FreshPatents.com Logo FreshPatents.com icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents

    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • CUSTOM RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • POPULAR PATENTS
  • Most popular patents recently. Top 40.

  • COMPANY PATENTS
  • Patents sorted by company.

06/28/07 - Class 435 site info Info monitor Monitor Keywords monitor archive Archive organizer Organizer account info Account |  Prev - Next

Process for producting 1,3-propanediol and or/3-hydroxypropionic acid pdficon_sm

pdficondownload pdfimage preview


Abstract: This invention is intended to improve the efficiency of producing 1,3-propanediol from glycerol and to provide an industrially effective process for producing the same. Such process involves the use of a transformant comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof, the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof, the gene encoding aldehyde dehydrogenase, and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase. ...

Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP - Washington, DC, US
Inventors: Shinzo Yasuda, Masaharu Mukoyama, Hiroshi Horikawa, Tetsuo Toraya, Hidetoshi Morita
USPTO Applicaton #: #20070148749 - Class: 435158000 (USPTO)

view organizer monitor keywords

Related Terms: Aldehyde Dehydrogenase   Oxidoreductase   Transformant    Related Patent Categories: Chemistry: Molecular Biology And Microbiology, Micro-organism, Tissue Cell Culture Or Enzyme Using Process To Synthesize A Desired Chemical Compound Or Composition, Preparing Oxygen-containing Organic Compound, Containing Hydroxy Group, Acyclic, Polyhydric
The Patent Description & Claims data below is from USPTO Patent Application 20070148749, Process for producting 1,3-propanediol and or/3-hydroxypropionic acid.

  monitor keywords
pdficondownload pdf

Aldehyde Dehydrogenase   Oxidoreductase   Transformant   

TECHNICAL FIELD

[0001] The present invention relates to a transformant comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding aldehyde dehydrogenase; and the gene encoding 1,3-propanediol oxidoreductase. and/or the gene encoding propanol dehydrogenase. The present invention also relates to knockout bacteria, from which the gene encoding glycerol dehydrogenase is knocked out. Further, the present invention relates to a method for producing 1,3-propanediol and/or 3-hydroxypropionic acid using such transformants or knockout bacteria.

BACKGROUND ART

[0002] 1,3-Propanediol is a monomer that is used in the production of polyester fibers and of polyurethane and cyclic compounds. A variety of pathways for 1,3-propanediol synthesis are known. Examples of such methods include: a method wherein 1,3-propanediol is produced via catalytic conversion of ethylene oxide in the presence of phosphine, water, carbon monoxide, hydrogen, and acid; a method wherein 1,3-propanediol is produced via catalytic liquid-phase hydration of acrolein, followed by reduction; and a method wherein 1,3-propanediol is produced by allowing hydrocarbon (e.g., glycerol) to react in the presence of carbon monoxide, hydrogen, and a catalyst having a group VIII atom of the periodic table. However, conventional chemical synthesis has been disadvantageous in terms of cost and generation of wastes containing environmental pollutants.

[0003] In order to overcome such drawbacks, biological methods for producing 1,3-propanediol, i.e., methods that involve the use of microorganisms having enzymes for catalyzing the fermentation of glycerol to 1,3-propanediol, have been reported (see Patent Documents 1 to 6). Bacterial strains that can produce 1,3-propanediol from glycerol have been discovered in bacteria of genera such as Citrobacter, Clostridium, Enterobacter, Salmonella, Klebsiella, Lactobacillus, Caloramator, and Listeria.

[0004] In a biological system, glycerol is converted into 1,3-propanediol through a 2-stage enzyme catalytic reaction. At the first stage, glycerol dehydratase converts glycerol into 3-hydroxypropionaldehyde (3-HPA) and water (glycerol.fwdarw.3-HPA+H.sub.2O). At the second stage, 3-HPA is reduced to 1,3-propanediol by NAD.sup.+-dependent oxidoreductase (3-HPA+NADH+H.sup.+.fwdarw.1,3-propanediol +NAD.sup.+). 1,3-Propanediol is not further metabolized and it is consequently accumulated in a medium.

[0005] Production of 1,3-propanediol from glycerol in a biological system is generally carried out under anaerobic conditions using glycerol as a single carbon source in the absence of other exogenous reducing-equivalent receptors. Accordingly, a glycerol-related parallel path is activated, wherein glycerol is first oxidized to dihydroxyacetone (DHA) by NAD.sup.+- (or NADP.sup.+-)-bound glycerol dehydrogenase (i.e., glycerol+NAD.sup.+.fwdarw.DHA+NADH+H). DHA is phosphorylated into dihydroxyacetone phosphate by DHA kinase and the product is utilized for biosynthesis and ATP generation.

[0006] According to conventional techniques for producing 1,3-propanediol involving the use of microorganisms, therefore, a half of the starting amount of glycerol is consumed in the parallel path, and the yield of the product is low in relation to the starting amount of glycerol. Thus, such techniques have been problematic in terms of efficiency and cost.

[0007] 3-Hydroxypropionic acid and esters thereof are compounds that are useful as starting materials of aliphatic polyesters. Polyesters synthesized therefrom have drawn attention as biodegradable environmentally-friendly polyesters.

[0008] In general, 3-hydroxypropionic acid is produced by the addition of water to acrylic acid or by a reaction between ethylene chlorohydrin and sodium cyanate. Since the reaction whereby acrylic acid is hydrated is an equilibrium reaction, the response rate is disadvantageously limited. In the case of the reaction of ethylene chlorohydrin, use of virulent substances is required, and a step of hydrolysis is further required. In such a case, large quantities of sodium chloride and ammonium salts are disadvantageously generated. [0009] Patent Document 1: WO 98/21339 [0010] Patent Document 2: WO 98/21341 [0011] Patent Document 3: U.S. Pat. No. 5,821,092 [0012] Patent Document 4: U.S. Pat. No. 5,254,467 [0013] Patent Document 5: U.S. Pat. No. 5,633,362 [0014] Patent Document 6: U.S. Pat. No. 5,686,276

DISCLOSURE OF THE INVENTION

[0015] The present invention is intended to improve the efficiently of the production of 1,3-propanediol from glycerol and to provide an industrially effective process for the production of the same.

[0016] The present inventors have conducted concentrated studies in order to attain the above objects. As a result, the present inventors discovered that two types of useful compounds could be effectively produced by bringing a transformant comprising the genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase, the genes each encoding a subunit of the reactivation factor for glycerol dehydratase, the gene encoding aldehyde dehydrogenase, and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase into contact with glycerol.

[0017] The present inventors also discovered that two types of useful compounds could be effectively produced by knocking out the gene encoding glycerol dehydrogenase of bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, and Propionibacterium, and bringing such bacteria into contact with glycerol.

[0018] Specifically, the present invention includes the following inventions.

[0019] (1) A transformant comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding aldehyde dehydrogenase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase (propanediol oxidoreductase).

[0020] (2) The transformant according to (1), wherein the genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase are derived from Lactobacillus reuteri.

[0021] (3) The transformant according to (2), wherein the gene encoding the large subunit of glycerol dehydratase encodes the following protein (a) or (b):

[0022] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 1 or 3; or

[0023] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 1 or 3 by deletion, substitution, or addition of one or several amino acid residues and having glycerol dehydratase activity when expressed with the medium and small subunits of glycerol dehydratase;

[0024] the gene encoding the medium subunit of glycerol dehydratase encodes the following protein (c) or (d):

[0025] (c) a protein comprising the amino acid sequence as shown in SEQ ID NO: 5 or 7; or

[0026] (d) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 5 or 7 by deletion, substitution, or addition of one or several amino acid residues and having glycerol dehydratase activity when expressed with the large and small subunits of glycerol dehydratase; and

[0027] the gene encoding the small subunit of glycerol dehydratase encodes the following protein (e) or (f):

[0028] (e) a protein comprising the amino acid sequence as shown in SEQ ID NO: 9 or 11; or

[0029] (f) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 9 or 11 by deletion, substitution, or addition of one or several amino acid residues and having glycerol dehydratase activity when expressed with the large and medium subunits of glycerol dehydratase.

[0030] (4) The transformant according to (2), wherein the gene encoding the large subunit of glycerol dehydratase comprises the following DNA (a) or (b):

[0031] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 2 or 4; or

[0032] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 2 or 4 and encoding a protein having glycerol dehydratase activity when expressed with the medium and small subunits of glycerol dehydratase;

[0033] the gene encoding the medium subunit of glycerol dehydratase comprising the following DNA (c) or (d):

[0034] (c) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 6 or 8; or

[0035] (d) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 6 or 8 and encoding a protein having glycerol dehydratase activity when expressed with the large and small subunits of glycerol dehydratase; and

[0036] the gene encoding the small subunit of glycerol dehydratase comprises the following DNA (e) or (f):

[0037] (e) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 10 or 12; or

[0038] (f) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 10 or 12 and encoding a protein having glycerol dehydratase activity when expressed with the large and medium subunits of glycerol dehydratase.

[0039] (5) The transformant according to any of (1) to (4), which comprises the gene encoding propanol dehydrogenase (propanediol oxidoreductase), such gene being derived from Lactobacillus reuteri.

[0040] (6) The transformant according to (5), wherein the gene encoding propanol dehydrogenase (propanediol oxidoreductase) encodes the following protein (a) or (b):

[0041] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 13 or 15; or

[0042] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 13 or 15 by deletion, substitution, or addition of one or several amino acid residues and having propanol dehydrogenase (propanediol oxidoreductase) activity.

[0043] (7) The transformant according to (5), wherein the gene encoding propanol dehydrogenase (propanediol oxidoreductase) comprises the following DNA (a) or (b):

[0044] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 14 or 16; or

[0045] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 14 or 16 and encoding a protein having propanol dehydrogenase (propanediol oxidoreductase) activity.

[0046] (8) The transformant according to any of (1) to (7), which comprises the gene encoding 1,3-propanediol oxidoreductase, such gene being derived from Lactobacillus reuteri.

[0047] (9) The transformant according to (8), wherein the gene encoding 1,3-propanediol oxidoreductase encodes the following protein (a) or (b):

[0048] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 17; or

[0049] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 17 by deletion, substitution, or addition of one or several amino acid residues and having 1,3-propanediol oxidoreductase activity.

[0050] (10) The transformant according to (8), wherein the gene encoding 1,3-propanediol oxidoreductase comprises the following DNA (a) or (b):

[0051] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 18; or

[0052] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 18 and encoding a protein having 1,3-propanediol oxidoreductase activity.

[0053] (11) The transformant according to any of (1) to (10), wherein the genes each encoding a subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase are derived from Lactobacillus reuteri.

[0054] (12) The transformant according to (11), wherein the gene encoding the large subunit of the reactivation factor for glycerol dehydratase encodes the following protein (a) or (b):

[0055] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 19 or 21; or

[0056] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 19 or 21 by deletion, substitution, or addition of one or several amino acid residues and having the activity of the reactivation factor for glycerol dehydratase when expressed with the small subunit of the reactivation factor for glycerol dehydratase, and

[0057] the gene encoding the small subunit of the reactivation factor for glycerol dehydratase encodes the following protein (c) or (d):

[0058] (c) a protein comprising the amino acid sequence as shown in SEQ ID NO: 23 or 25; or

[0059] (d) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 23 or 25 by deletion, substitution, or addition of one or several amino acid residues and having the activity of the reactivation factor for glycerol dehydratase when expressed with the large subunit of the reactivation factor for glycerol dehydratase.

[0060] (13) The transformant according to (11), wherein the gene encoding the large subunit of the reactivation factor for glycerol dehydratase comprises the following DNA (a) or (b):

[0061] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 20 or 22; or

[0062] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: SEQ ID NO: 20 or 22 and encoding a protein having the activity of the reactivation factor for glycerol dehydratase when expressed with the small subunit of the reactivation factor for glycerol dehydratase, and

[0063] the gene encoding the small subunit of the reactivation factor for glycerol dehydratase comprises the following DNA (c) or (d):

[0064] (c) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 24 or 26; or

[0065] (d) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: SEQ ID NO: 24 or 26 and encoding a protein having the reactivation factor for glycerol dehydratase when expressed with the large subunit of the reactivation factor for glycerol dehydratase.

