationic peptides of the cathelicidin family including LL-37, related homologues, and variants thereof. ... 12/21/06 - 20060286552 - Direct quantification of gene expression using capillary electrophoresis with laser-induced fluorescence Provided is a method for direct quantification of gene expression using capillary electrophoresis with laser-induced fluorescence to measure RNA in a sample. Also provided is a method of diagnosing a disease in a subject, wherein the disease is caused by increased or decreased expression of a causative gene. ... 12/21/06 - 20060286551 - Rt-pcr detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (csfv) in samples The present invention provides a rapid RT-PCR detection method and a diagnostic kit for differentiating field isolates of classical swine fever virus (CSFV) from lapinized CSF vaccine viruses in samples. In order to detecting different genotypes of CSF virus, this invention uses a pair (or pairs) of CSF virus specific ... 12/21/06 - 20060286550 - Substrates for isolating, reacting and microscopically analyzing materials An immobilizing device for biological material comprises a rigid support (12) carrying a substrate layer (20, 20′) of polymer having biological immobilizing properties, e.g. for amino and nucleic acids. Substantially solid ultra-thin substrate layers (20′) having a thickness less than about 5 micron, preferably between about 0.1 and 0.5 micron, ... 12/21/06 - 20060286549 - Microfluidic system for identifying or sizing individual particles passing through a channel An apparatus for characterizing and identifying individual particles, including: an input reservoir; at least one output reservoir; a channel connecting the input reservoir to the at least one output reservoir, wherein the channel is functionalized with at least one molecule selected to interact with a marker on a surface of ... 12/21/06 - 20060286548 - Method of making recombinant human antibodies for use in biosensor technology According to the current invention and apparatus and methods are provided for the production of modified antibodies and calins for use in biosensor applications. ... 12/21/06 - 20060286547 - Time-of-addition assay for identifying anti-viral compounds The present invention relates to a multi-well assay for identifying a compound inhibiting the replication cycle of a micro-organism, for example, HIV, and to an apparatus for carrying out an assay according to the present invention. The invention further relates to compounds identifiable with an assay according to the invention ... 12/21/06 - 20060286546 - Method and kit for the quantitative and/or qualitative detection of components in a sample A method and kit for quantitatively and/or qualitatively detecting one or more components in samples, including the use of metal-particle labelled reagents and an antibody conjugate are disclosed. The components are capable of binding to a probe. A kit and method for staining components in cell and tissue sections, based ... 12/21/06 - 20060286545 - Viral vectors with improved properties Methods to improve the tropism or other features of a virus is disclosed. Such methods can be used to prepare, e.g., DNA or plasmid libraries of variants of a gene encoding a viral capsid or envelope restriction site, libraries of viral clones with such variant genes with a randon-dy inserted ... 12/14/06 - 20060281077 - Label-free methods for performing assays using a colorimetric resonant reflectance optical biosensor Methods are provided for detecting biomolecular interactions. The use of labels is not required and the methods can be performed in a high-throughput manner. The invention also relates to optical devices. ... 12/14/06 - 20060281076 - Substrate functionalization method for high sensitivity applications A method for functionalizing substrates such as magnetic beads and glass slides is provided. The method involves providing substrate surfaces with activated polyacrylic acid (PAA) and attaching one or more desired capture probes. Substrates prepared by the method are particularly useful in ultrasensitive detection assays as they exhibit very low ... 12/14/06 - 20060281075 - Purification of viruses, proteins and nucleic acids Viruses, virus-like particles and protein and nucleic acid components are extracted from biological material using high ionic strength, activated carbon and changes in pH. The purified compositions are stored in similar or different conditions preferably with a higher pH. ... 12/14/06 - 20060281074 - Affinity-based detection of biological targets A method of biochemical identification by: providing a plurality of capture species bound to one or more substrates and suspected of having one or more biological targets affinity bound to at least one capture species; detecting which capture species contain bound biological targets to generate a binding pattern; and identifying ... 12/14/06 - 20060281073 - Broadening adenovirus tropism Recombinant adenoviruses comprising modified fiber proteins which expand the tropism of the adenovirus in comparison to wild-type virus are disclosed. The modified fiber proteins described herein contain a peptide ligand for a cell surface binding site other than CAR comprising a 14 amino acid core sequence containing both fixed and ... 12/14/06 - 20060281072 - Agonistic binding molecules to the human ox40 receptor The present invention provides binding molecules, such as human binding molecules, that bind to and stimulate the human OX40-receptor. The invention also provides nucleic acids encoding such binding molecules. Methods for producing such binding molecules are also provided by the present invention. The binding molecules and nucleic acids are useful ... 