[0066] (14) A method for producing 1,3-propanediol and 3-hydroxypropionic acid comprising culturing the transformant according to any of (1) to (13) in the presence of glycerol.

[0067] (15) Knockout bacteria, which are obtained by knocking out the gene encoding glycerol dehydrogenase from bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, or Propionibacterium.

[0068] (16) Knockout bacteria, which are obtained by knocking out the gene encoding glycerol dehydrogenase from bacteria having the pdu operon and the gene encoding phosphotransacylase.

[0069] (17) A method for producing 1,3-propanediol and/or 3-hydroxypropionic acid by bringing the bacteria of (15) or (16) into contact with glycerol.

[0070] (18) A transformant comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof, the gene encoding propionaldehyde dehydrogenase; the gene encoding phosphotransacylase; the gene encoding propionate kinase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase (propanediol oxidoreductase) and not comprising any gene encoding glycerol dehydrogenase.

[0071] (19) The transformant according to (18) having the pdu operon and not comprising any gene encoding glycerol dehydrogenase.

[0072] (20) The transformant according to (18) or (19), wherein the gene encoding propionaldehyde dehydrogenase encodes the following protein (a) or (b):

[0073] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 41; or

[0074] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 41 by deletion, substitution, or addition of one or several amino acid residues and having propionaldehyde dehydrogenase activity.

[0075] (21) The transformant according to (18) or (19), wherein the gene encoding propionaldehyde dehydrogenase comprises the following DNA (a) or (b):

[0076] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 42; or

[0077] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 42 and encoding a protein having the propionaldehyde dehydrogenase activity.

[0078] (22) The transformant according to (18) or (19), wherein the gene encoding propionate kinase encodes the following protein (a) or (b):

[0079] (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 43; or

[0080] (b) a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 43 by deletion, substitution, or addition of one or several amino acid residues and having propionate kinase activity.

[0081] (23) The transformant according to (18) or (19), wherein the gene encoding propionate kinase comprises the following DNA (a) or (b):

[0082] (a) DNA comprising the nucleotide sequence as shown in SEQ ID NO: 44; or

[0083] (b) DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in SEQ ID NO: 44 and encoding a protein having the propionate kinase activity.

[0084] (24) A method for producing 1,3-propanediol and/or 3-hydroxypropionic acid by bringing the transformant according to any of (18) to (23) into contact with glycerol.

[0085] According to the present invention, loss of starting glycerol used when producing 1,3-propanediol from glycerol can be reduced and 3-hydroxypropionic acid can also be produced in addition to 1,3-propanediol. Since bacteria used for such production can be effectively cultured, 1,3-propanediol and 3-hydroxypropionic acid can be produced with higher efficiency.

BRIEF DESCRIPTION OF THE DRAWINGS

[0086] FIG. 1 shows the structure of the pdu operon.

[0087] FIG. 2 shows an embodiment of a mechanism for producing 1,3-propanediol and 3-hydroxypropionic acid from glycerol.

PREFERRED EMBODIMENTS OF THE INVENTION

[0088] Hereafter, the present invention is described in detail.

[0089] The first aspect of the present invention relates to a transformant comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding aldehyde dehydrogenase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase.

[0090] The transformant according to the first aspect comprises the gene that encodes a protein having enzyme activity of catalyzing the reaction whereby glycerol is dehydrated and converted into 3-hydroxypropionaldehyde and water. Examples of such proteins include glycerol dehydratase and diol dehydratase. Glycerol dehydratase and diol dehydratase are each composed of 3 types of subunits, i.e., the large, medium, and small subunits. Examples of the transformant according to the present invention include those comprising the genes each encoding such 3 types of subunits of glycerol dehydratase, those comprising the genes each encoding such 3 types of subunits of diol dehydratase, and those comprising both the genes each encoding such 3 types of subunits of glycerol dehydratase and the genes each encoding such 3 types of subunits of diol dehydratase.

[0091] Known genes each encoding a subunit of glycerol dehydratase or diol dehydratase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria genera can be employed. In the present invention, the genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase derived from the bacteria of the genus Lactobacillus are preferable. The genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase derived from Lactobacillus reuteri are more preferable, and the genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase derived from the Lactobacillus reuteri JCM1112 strain and the Lactobacillus reuteri ATCC 53608 strain are further preferable.

[0092] SEQ ID NOs: 1 and 3 show the amino acid sequences of the large subunit of glycerol dehydratase derived from Lactobacillus reuteri. SEQ ID NOs: 5 and 7 show the amino acid sequences of the medium subunit thereof. SEQ ID NOs: 9 and 11 show the amino acid sequences of the small subunit thereof. SEQ ID NOs: 2 and 4 show the nucleotide sequences of the gene encoding the large subunit of glycerol dehydratase derived from Lactobacillus reuteri. SEQ ID NOs: 6 and 8 show the nucleotide sequences of the gene encoding the medium subunit thereof. SEQ ID NOs: 10 and 12 show the nucleotide sequences of the gene encoding the small subunit thereof.

[0093] Amino acid sequences of proteins may include mutations such as deletion, substitution, or addition of one or several amino acid residues as long as the proteins have glycerol dehydratase activity when expressed with the two other types of subunits.

[0094] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire nucleotide sequence as shown in each SEQ ID NO and that encodes a protein having glycerol dehydratase activity when expressed with the other two types of subunits.

[0095] The genes each encoding a subunit may be introduced into the same or different vectors to carry out transformation, as long as such genes are expressed in the same host. It is preferable that three types of subunits be derived from the same species or strain.

[0096] The transformant according to the first aspect comprises the gene encoding propanol dehydrogenase, the gene encoding 1,3-propanediol oxidoreductase, or both such genes.

[0097] In the present invention, the term "propanol dehydrogenase" (which also may be referred to as "propanediol oxidoreductase") is used in the general sense with which it is used in the art. That is, it refers to a protein having enzyme activity that can catalyze a reaction whereby 3-hydroxypropionaldehyde is reduced and converted into propanediol.

[0098] Known genes encoding propanol dehydrogenase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria can be employed. In the present invention, propanol dehydrogenase genes derived from the bacteria of the genus Lactobacillus are preferable, propanol dehydrogenase genes derived from Lactobacillus reuteri are more preferable, and propanol dehydrogenase genes derived from the Lactobacillus reuteri JCM1112 strain and the Lactobacillus reuteri ATCC 53608 strain are further preferable.

[0099] SEQ ID NOs: 13 and 15 show the amino acid sequences of propanol dehydrogenase derived from Lactobacillus reuteri. SEQ ID NOs: 14 and 16 show the nucleotide sequences of propanol dehydrogenase genes derived from Lactobacillus reuteri. As long as the proteins comprising such amino acid sequences have propanol dehydrogenase activity, the amino acid sequence as shown in SEQ ID NO: 13 or 15 may include mutations such as deletion, substitution, or addition of one or several amino acid residues.

[0100] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire nucleotide sequence of DNA comprising a sequence as shown in SEQ ID NO: 14 or 16 and that encodes a protein having propanol dehydrogenase activity.

[0101] In the present invention, the term "1,3-propanediol oxidoreductase" is used in the general sense with which it is used in the art. That is, it refers to a protein having enzyme activity that can catalyze a reaction whereby 3-hydroxypropionaldehyde is reduced and converted into 1,3-propanediol.

[0102] Known genes encoding 1,3-propanediol oxidoreductase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria can be employed. In the present invention, the 1,3-propanediol oxidoreductase genes derived from bacteria of the genus Lactobacillus are preferable, the 1,3-propanediol oxidoreductase genes derived from Lactobacillus reuteri are more preferable, and the 1,3-propanediol oxidoreductase genes derived from the Lactobacillus reuteri JCM1112 strain and the Lactobacillus reuteri ATCC 53608 strains are further preferable.

[0103] SEQ ID NO: 17 shows the amino acid sequence of the 1,3-propanediol oxidoreductase gene derived from Lactobacillus reuteri and SEQ ID NO: 18 shows the nucleotide sequence of the 1,3-propanediol oxidoreductase gene derived from Lactobacillus reuteri. As long as proteins comprising such amino acid sequences have 1,3-propanediol oxidoreductase activity, the amino acid sequence as shown in SEQ ID NO: 17 may include mutations such as deletion, substitution, or addition of one or several amino acid residues.

[0104] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire nucleotide sequence of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 18 and that encodes a protein having 1,3-propanediol oxidoreductase activity.

[0105] The transformant according to the first aspect of the present invention comprises the gene encoding a protein that replaces coenzyme B12 located at the reaction center of glycerol dehydratase or diol dehydratase, which had been deactivated via catalysis of conversion of glycerol into 3-hydroxypropionaldehyde and water, and regains its activity. Examples of such proteins include the reactivation factor for glycerol dehydratase and the reactivation factor for diol dehydratase. The reactivation factor for glycerol dehydratase and the reactivation factor for diol dehydratase are each composed of two types of subunits, i.e., a large subunit and a small subunit. Examples of the transformant of the present invention include those comprising the genes each encoding two types of subunits of the reactivation factor for glycerol dehydrogenase, those comprising the genes each encoding two types of subunits of the reactivation factor for diol dehydratase, and those comprising the genes each encoding two types of subunits of the reactivation factor for glycerol dehydratase and the genes each encoding two types of subunits of the reactivation factor for diol dehydratase.

[0106] Any gene encoding the reactivation factor can be employed without particular limitation, as long as such genes have equivalent functions. Examples of the reactivation factor for glycerol dehydratase include those disclosed in WO 98/21341; Daniel et al., J. Bacteriol., 177, 2151, 1995; Toraya and Mori, J. Biol. Chem., 274, 3372(1999); and Tobimatsu et al., J. Bacteriol. 181, 4110, 1999.

[0107] Genes each encoding a subunit of the reactivation factor for glycerol dehydratase or the reactivation factor for diol dehydratase include those existing in a group of genes referred to as gdh regulons and pdu operons possessed by a group of bacteria that can assimilate glycerol under anaerobic conditions, in general. Examples thereof include gdrA, gdrB, pduG, pduH, ddrA, ddrB, dhaF, dhaG, orfZ, and orfY.

[0108] Known genes each encoding a subunit of the reactivation factor for glycerol dehydratase or the reactivation factor for diol dehydratase can be employed. Examples thereof include genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria. In the present invention, the genes each encoding a subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase derived from bacteria of the genus Lactobacillus are preferable, the genes each encoding a subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase derived from Lactobacillus reuteri are more preferable, and the genes each encoding a subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase derived from the Lactobacillus reuteri JCM1112 strain and the Lactobacillus reuteri ATCC 53608 strain are further preferable.

[0109] Preferably, a transformant comprising genes each encoding 3 types of subunits of glycerol dehydratase comprises at least genes each encoding 2 types of subunits of the reactivation factor for glycerol dehydratase and a transformant comprising genes each encoding 3 types of subunits of diol dehydratase comprises at least genes each encoding 2 types of subunits of the reactivation factor for diol dehydratase.

[0110] SEQ ID NOs: 19 and 21 show the amino acid sequences of the large subunit of the reactivation factor for glycerol dehydratase derived from Lactobacillus reuteri. SEQ ID NOs: 23 and 25 show the amino acid sequences of the small subunit thereof. SEQ ID NOs: 20 and 22 show the nucleotide sequences of the genes encoding the large subunit of glycerol dehydratase derived from Lactobacillus reuteri. SEQ ID NOs: 24 and 26 show the nucleotide sequences of the gene encoding the small subunit thereof.

[0111] As long as a protein comprising each such amino acid sequence has the activity of the reactivation factor for glycerol dehydratase when expressed with another subunit, an amino acid sequence may include mutations such as deletion, substitution, or addition of one or several amino acid residues.

[0112] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire DNA comprising the nucleotide sequence as shown in each SEQ ID NO and that encodes a protein having the activity of the reactivation factor for glycerol dehydratase when expressed with another subunit.

[0113] The genes each encoding a subunit may be introduced into the same or different vectors to carry out transformation, as long as such genes are expressed in the same host. It is preferable that three types of subunits be derived from the same species or strain.