12/07/06 - 20060275754 - Method for a rapid test The object of the invention is a method for a rapid test. In the method in accordance with the invention a particle reagent is placed into a separate sample or reagent receptacle or test tube, in which the particle reagent reacts with one or several analytes in the liquid sample, ... 12/07/06 - 20060275753 - Recovery of analytes using combinatorial libraries The invention provides a method of binding multiple targets in samples by binding to multiple ligands. The method comprises providing ligands attached to a support, and contacting the ligands with targets to produce at least two target-ligand-support complexes. The method further comprises removal of non-bound targets followed by elution of ... 12/07/06 - 20060275752 - Multiparameteric method for assessing immune system status The invention provides a multiparametric method of assessing the reaction of a patient's immune system to a test subject. The invention compares a patient sample reacted with a test sample and a third party sample and combines the assessments of the multiple parameters to correlate the test reaction with a ... 12/07/06 - 20060275751 - Methods and compositions for screening using diphtheria toxin constructs The invention relates to methods and compositions utilizing diphtheria toxin for screening purposes. The invention is particularly useful in screening for modulators of IgE synthesis, secretion and switch rearrangement. ... 12/07/06 - 20060275750 - Bioreactive agents This invention relates to agents and conjugates that can be used to detect and isolate target components from complex mixtures such as nucleic acids from biological samples, cells from bodily fluids, and nascent proteins from translation reactions. Agents comprise a detectable moiety bound to a photoreactive moiety. Conjugates comprise agents ... 12/07/06 - 20060275749 - Compositions for use in identification of orthopoxviruses Oligonucleotide primers and compositions and kits containing the same for rapid identification of orthopoxviruses by amplification of a segment of viral nucleic acid followed by molecular mass analysis are provided. ... 12/07/06 - 20060275748 - Integrase cofactor In a study of HIV-1 integrase (IN) complexes derived from nuclei of human cells stably expressing the viral protein from a synthetic gene it was demonstrated that in the nuclear extracts IN exists as part of a large distinct complex with apparent Stokes radius of 61 Å, which dissociates upon ... 12/07/06 - 20060275747 - Endogenous retrovirus up-regulated in prostate cancer A specific member of the HERV-K family located in chromosome 22 at 20.428 megabases (22q11.2) has been found to be preferentially and significantly up-regulated in prostate tumors. The invention provides methods for diagnosing prostate cancer, comprising the step of detecting in a patient sample the presence or absence of an ... 12/07/06 - 20060275746 - Peptides which enhance transport across tissues and methods of identifying and using the same A method of identifying a peptide which permits or facilitates the transport of an active agent through a human or animal tissue. A predetermined amount of phage from a random phage library or preselected phage library is plated unto or brought into contact with a first side, preferably the apical ... 11/30/06 - 20060269911 - Antisense antiviral compound and method for treating ssrna viral infection The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Flaviviridae, Picomoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae families in the treatment of a viral infection. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides having a sequence ... 11/30/06 - 20060269910 - Assay methods for detection of a virus in an avian tissue sample The invention relates to methods of detecting a virus in an avian tissue sample wherein genetic material derived from feathers is tested for the presence of genetic material from the virus. ... 11/23/06 - 20060263769 - Multiplex capture of nucleic acids Methods of capturing two or more nucleic acids simultaneously from a single sample are provided. Different nucleic acids are captured through cooperative hybridization events on different subsets of particles or at different selected positions on a spatially addressable solid support. Compositions, kits, and systems related to the methods are also ... 11/23/06 - 20060263768 - Matrix screening method The invention concerns a method which can be used to screen two or more repertoires of molecules against one another and/or to create combinatorial repertoires by combining two or more repertoires. In particular, the invention relates to a method whereby two repertoires of molecules can be screened such that all ... 11/23/06 - 20060263767 - Ultrasensitive detection of prions by automated protein misfolding cyclic amplification A highly sensitive method is provided for the detection of prions in a sample. These methods may be used to diagnose prion mediated transmissible spongiform encephalopathies such as bovine spongiform encephalopathy, Creutzfeldt-Jakob disease, scrapie, or chronic wasting disease. In particular a method for serial automated cyclic amplification of prion is ... 11/23/06 - 20060263766 - Compositions and chromatography materials for bioseparation The present invention relates to compositions and chromatography materials, such as materials for the separation of biomolecules. The composition can comprise granules comprising carbonaceous particles, and at least one carbonized substance selected from carbonized synthetic resins and carbonized pitches. The composition further comprises at least one organic group attached to ... 