[0114] An amino acid sequence derived from the amino acid sequence as shown in a given SEQ ID NO by deletion, substitution, addition of one or several amino acid residues may involve deletion, addition, or substitution of 1, preferably 10 to 20, more preferably 5 to 10, and further preferably 2 or 3 amino acid residues in the amino acid sequence as shown in a given SEQ ID NO.

[0115] Under stringent conditions, a specific hybrid is formed and a nonspecific hybrid is not formed. That is, DNA having high homology (homology of 90% or higher, and preferably 95% or higher) to a given gene hybridizes under such conditions. More specifically, such conditions can be realized by conducting hybridization in the presence of 0.5 to 1 M NaCl at 42.degree. C. to 68.degree. C., in the presence of 50% formamide at 42.degree. C., or in an aqueous solution at 65.degree. C. to 68.degree. C., and then washing the filter using a 0.1- to 2-fold saline sodium citrate (SSC) solution at a temperature between room temperature and 68.degree. C.

[0116] The term "part of the sequence" refers to a nucleotide sequence of DNA comprising part of a nucleotide sequence of a given gene, which has a sufficient nucleotide sequence length to conduct hybridization under stringent conditions. For example, such sequence comprises at least 50, preferably at least 100, and more preferably at least 200 nucleotides.

[0117] Mutation can be introduced into a gene in accordance with conventional techniques such as the Kunkel method or the Gapped duplex method, or via techniques in accordance therewith, with the use of a mutagenesis kit utilizing site-specific mutagenesis (e.g., Mutan-K (TAKARA) or Mutan-G (TAKARA)) or the LA PCR in vitro Mutagenesis Series Kit (TAKARA). After the nucleotide sequence has been determined by the above technique, the gene of the present invention can be obtained via chemical synthesis, PCR using chromosome DNA as a template, or hybridization involving the use of a DNA fragment containing such nucleotide sequence as a probe.

[0118] In the present invention, the term "aldehyde dehydrogenase" is used in the general sense with which it is used in the art. Specifically, it refers to a protein having enzyme activity of oxidizing aldehyde and generating carboxylic acid or acyl group.

[0119] Known genes encoding aldehyde dehydrogenase can be employed. For example, genes derived from bacteria of the genera Alcaligenes, Aspergillus, Bacillus, Candida, Chromobacterium, Clostridium, Corynebacterium, Escherichia, Lactobacillus, Lactococcus, OceanoBacillus, Pichia, Pseudomonas, Rhizobium, Rhodobacter, Rhodococcus, Saccharomyces, Salmonella, Sulfolobus, and Thermotoga can be used.

[0120] Transformants can be obtained by ligating the 4 aforementioned types of genes or parts thereof to an adequate vector and introducing the resulting recombinant vector into a host so as to allow the gene of the present invention to express therein. The term "part" refers to a portion of a given gene that can express a protein encoded by such gene when introduced into a host.

[0121] A technique of obtaining a gene of interest from a bacteria genome is known in the field of molecular biology. When the gene sequence is known, for example, an adequate genome library is prepared by restriction endonuclease digestion, and the gene of interest can be screened for with the use of a probe complementary to the gene sequence of interest. Upon isolation of the sequence, DNA thereof may be amplified via a standard amplification technique such as polymerase chain reaction (PCR, U.S. Pat. No. 4,683,202) to obtain DNA in an adequate amount for transformation.

[0122] The genes each encoding a subunit of glycerol dehydratase and/or diol dehydratase, the 1,3-propanediol oxidoreductase gene, the propanol dehydrogenase gene, the genes each encoding a subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase, and the aldehyde dehydrogenase genes may be separately introduced into a plurality of vectors to carry out transformation. Alternatively, several types of genes may be introduced into a single vector to carry out transformation.

[0123] Vectors for introducing genes are not particularly limited, as long as such vectors can replicate the genes of interest in host cells. Examples thereof include plasmid DNA, phage DNA, and cosmid DNA. Examples of plasmid DNA include pBR322, pSC101, pUC18, pUC19, pUC118, pUC119, pACYC117, pBluescript II SK(+), pETDuet-1, and pACYCDuet-1. Examples of phage DNA include .lamda.gt10, Charon 4A, EMBL-, M13mp18,and M13mp19.

[0124] Any hosts can be used without particular limitation, as long as the genes of interest can be expressed therein. Examples of such hosts include bacteria of the genus Ralstonia such as Ralstonia eutropha, bacteria of the genus Pseudomonas such as Pseudomonas putida, bacteria of the genus Bacillus such as Bacillus subtilis, bacteria of the genus Escherichia such as E. coli, yeast of the genus Saccharomyces such as Saccharomyces cerevisiae, yeast of the genus Candida such as Candida maltosa, animal cells such as COS cells, CHO cells, mouse L cells, rat GH3 cells, and human FL cells, and insect cells such as SF9 cells.

[0125] It is preferable to use a host cell, wherein glycerol dehydrogenase is not expressed; i.e., a cell that does not contain the glycerol dehydrogenase gene or a cell from which the glycerol dehydrogenase gene is knocked out. Use of such cell can block the pathway whereby glycerol is oxidized and converted into dihydroxyacetone. Thus, 1,3-propanediol and 3-hydroxypropionic acid can be produced with higher yield.

[0126] The term "cell from which the glycerol dehydrogenase gene is knocked out" refers to a cell wherein the glycerol dehydrogenase gene has been disrupted and thus cannot be expressed. Specifically, such cell is prepared by disrupting the glycerol dehydrogenase gene in the cell by a method wherein the glycerol dehydrogenase gene in the cell is designated as the target gene and a vector that induces homologous recombination (i.e., a targeting vector) at any position in such target gene is used to disrupt the target gene (i.e., the gene targeting method), a method wherein a trap vector (i.e., a reporter gene not comprising any promoter) is inserted into any position in the target gene to disrupt and deactivate the target gene (i.e., the gene trap method), or combinations of such common techniques known in the art, which are often employed when producing knockout cells or transgenic animals (including knockout animals). The positions at which homologous substitution is induced to take place or at which a trap vector is to be inserted are not particularly limited, as long as mutation at such position can result in elimination of the glycerol dehydrogenase gene expression. Preferably, a transcriptional control region, and more preferably the second exon, is substituted. Examples of other methods of knocking out the glycerol dehydrogenase gene include a method wherein a vector expressing antisense cDNA of the glycerol dehydrogenase gene is introduced into cells and a method wherein a vector expressing double-strand RNA of the glycerol dehydrogenase gene is introduced into cells. Examples of such vectors include virus and plasmid vectors. Such vectors can be prepared in accordance with conventional genetic engineering techniques, such as the method described in fundamental textbooks such as Molecular cloning 2nd Ed., Cold Spring Harbor Laboratory Press, 1989. A commercialized vector may be cleaved with any restriction enzyme, and a gene of interest or the like may be incorporated therein to prepare a semisynthetic vector.

[0127] Whether or not the glycerol dehydrogenase gene is knocked out can be determined in the following manner. That is, the cells into which the vector has been introduced are subjected to Southern blotting to confirm that homologous recombination has adequately occurred. Alternatively, a drug resistant gene that is not present in a host cell is introduced into a targeting vector and a drug resistant cell is selected. It can also be determined in the following manner: after the introduction of disruption, PCR is carried out using the genome of the selected cell, bacteria, bacterial culture solution, or the like as a template and using the forward and reverse primers of the glycerol dehydrogenase gene to be disrupted; and confirm amplification of the DNA fragment to be obtained by combination of the glycerol dehydrogenase and the disruption introducing site. The resulting DNA fragment may be subjected to cloning for sequence analysis. Knock out can also be determined by confirming that dihydroxyacetone is not generated.

[0128] When bacterial host cells such as E. coli are used, it is preferable that a recombinant vector be capable of autonomous replication in such host cells and that a recombinant vector comprise a promoter, target DNA, and a terminator sequence. Expression vectors are replicated and maintained in a wide variety of host cells. Examples thereof include pLA2917 (ATCC 37355) originating from the RK2 replication origin and pJRD215 (ATCC 37533) originating from the RSF1010 replication origin.

[0129] Any promoter can be employed as long as it can express a gene of interest in a host cell. Examples thereof include E. coli or phage-derived promoters, such as trp promoter, lac promoter, PL promoter, PR promoter, and T7 promoter. A recombinant vector may be introduced into bacteria by any method without particular limitation. Examples of such methods include a method involving the use of calcium ions (Current Protocols in Molecular Biology, 1, 181, 1994) or electroporation.

[0130] When yeast host cells are used, YEpl3 or YCp50 expression vectors can be used, for example. Examples of promoters include gal 1 promoter, gal 10 promoter, heat shock protein promoter, and GAP promoter. A recombinant vector may be introduced into a yeast cell by any method without particular limitation. Examples of such methods include electroporation, spheroplast, (Proc. Natl. Acad. Sci. USA, 84, 192, 9-1933, 1978), and the lithium acetate method (J. Bacteriol., 153, 163-168, 1983).

[0131] When animal host cells are used, pcDNAI or pcDNAI/Amp (Invitrogen) expression vectors may be used, for example. Examples of promoters include SRa promoter, SV40 promoter, and CMV promoter. A recombinant vector may be introduced into animal cells by any method without particular limitation. Examples of such methods include electroporation, the calcium phosphate method, and lipofection.

[0132] Techniques for isolating genes and preparing transformants are described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Second Edition, 1989, Cold Spring Harbor Laboratory Press.

[0133] The second aspect of the present invention relates to knockout bacteria, which is obtained by knocking out the gene encoding glycerol dehydrogenase from bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, or Propionibacterium. In the present invention, the bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, and Propionibacterium are not particularly limited, as long as they comprise the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding propionaldehyde dehydrogenase; the gene encoding phosphotransacylase; the gene encoding propionate kinase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase.

[0134] In the second aspect of the present invention, bacteria having a system of coenzyme B 12 synthesis are preferable. Examples thereof include bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Brucella, Fusobacterium, and Propionibacterium.

[0135] Examples of bacteria of the genus Lactobacillus include Lactobacillus reuteri, Lactobacillus brevis, Lactobacillus collinoides, Lactobacillus hilgardii, Lactobacillus diolivorans, Lactobacillus buchneri, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus johnsonii, and Lactobacillus yamanashiensis.

[0136] Examples of bacteria of the genus Salmonella include Salmonella enterica, Salmonella enteritidis, Salmonella typhi, and Salmonella typhimurium. Examples of bacteria of the genus Klebsiella include Klebsiella aerogenes, Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella atlantae, Klebsiella edwardsii, Klebsiella mobilis, Klebsiella ozaenae, Klebsiella planticola, Klebsiella rhinoscleromatis, Klebsiella rubiacearum, and Klebsiella terrigena. Examples of bacteria of the genus Listeria include Listeria denitrificans, Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria murrayi, Listeria seeligeri, and Listeria welshimeri. Examples of bacteria of the genus Clostridium include Clostridium acetobutylicum, Clostridium butyricum, Clostridium pasteurianum, Clostridium paraperfringens, Clostridium perfringens, Clostridium glycolicum, and Clostridium difficile. Examples of bacteria of the genus Escherichia include Escherichia blattae, Escherichia hermannii, Escherichia vulneris, and Escherichia freundii. Examples of bacteria of the genus Enterobacter include Enterobacter aerogenes and Enterobacter agglomerans.

[0137] Examples of bacteria of the genus Caloramator include Caloramator coolhaasii, Caloramator fervidus, Caloramator indicus, Caloramator proteoclasticus, Caloramator uzoniensis, and Caloramator viterbiensis. An example of bacteria of the genus Acetobacterium is Acetobacterium sp., an example of bacteria of the genus Brucella is Brucella melitensis, an example of bacteria of the genus Flavobacterium is Flavobacterium sp., an example of bacteria of the genus Fusobacterium is Fusobacterium nucleatum, and an example of bacteria of the genus Citrobacter is Citrobacterfteundii.

[0138] Examples of bacteria of the genus Propionibacterium include Propionibacterium acidipropionici, Propionibacterium acnes, Propionibacterium australiense, Propionibacterium avidum, Propionibacterium cyclohexanicum, Propionibacterium granulosum, Propionibacterium jensenii, Propionibacterium microaephilum, Propionibacterium propionicum, Propionibacterium thoenii, and Propionibacterium freudenreichii.

[0139] In the second aspect of the present invention, bacteria of the genus Lactobacillus are preferably used, Lactobacillus reuteri is more preferably used and the Lactobacillus reuteri JCM1112 strain is particularly preferably used. Also, bacteria of the genus Klebsiella are preferably used, Klebsiella pneumoniae and Klebsiella oxytoca are more preferably used and the Klebsiella pneumoniae ATCC 25955 strain and the Klebsiella oxytoca ATCC 8724 strain are particularly preferably used.

[0140] Bacteria that are used in the second aspect of the present invention are knockout bacteria of the aforementioned bacteria, from which the gene encoding glycerol dehydrogenase is knocked out. Knocking out of such gene can block the pathway whereby glycerol is oxidized and converted into dihydroxyacetone. Thus, 1,3-propanediol and/or 3-hydroxypropionic acid can be produced with higher yields.

[0141] The gene encoding glycerol dehydrogenase being knocked out means that the glycerol dehydrogenase gene is disrupted and thus cannot be expressed. The knockout bacteria according to this aspect are as described with respect to the first aspect of the present invention.

[0142] In the second aspect of the present invention, bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, and Propionibacterium each preferably comprise the pdu operon and the gene encoding phosphotransacylase, and the gene encoding glycerol dehydrogenase are preferably knocked out.

[0143] In addition to bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Listeria, Clostridium, Escherichia, Enterobacter, Caloramator, Acetobacterium, Brucella, Flavobacterium, Fusobacterium, Citrobacter, and Propionibacterium, bacteria comprising the pdu operon and the gene encoding phosphotransacylase, from which the gene encoding glycerol dehydrogenase is knocked out, are also within the scope of this aspect.

[0144] The pdu operon comprises a gene encoding a protein of the polyhedral body and has function of retaining aldehyde derived from 1,2-diols such as glycerin for a given period of time in such polyhedral body, catalyzing reactions to convert aldehyde into acid or alcohol in the polyhedral body, on the membrane of polyhedral body, or in the vicinity thereof, and reducing direct adverse effects of aldehyde on cells.

[0145] Accordingly, microorganisms comprising pdu operons form polyhedral bodies in the cells, incorporate diols in such polyhedral bodies, and retain a given amount of aldehyde resulting from dehydration to prevent adverse effects on cell growth. Thus, aldehyde oxidation or reduction is considered to take place in the polyhedral bodies, on the membranes of polyhedral bodies, or in the vicinity thereof. The bacteria of the present invention preferably comprise the open reading frame (ORF) encoding the protein for the formation of polyhedral body and other ORFs contained in the pdu operon as well as in the operons that are directly involved in the reactions.

[0146] FIG. 1 shows the structure of the pdu operon, and SEQ ID NO: 53 shows the nucleotide sequence of the pdu operon. Functions of each ORF and their nucleotide sequences derived from the Lactobacillus reuteri JCM1112 strain are shown below. It is deduced that orf1 to orf4 are not related to the pdu operon. Also, pduObis is considered to have no relationship with the reactions according to the present invention. TABLE-US-00001 pduF Accelerator for glycerol ingestion (SEQ ID NO: 54) orf1 Ethanolamine utilization EutJ (SEQ ID NO: 55) pocR Transcription regulator (SEQ ID NO: 56) pduAB Polyhedral body structural protein (SEQ ID NOs: 57 and 58) pduCDE Diol dehydratase (SEQ ID NO: 2, 6, 10) pduGH Reactivation factor for diol dehydratase (SEQ ID NOs: 20 and 24) pduJK Polyhedral body structural protein(SEQ ID NOs: 60 and 59) pduLM Unknown (SEQ ID NOs: 61 and 62) pduN Polyhedral body structural protein (SEQ ID NO: 63) pduOObis Adenosyltransferase (SEQ ID NOs: 64 and 65) pduP Propionaldehyde dehydrogenase (SEQ ID NO: 42) pduQ Propanol dehydrogenase (SEQ ID NO: 14) pduW Propionate kinase (SEQ ID NO: 44) pduU Polyhedral body structural protein (SEQ ID NO: 66) orf2 Tyrosine phosphatase (SEQ ID NO: 67) orf3 Phosphoglycerate mutase (SEQ ID NO: 68) orf4 Cadmium resistance (transport protein) (SEQ ID NO: 69) pduV Unknown (SEQ ID NO: 70)

[0147] The present inventors discovered that knocking out of the gene encoding glycerol dehydrogenase from bacteria of the genus Lactobacillus comprising the pdu operon results in the production of 1,3-propanediol and 3-hydroxypropionic acid from glycerol, based on the mechanism shown in FIG. 2.

[0148] In the mechanism shown in FIG. 2, diol dehydratase and the reactivation factor for diol dehydratase can be substituted with glycerol dehydratase and the reactivation factor for glycerol dehydratase, and propanol dehydrogenase can be substituted with 1,3-propanediol oxidoreductase in view of enzyme activities, and similar reactions take place.

[0149] Based on such finding, the third aspect of the present invention relates to transformants comprising the gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding propionaldehyde dehydrogenase, the gene encoding phosphotransacylase; the gene encoding propionate kinase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase but not comprising any gene encoding glycerol dehydrogenase. The present inventors also discovered that 1,3-propanediol and 3-hydroxypropionic acid could be produced by culturing the transformants according to the third aspect of the present invention in the presence of glycerol.

[0150] The transformant according to the third aspect of the present invention comprises a gene encoding a protein having enzyme activity of catalyzing the reaction whereby glycerol is dehydrated and converted into 3-hydroxypropionaldehyde and water. Examples of such protein include glycerol dehydratase and diol dehydratase as mentioned above. The transformant according to the third aspect includes a transformant comprising genes each encoding 3 types of subunits of glycerol dehydratase, a transformant comprising genes each encoding 3 types of subunits of diol dehydratase, and a transformant comprising genes each encoding 3 types of subunits of glycerol dehydratase and genes each encoding 3 types of subunits of diol dehydratase.

[0151] The genes each encoding a subunit of glycerol dehydratase or diol dehydratase and the amino acid sequences thereof are as described with respect to the first aspect.

[0152] The genes each encoding a subunit may be introduced into the same or different vectors to carry out transformation, as long as such genes are expressed in the same host. It is preferable that three types of subunits be derived from the same species or strain.

[0153] The transformant according to the third aspect comprises a gene encoding a protein having enzyme activity of catalyzing a reaction whereby 3-hydroxypropionaldehyde is reduced and converted into propanediol. Examples of genes encoding such proteins include the genes encoding 1,3-propanediol oxidoreductase and the genes encoding propanol dehydrogenase.

[0154] The genes encoding propanol dehydrogenase, the genes encoding 1,3-propanediol oxidoreductase, and the amino acid sequences thereof are as described with respect to the first aspect.

[0155] The transformant according to the third aspect comprises a gene encoding a protein that replaces coenzyme B12 at the reaction center of glycerol dehydratase or diol dehydratase, which had been deactivated via catalysis of conversion of glycerol into 3-hydroxypropionaldehyde and water, and regains its activity. Examples of such proteins include the reactivation factor for glycerol dehydratase and the reactivation factor for diol dehydratase. The reactivation factor for glycerol dehydratase and the reactivation factor for diol dehydratase are as described with respect to the first embodiment. The transformant according to the third aspect includes a transformant comprising genes each encoding 2 types of subunits of the reactivation factor for glycerol dehydratase, a transformant comprising genes each encoding 2 types of subunits of the reactivation factor for diol dehydratase, and a transformant comprising genes each encoding 2 types of subunits of the reactivation factor for glycerol dehydratase and genes each encoding 2 types of subunits of the reactivation factor for diol dehydratase.

[0156] The genes each encoding a subunit of the reactivation factor for glycerol dehydratase or the reactivation factor for diol dehydratase and the amino acid sequences thereof are as described with respect to the first embodiment.

[0157] Preferably, a transformant comprising genes each encoding 3 types of subunits of glycerol dehydratase comprises at least genes each encoding 2 types of subunits of the reactivation factor for glycerol dehydratase and a transformant comprising genes each encoding 3 types of subunits of diol dehydratase comprises at least genes each encoding 2 types of subunits of the reactivation factor for the diol dehydratase.

[0158] The transformant according to the third aspect comprises a gene encoding a protein having enzyme activity of catalyzing the reaction whereby CoA is added to propionaldehyde to generate propionyl-CoA. An example of genes encoding such proteins is the genes encoding propionaldehyde dehydrogenase. Aldehyde dehydrogenase includes propionaldehyde dehydrogenase.

[0159] Known genes encoding propionaldehyde dehydrogenase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria can be employed. In the present invention, the propionaldehyde dehydrogenase gene derived from bacteria of the genus Lactobacillus is preferable, the propionaldehyde dehydrogenase gene derived from Lactobacillus reuteri is more preferable, and the propionaldehyde dehydrogenase gene derived from the Lactobacillus reuteri JCM 1112 strain is further preferable.

[0160] SEQ ID NO: 41 shows the amino acid sequence of propionaldehyde dehydrogenase derived from Lactobacillus reuteri, and SEQ ID NO: 42 shows the nucleotide sequence of the propionaldehyde dehydrogenase gene derived from Lactobacillus reuteri. As long as such protein having a amino acid sequence has propionaldehyde dehydrogenase activity, the amino acid sequence as shown in SEQ ID NO: 41 may include mutations such as deletion, substitution, or addition of one or several amino acid residues.

[0161] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire nucleotide sequence of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 42 and that encodes a protein having propionaldehyde dehydrogenase activity.

[0162] The transformant according to the third aspect comprises a gene encoding a protein having enzyme activity of catalyzing the reaction whereby CoA is removed from propionyl-CoA and phosphoric acid is added to generate propionyl phosphate. An example of a gene encoding such protein is the gene encoding phosphotransacylase.

[0163] Known genes encoding phosphotransacylase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria can be employed. In the present invention, the phosphotransacylase gene derived from bacteria of the genus Lactobacillus is preferable, the phosphotransacylase gene derived from Lactobacillus reuteri is more preferable, and the phosphotransacylase gene derived from the Lactobacillus reuteri JCM1112 strain is further preferable.

[0164] The transformant according to the third aspect comprises a gene encoding a protein having enzyme activity of catalyzing the reaction whereby phosphoric acid is removed from propionyl phosphate and phosphoric acid is added to ADP to generate ATP and propionic acid simultaneously. An example of gene encoding such protein is the gene encoding propionate kinase.

[0165] By a gene having such enzyme activity, ATP is generated simultaneously with the occurrence of the reaction whereby 1,3-propanediol and 3-hydroxypropionic acid are generated, transformants are effectively proliferated, and culture can be effectively carried out.

[0166] Known genes encoding propionate kinase can be employed. For example, genes derived from bacteria of the genera Lactobacillus, Citrobacter, Clostridium, Klebsiella, Enterobacter, Caloramator, Salmonella, and Listeria can be employed. In the present invention, the propionate kinase gene derived from bacteria of the genus Lactobacillus is preferable, the propionate kinase gene derived from Lactobacillus reuteri is more preferable, and the propionate kinase gene derived from the Lactobacillus reuteri JCM1112 strain is further preferable.

[0167] SEQ ID NO: 43 shows the amino acid sequence of propionate kinase derived from Lactobacillus reuteri and SEQ ID NO: 44 shows the nucleotide sequence of the propionate kinase gene derived from Lactobacillus reuteri. As long as such protein having a amino acid sequence has propionate kinase activity, the amino acid sequence as shown in SEQ ID NO: 43 may include mutations such as deletion, substitution, or addition of one or several amino acid residues.

[0168] The present invention also includes the use of a gene that hybridizes under stringent conditions with a sequence complementary to DNA comprising part of or the entire nucleotide sequence of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 44 and that encodes a protein having propionate kinase activity.

[0169] The transformant according to the third aspect can be obtained by ligating the 4 aforementioned types of genes or parts thereof to an adequate vector and introducing the resulting recombinant vector into a host so as to allow the expression of the gene of the present invention.