11/23/06 - 20060263765 - Peptides and mixtures thereof for use in the detection of severe acute respiratory syndrome-associated coronavirus (sars) The present invention relates to novel peptides and mixtures thereof useful for detecting Severe Acute Respiratory Syndrome-associated coronavirus (SARS-CoV) infections in humans and animals. Therefore, the present invention provides SARS-CoV diagnostic methods and kits. ... 11/23/06 - 20060263764 - Methods and constructs for evaluation of rnai targets and effector molecules Methods and constructs for selecting double-stranded RNA molecules capable of post-transcriptional gene silencing (PTGS) or RNA interference (RNAi); and methods of selecting targets susceptible to double-stranded RNA mediated PTGS or RNAi. ... 11/16/06 - 20060257863 - Viral detection method using viral encoded enzymes and chemiluminescent substrates A chemiluminescent system for detecting the presence of influenza virus in a biological fluid sample is provided. An influenza diagnostic kit is provided which includes (1) a sampling device for obtaining the biological fluid from a subject, (2) a chemiluminescent substrate material which, in the presence of influenza virus in ... 11/16/06 - 20060257862 - A highly cost-effective analytical device for performing immunoassays with ultra high sensitivity A simple easy to manufacture analytical device capable of performing membrane based immunoassays on batch of samples within 3 to 10 minutes wherein the method permits focused application of samples, costly labeled immunoassay and signal amplification reagents, said device includes an antibody-immobilized micro porous membrane, breadth corner layer of which ... 11/16/06 - 20060257861 - Screening assay for inhibitors of severe acute respiratory syndrome (sars) using seldi-tof mass spectrometry Mass spectrometric methods directed to screening libraries of compounds for agents that inhibit entry of Severe Acute Respiratory Syndrome (SARS) coronavirus (CoV) into cells are provided, along with methods for comparatively evaluating inhibitors of the SARS CoV. ... 11/16/06 - 20060257860 - Compositions and assays to detect influenza virus a and b nucleic acids Methods for detecting influenza virus A and influenza virus B nucleic acids in biological samples by using in vitro amplification and detection are disclosed. Compositions that are target-specific nucleic acid sequences and kits comprising target-specific nucleic acid oligomers for amplifying in vitro influenza virus A or influenza virus B nucleic ... 11/16/06 - 20060257859 - Recombinant enterovirus 71 neutralizing antibodies and applications thereof Provided is an antibody against enterovirus 71 comprising the amino acid sequence shown in SEQ ID NOS: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or functionally active homologues thereof. Also provided are methods for obtaining the antibody comprising (a) selecting a yeast expressing ... 11/16/06 - 20060257858 - Methods and compositions for introducing biopolymers into cells The invention relates to methods for introducing target biopolymers (e.g., nucleic acid molecules, proteins, etc.) and other compounds (e.g., non-polymeric organic molecules, such as steroids) into cells (e.g., eukaryotic cells). The invention further relates to compositions comprising target biopolymers and other compounds. In certain aspects, the invention relates to the ... 11/16/06 - 20060257857 - Methods for identifying functionally related genes and drug targets The identification and evaluation of mRNA and protein targets associated with mRNP complexes and implicated in the expression of proteins involved in common physiological pathways is described. Effective targets are useful for treating a disease, condition or disorder associated with the physiological pathway. ... 11/16/06 - 20060257856 - Heterodimeric receptor libraries using phagemids Filamentous phage comprising a matrix of cpVIII proteins encapsulating a genome encoding first and second polypeptides of an antogenously assembling receptor, such as an antibody, and a receptor comprised of the first and second polypeptides surface-integrated into the matrix via a filamentous phage coat protein membrane anchor domain fused to ... 11/16/06 - 20060257855 - Biological particulate matter analogue The present invention provides a biological particle analogue, or biological analogue, that simulates a chosen biological organism or compound. The biological analogue includes a first portion that is not, in and of itself, recognized by the biological detection system, and a second portion, which provides the properties necessary for recognition ... 11/16/06 - 20060257854 - Membrane assay system including preloaded particles Described herein is an analyte detection device and method related to a portable instrument suitable for point-of-care analyses. In some embodiments, a portable instrument may include a disposable cartridge, an optical detector, a sample collection device and/or sample reservoir, reagent delivery systems, fluid delivery systems, one or more channels, and/or ... 11/16/06 - 20060257853 - Autonomous surveillance system A detection system includes a collector for capturing a first particle, a first device for determining a class of a second particle, a second device for determining an identity of the first particle, and a control system. The control system is configured to select a test to be performed by ... 