[0170] The gene encoding the large subunit of glycerol dehydratase and/or diol dehydratase, the gene encoding the medium subunit thereof, and the gene encoding the small subunit thereof; the gene encoding the large subunit of the reactivation factor for glycerol dehydratase and/or the reactivation factor for diol dehydratase and the gene encoding the small subunit thereof; the gene encoding propionaldehyde dehydrogenase; the gene encoding phosphotransacylase; the gene encoding propionate kinase; and the gene encoding 1,3-propanediol oxidoreductase and/or the gene encoding propanol dehydrogenase may be separately introduced into a plurality of vectors to carry out transformation. Alternatively, several types of genes may be introduced into a single vector to carry out transformation.

[0171] Vectors for gene introduction are not particularly limited, as long as such vectors can replicate the genes of interest in host cells. Examples thereof include plasmid DNA, phage DNA, and cosmid DNA. Examples of plasmid DNA include pBR322, pSC101, pUC18, pUC19, pUC118, pUC119, pACYC117, pBluescript II SK(+), pETDuet-1, and pACYCDuet-1. Examples of phage DNA include .lamda.gt10, Charon 4A, M13mp18, and M13mp19.

[0172] Any host cells may be employed without particular limitation, as long as the genes of interest can be expressed therein. Examples thereof include bacteria of the genera Ralstonia, Pseudomonas, Bacillus, Escherichia, Propionibacterium, Lactobacillus, Salmonella, Klebsiella, Acetobacterium, Flavobacterium, Citrobacter, Agrobacterium, Anabaena, Bradyrhizobium, Brucella, Chlorobium, Clostridium, Corynebacterium, Fusobacterium, Geobacter, Gloeobacter, Leptospira, Mycobacterium, Mycobacterium, Photorhabdus, Porphyromonas, Prochlorococcus, Rhodobacter, Rhodopseudomonas, Sinorhizobium, Streptomyces, Synechococcus, Thermosynechococcus, and Treponema and archaebacteria of the genera Archaeoglobus, Halobacterium, Mesorhizobium, Methanobacterium, Methanococcus, Methanopyrus, Methanosarcina, Methanosarcina, Pyrobaculum, Sulfolobus, and Thermoplasma. Specific examples thereof include Acetobacterium sp., Citrobacter freundii, Flavobacterium sp., Ralstonia solanacearum, Ralstonia eutropha, Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas denitrificans, Bacillus subtilis, Bacillus megaterium, Escherichia coli, Propionibacterium acidipropionici, Propionibacterium acnes, Propionibacterium australiense, Propionibacterium avidumn, Propionibacterium cyclohexanicum, Propionibacterium granulosum, Propionibacterium jensenii, Propionibacterium microaephilum, Propionibacterium propionicum, Propionibacterium thoenii, Propionibacterium freudenreichii, Agrobacterium tumefaciens, Anabaena sp., Bradyrhizobium japonicum, Brucella melitensis, Brucella suis, Chlorobium tepidum, Clostridium tetani, Clostridium glycolicum, Clostridium difficile, Corynebacterium diphtheriae, Fusobacterium nucleatum, Geobacter sulfurreducens, Gloeobacter violaceus, Leptospira interrogans, Mycobacterium bovis, Mycobacterium tuberculosis, Photorhabdus luminescens, Porphyromonas gingivalis, Prochlorococcus marinus, Rhodobacter capsulatus, Rhodopseudomonas palustris, Sinorhizobium meliloti, Streptomyces avermitilis, Streptomyces coelicolor, Synechococcus sp., Thermosynechococcus elongatus, Treponema denticola, Archaeoglobus fulgidus, Halobacterium sp, Mesorhizobium loti, Methanobacterium Thermoautotrophicum, Methanococcus jannaschii, Methanopyrus kandleri, Methanosarcina acetivorans, Methanosarcina mazei, Pyrobaculum aerophilum, Sulfolobus solfataricus, Sulfolobus tokodaii, Thermoplasma acidophilum, and Thermoplasma volcanium.

[0173] Yeast of the genus Saccharomyces, such as Saccharomyces cerevisiae, yeast of the genus Candida, such as Candida maltosa, animal cells such as COS cells, CHO cells, mouse L cells, rat GH3 cells, human FL cells, and insect cells, such as SF9 cells, can be employed.

[0174] In the third aspect of the present invention, use of bacterial hosts having the system of coenzyme B 12 synthesis is preferable. Examples thereof include bacteria of the genera Lactobacillus, Salmonella, Klebsiella, Propionibacterium, Agrobacterium, Anabaena, Bacillus, Bradyrhizobium, Brucella, Chlorobium, Clostridium, Corynebacterium, Fusobacterium, Geobacter, Gloeobacter, Leptospira, Mycobacterium, Mycobacterium, Photorhabdus, Porphyromonas, Prochlorococcus, Pseudomonas, Ralstonia, Rhodobacter, Rhodopseudomonas, Sinorhizobium, Streptomyces, Synechococcus, Thermosynechococcus, and Treponema, archaebacteria of the genera Archaeoglobus, Halobacterium, Mesorhizobium, Methanobacterium, Methanococcus, Methanopyrus, Methanosarcina, Methanosarcina, Pyrobaculum, Sulfolobus, and Thermoplasma. Bacteria of the genus Propionibacterium is preferable, and Propionibacterium freudenreichii is particularly preferable as a host cell. Alternatively, a host cell into which a gene involved in coenzyme B12 synthesis has been introduced via recombination may be used.

[0175] Use of host cells wherein glycerol dehydrogenase is not expressed, i.e., a cell that does not contain the glycerol dehydrogenase gene or a cell from which the glycerol dehydrogenase gene is knocked out, is preferable. Use of such cell can block the pathway whereby glycerol is oxidized and converted into dihydroxyacetone. Thus, 1,3-propanediol and 3-hydroxypropionic acid can be produced with higher yield. The glycerol dehydrogenase gene can be knocked out by the same method as described above.

[0176] An expression vector, a promoter, and a recombinant vector can be introduced in the same manner as described above.

Production of 1,3-propanediol and 3-hydroxypropionic acid

[0177] In the present invention, 1,3-propanediol and 3-hydroxypropionic acid can be produced in the following manner. That is, the bacteria or transformants of the present invention are brought into contact with glycerol, 1,3-propanediol and 3-hydroxypropionic acid are allowed to accumulate in the reaction product (i.e., the cultured bacteria or culture supernatant), and 1,3-propanediol and 3-hydroxypropionic acid are then recovered.

[0178] The condition that "the bacteria or transformants of the present invention be brought into contact with glycerol" refers to culturing of the bacteria or transformants of the present invention in the presence of glycerol or carrying out the reaction with the use of processed culture products of the bacteria or transformants of the present invention. Such processed products include dead bacteria, disrupted bacteria, and crude or purified enzymes prepared from disrupted bacteria or a culture supernatant. Bacteria, processed bacteria, enzymes, or the like, which have been immobilized on carriers via conventional techniques, may also be used.

[0179] The bacteria or transformants of the present invention are cultured in accordance with conventional techniques with the use of glycerol as a carbon source. For example, aerobic culture is carried out using a relatively rich medium, such as 2-fold medium, to increase the quantity of bacteria, the atmosphere is converted into anaerobic conditions, and fermentation is then carried out with the addition of glycerol. The pH level is adjusted using a reagent that does not disturb the growth of host cells and that does not block the separation of acid from a fermentation liquor. A sodium carbonate, ammonia, or a sodium ion source such as sodium chloride may be added. General alkaline reagents, such as an aqueous solution of sodium hydroxide, an aqueous solution of potassium hydroxide, an aqueous solution of sodium hydroxide, an aqueous solution of ammonium hydroxide, an aqueous solution of calcium hydroxide, an aqueous solution of potassium carbonate, an aqueous solution of sodium carbonate, or an aqueous solution of potassium acetate, may be used. During the culture, the pH level is maintained between 5.0 and 8.0, and preferably between 5.5 and 7.5.

[0180] Examples of nitrogen sources include: ammonia; ammonium salts such as ammonium chloride, ammonium sulfate, and ammonium phosphate; peptone; meat extract; yeast extract; and corn steep liquor. Examples of inorganic materials include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, and sodium chloride.

[0181] During the culture, an antibiotic such as kanamycin, ampicillin, or tetracycline may be added to the medium. When a microorganism transformed with an expression vector containing an inducible promoter is cultured, an inducer may be added to the medium. For example, isopropyl-.beta.-D-thiogalactopyranoside (IPTG), indoleacrylic acid (IAA), or the like may be added to the medium.

[0182] Transformants obtained by using animal host cells are cultured in medium, such as RPMI-1640, DMEM, or a medium mixture wherein fetal bovine serum is added thereto. Usually, the culture is carried out in the presence of 5% CO2 at 30.degree. C. to 40.degree. C. for 1 to 30 days. During the culture, an antibiotic such as kanamycin or penicillin may be added to the medium.

[0183] Alternatively, the cultured bacteria or transformants obtained above are centrifuged to collect cells and the collected cells are then suspended in an adequate buffer. The resulting cell suspension is suspended in a glycerol-containing buffer, and the resultant is subjected to a reaction to produce 1,3-propanediol and 3-hydroxypropionic acid. The reaction is carried out, for example, at 10.degree. C. to 80.degree. C., and preferably at 15.degree. C. to 50.degree. C., for 5 minutes to 96 hours, and preferably for 10 minutes to 72 hours, and at pH 5.0 to 8.0, and preferably at pH 5.5 to 7.5.

[0184] 1,3-Propanediol and 3-hydroxypropionic acid are purified from the culture medium by a method known in the art. For example, 1,3-propanediol and 3-hydroxypropionic acid can be obtained from the culture medium by extraction using an organic solvent or by subjecting the reaction mixture to distillation and column chromatography (U.S. Pat. No. 5,356,812). A fermentation liquor is preferably concentrated with the use of a ultrafilter membrane or a zeolite separation membrane that selectively allows permeation of low-molecular weight substances, such as water. Such concentration can reduce the energy required for evaporating water.

[0185] The medium may be subjected to high-pressure liquid chromatography (HPLC) analysis to directly identify 1,3-propanediol and 3-hydroxypropionic acid.

[0186] The present invention is hereafter described in greater detail with reference to the following examples, although the technical scope of the present invention is not limited thereto.

EXAMPLES

Example 1

Acquisition of Glycerol Dehydratase Gene

[0187] Synthetic oligonucleotide primers (forward primer: 5'-ATGAAACGTCAAAAACGATTTGAAGAACTAGAAAAAC-3' (SEQ ID NO: 27); and reverse primer: 5'-TTAGTTATCGCCCTTTAGCTTCTTACGACTTT-3' (SEQ ID NO: 28)) were prepared. PCR was carried out using the genome of the Lactobacillus reuteri JCM1112 strain as a template under the following conditions. TABLE-US-00002 Composition of PCR solution (.mu.l) 10.times. Buffer KODplus 5 2 mM dNTPs 5 25 mM MgSO.sub.4 2 Genome (111 ng/.mu.l) 1 KODplus 1 Water 34 Forward primer (20 pM) 1 Reverse primer (20 pM) 1 Volume of reaction system total 50 .mu.l

Reaction cycle: (94.degree. C. for 2 min.times.1, 94.degree. C. for 15 sec, 45 to 65.degree. C. for 30 sec, and 68.degree. C. for 5 min).times.30 times, 4.degree. C. .infin. (for an indefinite period of time).

[0188] Taq Premix was added to the equivalent amount of a solution containing fragments, the mixture was subjected to 3' A-overhanging at 72.degree. C. for 10 min, and the purified sample was subjected to TA cloning in pCR4-TOPO. The PRISM 310 and 3100 sequencers (ABI) were used. As a result, the nucleotide sequence of the gene encoding the large subunit of glycerol dehydratase as shown in SEQ ID NO: 2, the nucleotide sequence of the gene encoding the medium subunit of glycerol dehydratase as shown in SEQ ID NO: 6, and the nucleotide sequence of the gene encoding the small subunit of glycerol dehydratase as shown in SEQ ID NO: 10 were determined.

[0189] Separately, the forward primer: 5'-ATGAAACGTCAAAAACGTTTTGAAGAACTA-3' (SEQ ID NO: 29) and the reverse primer: 5'-CTAGTTATCACCCTTGAGCTTCTTT-3' (SEQ ID NO: 30) were prepared, and PCR and DNA sequencing were carried out in the same manner as described above using the genome of the Lactobacillus reuteri ATCC 53608 strain as a template. As a result, the nucleotide sequence of the gene encoding the large subunit of glycerol dehydratase as shown in SEQ ID NO: 4, the nucleotide sequence of the gene encoding the medium subunit of glycerol dehydratase as shown in SEQ ID NO: 8, and the nucleotide sequence of the gene encoding the small subunit of glycerol dehydratase as shown in SEQ ID NO: 12 were determined.

Example 2

Acquisition of Propanol Dehydrogenase Gene

[0190] The forward primer: 5'-ATGGGAGGCATAATTCCAATGGAAAAATA-3' (SEQ ID NO: 31) and the reverse primer: 5'-TTAACGAATTATTGCTTCGTAAACCATCTTC-3' (SEQ ID NO: 32) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri JCM1112 as a template. As a result, the nucleotide sequence of the propanol dehydrogenase gene as shown in SEQ ID NO: 14 was determined.

[0191] Separately, the forward primer: 5'-ATGGGAGGCATAATGCCGATG-3' (SEQ ID NO: 33) and the reverse primer: 5'-TTAACGAATTATTGCTTCGTAAATCATCTTC-3' (SEQ ID NO: 34) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri ATCC 53608 strain as a template. As a result, the nucleotide sequence of the propanol dehydrogenase gene as shown in SEQ ID NO: 16 was determined.

Example 3

Acquisition of the 1,3-Propanediol Oxidoreductase Gene

[0192] The forward primer: 5'-ATGAATAGACAATTTGATTTCTTAATGCCAAG-3' (SEQ ID NO: 35) and the reverse primer: 5'-TTAGTAGATGCCATCGTAAGCCTTTT-3' (SEQ ID NO: 36) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri JCM1 112 strain as a template. As a result, the nucleotide sequence of the 1,3-propanediol oxidoreductase gene as shown in SEQ ID NO: 18 was determined.

Example 4

Acquisition of the Gene Encoding the Reactivation Factor for Glycerol Dehydratase

[0193] The forward primer: 5'-ATGGCAACTGAAAAAGTAATTGGTGTTGATATT-3' (SEQ ID NO: 37) and the reverse primer: 5'-TCACCTGTTTGCCATTTCCTTAAAAGGGATT-3' (SEQ ID NO: 38) were prepared, and PCR and DNA sequencing were carried out in the same manner. as in Example 1 using the genome of the Lactobacillus reuteri JCM1112 strain as a template. As a result, the nucleotide sequence of the gene encoding the large subunit of the reactivation factor for glycerol dehydratase as shown in SEQ ID NO: 20 and the nucleotide sequence of the gene encoding the small subunit of the reactivation factor for glycerol dehydratase as shown in SEQ ID NO: 24 were determined.

[0194] Separately, the forward primer: 5'-ATGGCAACTGAAAAAGTAATTGGTGTTG-3' (SEQ ID NO: 39) and the reverse primer: 5'-TCACCTGTTTACCATTTCCTTAAAGG-3' (SEQ ID NO: 40) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri ATCC 53608 strain as a template. As a result, the nucleotide sequence of the gene encoding the large subunit of the reactivation factor for glycerol dehydratase as shown in SEQ ID NO: 22 and the nucleotide sequence of the gene encoding the small subunit of the reactivation factor for glycerol dehydratase as shown in SEQ ID NO: 26 were determined.

Example 5

Acquisition of the propionaldehyde dehydrogenase gene

[0195] The forward primer: 5'-ATGCAGATTAATGATATTGAAAGTGCTGTA-3' (SEQ ID NO: 47) and the reverse primer: 5'-TTAATACCAGTTACGTACTGAGAATCC-3' (SEQ ID NO: 48) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri JCM1 112 strain as a template. As a result, the nucleotide sequence of the gene encoding propionaldehyde dehydrogenase as shown in SEQ ID NO: 42 was determined.

Example 6

Acquisition of the Gene Encoding Propionate Kinase

[0196] The forward primer: 5'-TTGATGTCAAAAAAAATACTTGCAATTAATTCTG-3' (SEQ ID NO: 49) and the reverse primer: 5'-TTATTGCTGAGTTACATTCATTACATCAC-3' (SEQ ID NO: 50) were prepared, and PCR and DNA sequencing were carried out in the same manner as in Example 1 using the genome of the Lactobacillus reuteri JCM 1112 strain as a template. As a result, the nucleotide sequence of the gene encoding propionate kinase as shown in SEQ ID NO: 44 was determined.

Example 7

Production of 1,3-Propanediol and 3-Hydroxypropionic Acid

(1) Preparation of Recombinant Microorganisms

[0197] Plasmid 1 comprising the glycerol dehydratase gene of Lactobacillus introduced into the multicloning site 1 and the 1,3-propanediol oxidoreductase gene introduced into the multicloning site 2 of the pETDuet-1 vector (Novagen) and plasmid 2 comprising the gene encoding the reactivation factor for glycerol dehydratase gene introduced into the multicloning site 1 and the aldehyde dehydrogenase gene (the aldB gene of E. coli; accession number: L40742) introduced into the multicloning site 2 of the pACYCDuet-1 vector (Novagen) were prepared. These plasmids were introduced into BL21 (DE3)-RIL via the Gene Pulser II Electroporation System (Bio-Rad).

(2) Culture of Recombinant Microorganisms

[0198] A 1-.mu.l loopful of the cells was cultured in 5 ml of 2-fold medium containing 100 .mu.g/ml of chloramphenicol and 50 .mu.g/ml of ampicillin (40 g/l of glycerol, 10 g/l of ammonium sulfate, 2 g/l of KH.sub.2PO.sub.4, 6 g/l of K.sub.2HPO.sub.4, 40 g/l of yeast extract, 1 g/l of magnesium sulfate heptahydrate, and 20 drops/i of an antifoaming agent, Adekanol) with shaking at 37.degree. C. under aerobic conditions to the late logarithmic growth phase (OD.sub.660=50). A portion of the culture solution (1 ml) was fractionated, subcultured in 100 ml of 2-fold medium containing 100 .mu.g/ml of chloramphenicol and 50 .mu.g/ml of ampicillin in a 500-ml Sakaguchi flask, and then cultured with shaking at 37.degree. C. under aerobic conditions to the late logarithmic growth phase (OD.sub.660=50).

[0199] IPTG was added to a concentration of 1 mM and the mixture was then allowed to stand for 2 hours. The cells were recovered via centrifugation, the recovered cells were added to 100 ml of 1 M glycerol, a 100-ml bottle in which the gas phase has been substituted with nitrogen was allowed to stand on a bottle roller at 37.degree. C. for 5 hours, and the liquid was then analyzed. As a result, the liquid was found to contain 0.4 M of 1,3-propanediol and 0.4M of 3-hydroxypropionic acid.

Example 8

Production of 1,3-Propanediol and 3-Hydroxypropionic Acid using Knockout Bacteria

(1) Preparation of Recombinant Microorganisms

[0200] The ampicillin resistance gene (5 .mu.g, SEQ ID NO: 73) comprising the sequence 5'-ATGGACCGCATTATTCAATCACCGGGTAAATACATCCAGGGCGCTGATGTGATTAAT CGTTAACC-3' (primer 1: SEQ ID NO: 71) at its N-terminus and the sequence 5'-CTGGGCGAATACCTGAAGCCGCTGGCAGAACGCTGGTTAGTGGTGGGTGACAAAT TTG-3' (primer 2: SEQ ID NO: 72) was mixed with 50 .mu.l of a solution containing E. coli Top 10 electrocompetent cells, and the resulting mixture was transferred to a 0.1 cm cuvette using a Gene-Pulser II (Bio-Rad). The Gene-Pulser II was set at 2.0 kV, 25 mF, and 200 .OMEGA., and electrical pulses were applied. The pulsed mixture was introduced into 250 .mu.l of SOC medium, the mixture was cultured at 37.degree. C. for 1 hour, the culture product was applied onto an agar plate of LB medium containing 50 .mu.g/ml of ampicillin, and ampicillin resistance strains were selected. The ampicillin resistance strains were subjected to colony PCR using the primer 1 and the primer 2, and strains exhibiting amplification of fragments of approximately 2300 bp were designated as the glycerol dehydrogenase gene knockout strains.

[0201] The genome of Klebsiella oxytoca ATCC8724 (1 .mu.g) was processed with 1U of Sau3AI restriction enzyme at 37.degree. C. for 10 minutes, and the processed sample was separated via electrophoresis to recover and purify DNA at around 25 to 35 kb. The purified DNA was ligated to a Charomid 9-20 vector (Nippon Gene), the product was packaged using Lambda INN (Nippon Gene), and the packaged product was caused to infect the E. coli TOPIO competent cells, from which the glycerol dehydrogenase genes were knocked out, for transformation. From among the resulting transformants, probe 1 (SEQ ID NO: 74), which is a conserved region in the ORF of pocR located at the anterior end of any type of pdu operon, and probe 2 (SEQ ID NO: 75), which is a conserved region in the ORF of pduV located at the posterior end of any type of pdu operon, were selected, colony hybridization was carried out, and strains positive for both probes were selected.

(2) Culture of Recombinant Microorganisms

[0202] A 1-.mu.l loopful of the cells was cultured in 5 ml of 2-fold medium containing 100 .mu.g/ml of chloramphenicol and 50 .mu.g/ml of ampicillin (40 g/l of glycerol, 10 g/l of ammonium sulfate, 2 g/l of KH.sub.2PO.sub.4, 6 g/l of K.sub.2HPO.sub.4, 40 g/l of yeast extract, 1 g/l of magnesium sulfate heptahydrate, and 20 drops/l of an antifoaming agent, Adekanol) with shaking at 37.degree. C. under aerobic conditions to the late logarithmic growth phase (OD.sub.660=50). A portion of the culture solution (1 ml) was fractionated, subcultured in 100 ml of 2-fold medium containing 100 pg/ml of chloramphenicol and 50 .mu.g/ml of ampicillin in a 500-ml Sakaguchi flask, and then cultured with shaking at 37.degree. C. under aerobic conditions to the late logarithmic growth phase (OD.sub.660=50).

[0203] IPTG was added to a concentration of 1 mM and the mixture was then allowed to stand for 2 hours. The cells were recovered via centrifugation, the recovered cells were added to 200 ml of IM glycerol, a 100-ml bottle in which the gas-phase has been substituted TABLE-US-00003 Forward primer: 5'-ATGGTTGAAGAATTTGGCTCACC-3' (SEQ ID NO: 51) Reverse primer: 5'-TTACATACGACTATGGTGACAACG-3' (SEQ ID NO: 52)

[0204] with nitrogen was allowed to stand on a bottle roller at 37.degree. C. for 5 hours, and the liquid was then analyzed. As a result, the liquid was found to contain 25 mM of 1,3-propanediol and 21 mM of 3-hydroxypropionic acid.

Example 9

Production of 1,3-Propanediol and 3-Hydroxypropionic Acid using Knockout Bacteria

[0205] In order to disrupt the glycerol dehydrogenase gene, the sequence of the glycerol dehydrogenase gene (SEQ ID NO: 45) was analyzed, the KpnI site at around 830 bp from the initiation codon was selected, and a drug resistance marker was introduced into the restriction enzyme site in order to confirm the introduction of gene disruption.

(1) Acquisition of Glycerol Dehydrogenase of Lactobacillus reuteri JCM1112 Strain and Introduction thereof into pCR4-TOPO Vector

[0206] Based on the genomic information, the following primers for amplifying the glycerol dehydrogenase gene of the Lactobacillus reuteri JCM 1112 strain were prepared.

[0207] As a result of amplification by PCR, a 1112-bp fragment of interest was obtained. The resultant was subjected to 3'A-overhanging, further purification, TA cloning using the Invitrogen TOPO TA cloning kit, and then transformation into the TOPIO cells. A plasmid (pCR4-TOPO/Lb_GDH) was recovered from a transformant having a plasmid comprising the glycerol dehydrogenase gene of the Lactobacillus reuteri JCM 1112 strain introduced into the TA cloning site of the pCR4-TOPO vector.