11/16/06 - 20060257852 - Severe acute respiratory syndrome coronavirus An outbreak of a virulent respiratory virus, now known as Severe Acute Respiratory Syndrome (SARS), was identified in Hong Kong, China and a growing number of countries around the world in 2003. The invention relates to nucleic acids and proteins from the SARS coronavirus. These nucleic acids and proteins can ... 11/16/06 - 20060257851 - Bioinformatically detectable group of novel viral regulatory genes and uses thereof The present invention relates to a first group of novel genes, here identified as genomic address messenger or VGAM genes, and a second group of novel operon-like genes, here identified as viral genomic record or VGR genes. VGAM genes selectively inhibit translation of known ‘target’ genes, many of which are ... 11/16/06 - 20060257850 - Methods of treatment and diagnosis of patients with hepatitis c infection Use of a compound capable of modulating the level of activity of the OAS gene and/or activity of the OAS protein, in the manufacture of a medicament for the treatment of a patient with or at risk of hepatitis C infection, wherein the compound is not an interferon or an ... 11/16/06 - 20060257849 - Method of screening for therapeutics for infectious diseases The present invention relates to a method of screening for a host cell gene products which are useful as therapeutics for an infective disease. This method comprises identifying genes which are differentially expressed in infected cells, and screening the differentially expressed gene products for immunogenicity. ... 11/09/06 - 20060252033 - Carrier of a diamond fine particle for immobilizing virus The present invention provides a carrier for immobilizing a bio-derived polymer, and especially, the present invention provides a carrier of diamond fine particle for immobilizing a DNA, RNA, protein and peptide, as well as a DNA chip substrate, a carrier for trapping virus and a vaccine. The carrier is prepared ... 11/09/06 - 20060252032 - Detection of human herpesviruses The present invention provides methods, compositions, and kits related to nucleic acid detection assays for detecting human herpes virus. For example, the present invention provides detection assays for detecting human herpes virus subtypes HHV1- through HHV-8. ... 11/09/06 - 20060252031 - Bead based assays using a liquid crystal reporter The present invention relates to the field of detection of analytes, and in particular to detection of viruses, cells, bacteria, lipid-membrane containing organisms, proteins, nucleic acids, carbohydrates and other biomolecules, organic molecules and inorganic molecules using a liquid crystal assay format. ... 11/09/06 - 20060252030 - Fabrication of carbohydrate chips by immobilizing unmodified carbohydrates on derivatized solid surfaces, and their uses The present invention relates to the fabrication of carbohydrate chips wherein free carbohydrates are immobilized on a modified solid surface. More specifically, it relates to a fabrication method for carbohydrate chips wherein unmodified carbohydrates irrespective of their size are site-specifically and covalently attached to the solid surface derivatized by hydrazide ... 11/09/06 - 20060252029 - Detection of hpv-induced invasive cancers and their precursor lesions with invasive potential The invention is in the field of medicine and is concerned with a molecular diagnostic marker for progression to invasiveness of HPV-induced premalignant lesions and future metastatic potential of HPV-induced premalignant lesions and carcinomas. In particular the present invention relates to the use of the TSLC1 gene as marker for ... 11/09/06 - 20060252028 - Method of assaying interaction between proteins A novel method for determining interaction between VH fragment and VL fragment of the variable region of an antibody is provided by the present invention. The method according to this invention can be widely used for detection of protein interactions. If a phagemid vector containing an amber codon is used ... 11/02/06 - 20060246429 - Dot-elisa for the detection of animal viruses A monoclonal antibody-based Dot-ELISA assay for the rapid detection of animal viruses such as avian influenza virus. The assay includes applying a specimen suspected of containing an animal virus on a porous membrane and treating the specimen with a solution of citric acid or lactic acid and a solution containing ... 11/02/06 - 20060246428 - Polynucleotide probe and primer derived from hepatitis e virus recovered from japanese, chip including the same, kit including the same, and method of detecting hepatitis e virus genome using the same A polynucleotide probe that has a sequence of at least 8 nucleotides which can be hybridized with nucleotides from the hepatitis E virus JRA 1; a probe assay kit that includes the polynucleotide probe; and a chip on which the polynucleotide probe has been solid-phase fixed. ... 11/02/06 - 20060246427 - Method for determining the mechanism of hiv rt inhibitors The present invention is directed to the field of HIV resistance to RT inhibitors and methods of determining the levels and mechanisms of action of HIV resistance. The methods of the present invention may be accomplished using a novel in vitro assay that provides a reaction well comprising a template ... 