(2) Preparation of Drug Resistance Marker Gene and Processing thereof with Restriction Enzyme

[0208] The sequence of the pIL253 plasmid, which has been disclosed on the Internet (see http://www. ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=277339), was analyzed, and a DNA fragment as shown in SEQ ID NO: 46 was synthesized so as to comprise the erythromycin resistance gene that can be used as a drug resistance marker in Lactobacillus, a promoter thereof, a terminator region, and KpnI sites at both ends. The solution having the composition shown in Table 1 was used to subject this DNA fragment to processing with a restriction enzyme at 37.degree. C. for 2 hours, and the DNA fragment was purified, recovered, and then designated as a drug resistance marker sequence. TABLE-US-00004 TABLE 1 10.times. Buffer L 10 .mu.l Synthesized DNA sequence (amount of DNA: 1 .mu.g) 30 .mu.l KpnI 10 .mu.l Purified water 50 .mu.l Total 100 .mu.l

(3) Preparation of a Fragment for Introducing Gene Disruption a) Preparation of linearized pCR4-TOPO/Lb_GDH

[0209] The solution having the composition shown in Table 2 was used to perform restriction enzyme treatment at 37.degree. C. for 2 hours and a linearized plasmid of approximately 4986 bp was recovered. TABLE-US-00005 TABLE 2 10.times. Buffer L 10 .mu.l PCR4-TOPO/Lb_GDH 50 .mu.l KpnI 10 .mu.l Purified water 30 .mu.l Total 100 .mu.l

[0210] Subsequently, the solution having the composition shown in Table 3 was used to subject the linearized pCR4-TOPO/Lb_GDH to alkaline phosphatase treatment at 37.degree. C. for 1.5 hours, followed by purification and recovery. The concentration of the recovered linearized pCR4-TOPO/Lb_GDH was 30 ng/.mu.l. TABLE-US-00006 TABLE 3 10.times. BAP buffer 10 .mu.l pCR4-TOPO/Lb_GDH processed with restriction enzyme 50 .mu.l BAP (2.5 U) 10 .mu.l Purified water 30 .mu.l Total 100 .mu.l

b) Preparation of pCR-4/TOPO Vector having a Fragment for Introducing Gene Disruption as Insertion Sequence

[0211] The linearized plasmid prepared in a) was ligated to the drug resistance marker sequence prepared in 2), and the ligation product was transformed into the E. coli TOP 10 cells. A pCR4-TOPO plasmid (hakai/pCR4-TOPO) having a fragment for introducing gene disruption as an insertion sequence was selected and then recovered.

c) Preparation of a Fragment for Introducing Gene Disruption

[0212] PCR was carried out using the hakai/pCR4-TOPO prepared in b) as a template and the primers used in 1), TABLE-US-00007 Forward primer: 5'-ATGGTTGAAGAATTTGGCTCACC-3' (SEQ ID NO: 51) Reverse primer: 5'-TTACATACGACTATGGTGACAACG-3' (SEQ ID NO: 52)

and a target fragment of 2144 bp was amplified.

[0213] A large portion of the resulting fragment was purified, the resultant was concentrated to an average concentration of 5 .mu.g/.mu.l, and the resultant was used in the experiment for introducing gene disruption.

(4) Introduction of Gene Disruption

a) Preparation of Competent Cells

[0214] Competent cells were prepared in the following manner. [0215] 1. MRS media (10 ml.times.5) each were inoculated with 100 ml of L. reuteri solution that had been cultured overnight, and culture was continued to result in OD.sub.660.apprxeq.0.8. (culture was performed in a test tube, and anaerobic culture was performed in a gas-pack system for about 5 to 5.5 hours). [0216] 2. Five tubes of culture solution were transferred to 50-ml falcon tubes, and cells were collected, followed by washing three times with 30 to 40 ml of sterile distilled water at room temperature. [0217] 3. The cells were suspended in 800 ml of sterile distilled water (room temperature), transferred to a 1.5-ml microtube, and then collected. [0218] 4. The supernatant was discarded, and the remnant was suspended in 250 ml of 30% (wt/vol) PEG1500 (dH.sub.2O). [0219] 5. The solution was fractionated to fractions of 100 ml each and preserved at -80.degree. C. [0220] 6. The product was dissolved immediately before use and then subjected to electroporation. b) Introduction of a Fragment for Introducing Gene Disruption into Competent Cell [0221] 1. The test plasmid (5 to 10 ml; 2 to 3 mg) was added to the competent cells prepared in the above-described manner. [0222] 2. The resulting mixture was transferred to a 0.2-cm cuvette that had been cooled in advance. [0223] 3. The Gene pulser was set at 2.5 kV, 25 mF, and 200 .OMEGA., and electropulses were applied. [0224] 4. Immediately thereafter, MRS broth that had been heated at 37.degree. C. in advance was added to result in a total amount of 1 ml, and the mixture was then incubated at 37.degree. C. for 1.5 to 2 hours. [0225] 5. The incubation product was applied to the MRS agar containing erythromycin (2 mg/ml), and anaerobic culture was performed at 37.degree. C. for 24 to 48 hours (anaerobic culture was performed in a gas-pack system). c) Selection of Disrupted Strain

[0226] The erythromycin resistance strain that had grown as a result of culture in b) above was selected, and the genome thereof was recovered. PCR was carried out using the recovered genome as a template to confirm the presence of the insert. The strain, drug resistance of which and gene introduction into the genome were confirmed by PCR, was designated as a disrupted strain.

(5) Reaction using Disrupted Strain

[0227] To 10 ml of medium comprising common MRS medium and 2% glycerin, 100 .mu.l of a solution containing the disrupted strains that had been cultured overnight was added, and the resultant was cultured at 37.degree. C. for 24 hours under anaerobic conditions. The cells were recovered by centrifugation at 2500.times.g for 10 minutes, the recovered cells were washed two times with 10 ml of 50 mM potassium phosphate buffer (pH 7.5), 10 ml of 50 mM potassium phosphate buffer (pH 7.5) containing 2% glycerin was added thereto, and the reaction was allowed to proceed at 37.degree. C. The reaction results are as shown below. As a control example, nondisrupted Lactobacillus cells were used. The results are shown in Table 4. TABLE-US-00008 TABLE 4 Reaction time (hr) 0 24 48 72 96 120 Reaction results of disrupted strain Glycerol (mM) 200 140 100 50 25 0 1,3-Propanediol 0 29 48 72 85 95 (mM) 3-Hydroxypropionic 0 27 47 70 83 94 acid (mM) Reaction results of wild strain Glycerol (mM) 200 180 181 180 180 180 1,3-Propanediol 0 10 9 10 9 12 (mM) 3-Hydroxypropionic 0 0 0 0 0 0 acid (mM)

[0228] As is apparent from the foregoing description, the present invention can reduce loss in starting glycerol used when producing 1,3-propanediol from glycerol and can produce 1,3-propanediol and 3-hydroxypropionic acid.

Example 10

Confirmation of Phosphotransacylase Activity

[0229] The cell broth at the late logarithmic growth phase (10 ml, the Lactobacillus reuteri JCM1112 strain) was washed two times with 10 ml of 50 mM potassium phosphate buffer (pH 8) and resuspended in 10 ml of 50 mM potassium phosphate buffer (pH 8), followed by disruption of cells via ultrasonication with ice cooling. The product was centrifuged at 20,000.times.g for 30 minutes, and the supernatant was designated as a crude enzyme solution. The crude enzyme solution was adequately diluted, the dilution was added to a buffer comprising acetyl-CoA (pH 7.5), the reaction was allowed to proceed at 37.degree. C., and generation of CoA was investigated. As a result, generation of CoA was confirmed.

[0230] The genome of the Lactobacillus reuteri JCM 1112 strain was analyzed, and ORF that was homologous to phosphotransacylase was observed.

Sequence Listing Free Text

[0231] SEQ ID NOs: 27 to 40 and 46 to 52: Synthetic oligonucleotides Sequence CWU 1