11/02/06 - 20060246426 - Recombinant fusion proteins with high affinity binding to gold and applications thereof The present invention provides a method to firmly attach any polypeptide to a gold surface regardless of its intrinsic gold-binding properties. The method describes the production of recombinant fusion proteins consisting of polypeptides of interest and a high affinity gold binding peptide consisting of 1 to 7 repeats of a ... 11/02/06 - 20060246425 - Assay for porcine circovirus production The present invention provides methods for the determination of the viral titer of a culture of host animal host cells infected with a circovirus. The FACS-based methods of the invention may include determining the viability of the host cells in a cell culture medium supernatant and of those cells that ... 11/02/06 - 20060246424 - Self-replicating rna molecule from hepatitis c virus A unique HCV RNA molecule is provided having an enhanced efficiency of establishing cell culture replication. Novel adaptive mutations have been identified within the HCV non-structural region that improves the efficiency of establishing persistently replicating HCV RNA in cell culture. This self-replicating polynucleotide molecule contains, contrary to all previous reports, ... 11/02/06 - 20060246423 - Method and kit for the collection and maintenance of the detectability of a plurality of microbiological species in a single gynecological sample A method and kit related thereto are described for the collection and maintenance of detectability of a plurality of species of microbiological agents selected from the group consisting of bacteria, fungi, viruses, and protozoa, in a single gynecological sample which comprises providing transport media in a resealable container and instructions ... 11/02/06 - 20060246422 - Methods and compositions for use in spliceosome mediated rna trans-splicing The molecules and methods of the present invention provide a means for in vivo production of a trans-spliced molecule in a selected subset of cells. The pre-trans-splicing molecules of the invention are substrates for a trans-splicing reaction between the pre-trans-splicing molecules and a pre-mRNA that is uniquely expressed in the ... 11/02/06 - 20060246421 - Compounds and methods for inhibiting hepatitis c virus replication The inventors have discovered that an ATPase-deficient dominant-negative mutant NS3 protein of hepatitis C virus inhibits activity of the wild-type NS3 protein and inhibits replication of hepatitis C virus (HCV). The solved crystal structure of a multi-enzyme NS3 complex on a DNA substrate is also provided. The inventors have tested ... 11/02/06 - 20060246420 - In vitro diagnostic test for enterovirus infections The present invention is related to an in vitro diagnostic assay of enteroviruses, based on the revealing of an immunologic reaction of antigen-antibody recognition type, using antigens or epitopes thereof that do not induce antiviral neutralising antibodies but induce “facilitating” antibodies which increase the viral infection. ... 10/26/06 - 20060240415 - Screening compound libraries using an optical fiber array device capable of simultaneously performing multiple functional assays Disclosed is a method of screening Compounds wherein target cells are coated onto a population of microbeads, and wherein each microbead is coated with several cells of the same cellular type and has an assay and an assay reporter associated with it. Each of the cell-coated microbeads are positioned in ... 10/26/06 - 20060240414 - Genetically engineered glutaminase and its use in antiviral and anticancer therapy DNA encoding a therapeutically suitable glutaminase has been molecularly cloned. This allows one to obtain a polypeptide which is a therapeutically suitable glutaminase free of contaminating endotoxin. It has been found that this polypeptide is a potent anti-viral agent and when coupled to an anti-tumor monoclonal antibody is a potent ... 10/26/06 - 20060240413 - Medical test probe for cell sample collection A device and method are disclosed for collecting biological samples. One embodiment includes a device for collecting biological samples comprising a probe having a cell collector located on a distal end, the probe having a plurality of distinct raised protrusions. ... 10/26/06 - 20060240412 - Compositions for use in identification of adenoviruses The present invention provides compositions, kits and methods for rapid identification and quantification of adenoviruses by molecular mass and base composition analysis. ... 10/26/06 - 20060240411 - Multiplex microparticle system Arrays of microparticle populations, each population labeled with a single fluorescent dye, are provided for use in multiplex assays. The populations form a virtual multidimensional array wherein each microparticle is identified by fluorescence intensity in two different fluorescence detection channels. The arrays are useful in a variety of assays, including ... 10/26/06 - 20060240410 - Retroviral protease inhibitor combinations The present invention is directed to a method for the treatment of mammalian retrovirus infections, such as HIV, using combinations of retroviral protease inhibitors which are effective in preventing the replication of the retroviruses in vitro or in vivo. This invention, in particular, relates to protease inhibitor compounds used in ... 10/26/06 - 20060240409 - Method for extraction and identification of nucleic acids The invention provides a method for extracting nucleic acids from a sample. The sample contains cells, viruses, or both cells and viruses. The method include adding a lysing solution containing a detergent to the sample to lyse the cells or viruses to form a lysate, adding alcohol to the lysate ... 10/26/06 - 20060240408 - |