75 1 558 PRT Lactobacillus reuteri 1 Met Lys Arg Gln Lys Arg Phe Glu Glu Leu Glu Lys Arg Pro Ile His 1 5 10 15 Gln Asp Thr Phe Val Lys Glu Trp Pro Glu Glu Gly Phe Val Ala Met 20 25 30 Met Gly Pro Asn Asp Pro Lys Pro Ser Val Lys Val Glu Asn Gly Lys 35 40 45 Ile Val Glu Met Asp Gly Lys Lys Leu Glu Asp Phe Asp Leu Ile Asp 50 55 60 Leu Tyr Ile Ala Lys Tyr Gly Ile Asn Ile Asp Asn Val Glu Lys Val 65 70 75 80 Met Asn Met Asp Ser Thr Lys Ile Ala Arg Met Leu Val Asp Pro Asn 85 90 95 Val Ser Arg Asp Glu Ile Ile Glu Ile Thr Ser Ala Leu Thr Pro Ala 100 105 110 Lys Ala Glu Glu Ile Ile Ser Lys Leu Asp Phe Gly Glu Met Ile Met 115 120 125 Ala Val Lys Lys Met Arg Pro Arg Arg Lys Pro Asp Asn Gln Cys His 130 135 140 Val Thr Asn Thr Val Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala 145 150 155 160 Asp Ala Ala Leu Arg Gly Phe Pro Glu Gln Glu Thr Thr Thr Ala Val 165 170 175 Ala Arg Tyr Ala Pro Phe Asn Ala Ile Ser Ile Leu Ile Gly Ala Gln 180 185 190 Thr Gly Arg Pro Gly Val Leu Thr Gln Cys Ser Val Glu Glu Ala Thr 195 200 205 Glu Leu Gln Leu Gly Met Arg Gly Phe Thr Ala Tyr Ala Glu Thr Ile 210 215 220 Ser Val Tyr Gly Thr Asp Arg Val Phe Thr Asp Gly Asp Asp Thr Pro 225 230 235 240 Trp Ser Lys Gly Phe Leu Ala Ser Cys Tyr Ala Ser Arg Gly Leu Lys 245 250 255 Met Arg Phe Thr Ser Gly Ala Gly Ser Glu Val Leu Met Gly Tyr Pro 260 265 270 Glu Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Leu Leu Thr 275 280 285 Lys Ala Ser Gly Val Gln Gly Leu Gln Asn Gly Ala Val Ser Cys Ile 290 295 300 Glu Ile Pro Gly Ala Val Pro Asn Gly Ile Arg Glu Val Leu Gly Glu 305 310 315 320 Asn Leu Leu Cys Met Met Cys Asp Ile Glu Cys Ala Ser Gly Cys Asp 325 330 335 Gln Ala Tyr Ser His Ser Asp Met Arg Arg Thr Glu Arg Phe Ile Gly 340 345 350 Gln Phe Ile Ala Gly Thr Asp Tyr Ile Asn Ser Gly Tyr Ser Ser Thr 355 360 365 Pro Asn Tyr Asp Asn Thr Phe Ala Gly Ser Asn Thr Asp Ala Met Asp 370 375 380 Tyr Asp Asp Met Tyr Val Met Glu Arg Asp Leu Gly Gln Tyr Tyr Gly 385 390 395 400 Ile His Pro Val Lys Glu Glu Thr Ile Ile Lys Ala Arg Asn Lys Ala 405 410 415 Ala Lys Ala Leu Gln Ala Val Phe Glu Asp Leu Gly Leu Pro Lys Ile 420 425 430 Thr Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala Asn Thr His Asp Asp 435 440 445 Met Pro Lys Arg Asp Met Val Ala Asp Met Lys Ala Ala Gln Asp Met 450 455 460 Met Asp Arg Gly Ile Thr Ala Ile Asp Ile Ile Lys Ala Leu Tyr Asn 465 470 475 480 His Gly Phe Lys Asp Val Ala Glu Ala Ile Leu Asn Leu Gln Lys Gln 485 490 495 Lys Val Val Gly Asp Tyr Leu Gln Thr Ser Ser Ile Phe Asp Lys Asp 500 505 510 Trp Asn Val Thr Ser Ala Val Asn Asp Gly Asn Asp Tyr Gln Gly Pro 515 520 525 Gly Thr Gly Tyr Arg Leu Tyr Glu Asp Lys Glu Glu Trp Asp Arg Ile 530 535 540 Lys Asp Leu Pro Phe Ala Leu Asp Pro Glu His Leu Glu Leu 545 550 555 2 1677 DNA Lactobacillus reuteri 2 atgaaacgtc aaaaacgatt tgaagaacta gaaaaacggc caattcatca agatacattt 60 gttaaagaat ggccagaaga aggtttcgtt gcaatgatgg ggcctaatga ccctaagcct 120 agtgtaaaag ttgaaaatgg caagatcgta gagatggatg gtaaaaagct cgaagatttt 180 gatttgattg acttgtacat tgctaagtat ggaatcaata ttgacaacgt tgaaaaagtt 240 atgaatatgg attctaccaa gattgcacgg atgcttgttg atcctaatgt ttctcgtgat 300 gaaattattg aaattacatc agctttgact cctgctaagg ctgaagagat catcagtaag 360 cttgattttg gtgaaatgat tatggctgtc aagaagatgc gcccacgtcg taagcctgac 420 aaccagtgtc acgttaccaa tactgttgat aacccagttc aaattgctgc tgatgctgct 480 gatgccgctc ttcgtggatt tccagaacaa gaaaccacga cagctgtggc acgttatgca 540 ccattcaatg ctatttcaat tttaattggt gcacaaacag gtcgccctgg tgtattgaca 600 caatgttctg ttgaagaagc tactgaattg caattaggta tgcgtggttt taccgcatat 660 gctgaaacca tttcagttta cggtactgat cgtgtattta ccgatggtga tgatactcca 720 tggtctaaag gcttcttggc atcttgttat gcatcacgtg gtttgaagat gcgatttact 780 tcaggtgccg gttcagaagt tttgatgggt tatccagaag gtaagtcaat gctttacctt 840 gaagcgcgtt gtattttact tactaaggct tcaggtgttc aaggacttca aaatggtgcc 900 gtaagttgta ttgaaattcc tggtgctgtt cctaatggta ttcgtgaagt tctcggtgaa 960 aacttgttat gtatgatgtg tgacatcgaa tgtgcttctg gttgtgacca agcatactca 1020 cactccgata tgcggcggac tgaacggttt attggtcaat ttattgccgg tactgattat 1080 attaactctg gttactcatc aactcctaac tacgataata ccttcgctgg ttcaaacact 1140 gatgctatgg actacgatga tatgtatgtt atggaacgtg acttgggtca atattatggt 1200 attcaccctg ttaaggaaga aaccattatt aaggcacgta ataaggccgc taaagccctt 1260 caagcagtat ttgaagatct tggattacca aagattactg atgaagaggt cgaagcagca 1320 acgtatgcta acacccatga tgacatgcca aagcgggata tggttgcaga tatgaaggct 1380 gctcaagata tgatggatcg tggaattact gctattgata ttatcaaggc attgtacaac 1440 cacggattta aagatgtcgc tgaagcaatt ttgaaccttc aaaaacaaaa agttgttggt 1500 gattaccttc aaacatcttc tatttttgat aaagattgga acgtcacttc tgctgttaac 1560 gacggaaatg attatcaagg accaggtact ggataccgtc tatatgaaga caaggaagaa 1620 tgggatcgga ttaaagactt accattcgcc cttgatccag aacatttgga actgtag 1677 3 558 PRT Lactobacillus reuteri 3 Met Lys Arg Gln Lys Arg Phe Glu Glu Leu Glu Lys Arg Pro Ile His 1 5 10 15 Gln Asp Thr Phe Val Lys Glu Trp Pro Glu Glu Gly Phe Val Ala Met 20 25 30 Met Gly Pro Asn Asp Pro Lys Pro Ser Val Lys Val Glu Asn Gly Lys 35 40 45 Ile Val Glu Met Asp Gly Lys Lys Arg Glu Asp Phe Asp Leu Ile Asp 50 55 60 Leu Tyr Ile Ala Lys Tyr Gly Ile Asn Ile Asp Asn Val Glu Lys Val 65 70 75 80 Met Asn Met Asp Ser Thr Lys Ile Ala Arg Met Leu Val Asp Pro Asn 85 90 95 Val Ser Arg Glu Ser Ile Ile Glu Ile Thr Ser Ala Leu Thr Pro Ala 100 105 110 Lys Ala Glu Glu Ile Ile Ser Lys Leu Asp Phe Gly Glu Met Ile Met 115 120 125 Ala Ile Lys Lys Met Arg Pro Arg Arg Lys Pro Asp Asn Gln Cys His 130 135 140 Val Thr Asn Thr Val Asp Asn Pro Val Gln Ile Ala Ala Asp Ala Ala 145 150 155 160 Asp Ala Ala Leu Arg Gly Phe Pro Glu Gln Glu Thr Thr Thr Ala Val 165 170 175 Ala Arg Tyr Ala Pro Phe Asn Ala Ile Ser Ile Leu Ile Gly Ala Gln 180 185 190 Thr Gly Arg Pro Gly Val Leu Thr Gln Cys Ser Val Glu Glu Ala Thr 195 200 205 Glu Leu Gln Leu Gly Met Arg Gly Phe Thr Ala Tyr Ala Glu Thr Ile 210 215 220 Ser Val Tyr Gly Thr Asp Arg Val Phe Thr Asp Gly Asp Asp Thr Pro 225 230 235 240 Trp Ser Lys Gly Phe Leu Ala Ser Cys Tyr Ala Ser Arg Gly Leu Lys 245 250 255 Met Arg Phe Thr Ser Gly Ala Gly Ser Glu Val Leu Met Gly Tyr Pro 260 265 270 Glu Gly Lys Ser Met Leu Tyr Leu Glu Ala Arg Cys Ile Leu Leu Thr 275 280 285 Lys Ala Ser Gly Val Gln Gly Leu Gln Asn Gly Ala Val Ser Cys Ile 290 295 300 Glu Ile Pro Gly Ala Val Pro Asn Gly Ile Arg Glu Val Leu Gly Glu 305 310 315 320 Asn Leu Leu Cys Met Met Cys Asp Ile Glu Cys Ala Ser Gly Cys Asp 325 330 335 Gln Ala Tyr Ser His Ser Asp Met Arg Arg Thr Glu Arg Phe Ile Gly 340 345 350 Gln Phe Ile Ala Gly Thr Asp Tyr Ile Asn Ser Gly Tyr Ser Ser Thr 355 360 365 Pro Asn Tyr Asp Asn Thr Phe Ala Gly Ser Asn Thr Asp Ala Met Asp 370 375 380 Tyr Asp Asp Met Tyr Val Met Glu Arg Asp Leu Gly Gln Tyr Tyr Gly 385 390 395 400 Ile His Pro Val Gln Glu Glu Thr Ile Ile Lys Ala Arg Asn Lys Ala 405 410 415 Ala Lys Ala Leu Gln Ala Val Phe Glu Asp Leu Gly Leu Pro Lys Ile 420 425 430 Thr Asp Glu Glu Val Glu Ala Ala Thr Tyr Ala Asn Thr His Asp Asp 435 440 445 Met Pro Lys Arg Asp Met Val Ala Asp Met Lys Ala Ala Gln Asp Met 450 455 460 Met Asp Arg Gly Ile Thr Ala Ile Asp Ile Ile Lys Ala Leu Tyr Asn 465 470 475 480 His Gly Phe Lys Asp Val Ala Glu Ala Val Leu Asn Leu Gln Lys Gln 485 490 495 Lys Val Val Gly Asp Tyr Leu Gln Thr Ser Ser Ile Phe Asp Lys Asp 500 505 510 Trp Asn Ile Thr Ser Ala Val Asn Asp Gly Asn Asp Tyr Gln Gly Pro 515 520 525 Gly Thr Gly Tyr Arg Leu Tyr Glu Asp Lys Glu Glu Trp Asp Arg Ile 530 535 540 Lys Asp Leu Pro Phe Ala Leu Asp Pro Glu His Leu Glu Leu 545 550 555 4 1677 DNA Lactobacillus reuteri 4 atgaaacgtc aaaaacgttt tgaagaacta gaaaagcggc caattcatca agatacattt 60 gttaaggaat ggcctgaaga aggtttcgtt gcaatgatgg gtccaaatga cccgaagcca 120 agtgtaaagg ttgaaaacgg taaaattgtc gaaatggatg gcaagaagcg ggaagacttt 180 gacttaattg acctctacat tgctaagtat ggaattaata ttgataacgt tgaaaaagtt 240 atgaatatgg attcaactaa aattgcacgg atgttggttg atccaaatgt ctcacgtgaa 300 tccatcattg aaattacttc tgcactaact ccagcgaaag ccgaagaaat cattagtaag 360 cttgactttg gtgaaatgat tatggctatc aagaagatgc gtccgcgtcg gaagccggat 420 aaccaatgtc acgttaccaa cacggttgat aacccagttc aaattgctgc tgatgctgct 480 gatgctgcgc ttcgtggttt cccagaacaa gaaactacta ctgccgttgc ccgttatgca 540 ccatttaatg ctatttcaat cttaattggt gctcaaacag gtcgtcctgg tgtattaaca 600 caatgttctg ttgaagaagc aaccgaattg caattaggaa tgcgtggctt taccgcttat 660 gctgaaacta tttcagttta tggtactgac cgggtattta ctgatggtga tgatacacca 720 tggtctaaag gattccttgc atcatgttat gcatcgcgtg gtttgaagat gcggtttact 780 tcaggtgctg gttcagaagt tttgatgggt tacccagaag gtaagtcaat gttatatctt 840 gaagcacgtt gtattttact taccaaggct tcaggtgttc aaggacttca aaacggtgcc 900 gtaagttgta ttgaaattcc aggtgctgtt cctaacggta tccgtgaagt tcttggtgaa 960 aacctattat gtatgatgtg tgatattgaa tgtgcttctg gttgtgacca agcatactca 1020 cactcagata tgcggcgtac tgaacggttt attggtcaat ttattgccgg tactgattac 1080 attaattctg gttactcatc aactcctaac tacgataaca cctttgctgg ttcaaacacc 1140 gatgcaatgg actacgatga catgtatgtt atggaacgtg acttaggtca atactatggt 1200 attcacccag ttcaagaaga aacaattatt aaggctcgta acaaggctgc taaggcatta 1260 caagctgtat ttgaagatct tggactacct aagattactg atgaagaagt tgaagctgct 1320 acatatgcta acactcatga tgacatgcca aaacgtgaca tggttgcaga tatgaaagcc 1380 gctcaagata tgatggatcg tggcattact gctattgata ttattaaggc tctttataac 1440 catggattta aggatgttgc tgaagctgta ttgaaccttc aaaagcaaaa ggttgtcggt 1500 gattaccttc aaacttcatc aatctttgac aaggattgga atatcacttc tgccgtaaat 1560 gacgggaatg actaccaagg tccaggtact ggataccgtc tatatgaaga caaggaagaa 1620 tgggatcgaa tcaaagatct tccattcgca cttgatccag aacacttgga actatag 1677 5 236 PRT Lactobacillus reuteri 5 Met Ala Asp Ile Asp Glu Asn Leu Leu Arg Lys Ile Val Lys Glu Val 1 5 10 15 Leu Ser Glu Thr Asn Gln Ile Asp Thr Lys Ile Asp Phe Asp Lys Ser 20 25 30 Asn Asp Ser Thr Ala Thr Ala Thr Gln Glu Val Gln Gln Pro Asn Ser 35 40 45 Lys Ala Val Pro Glu Lys Lys Leu Asp Trp Phe Gln Pro Val Gly Glu 50 55 60 Ala Lys Pro Gly Tyr Ser Lys Asp Glu Val Val Ile Ala Val Gly Pro 65 70 75 80 Ala Phe Ala Thr Val Leu Asp Lys Thr Glu Thr Gly Ile Pro His Lys 85 90 95 Glu Val Leu Arg Gln Val Ile Ala Gly Ile Glu Glu Glu Gly Leu Lys 100 105 110 Ala Arg Val Val Lys Val Tyr Arg Ser Ser Asp Val Ala Phe Cys Ala 115 120 125 Val Gln Gly Asp His Leu Ser Gly Ser Gly Ile Ala Ile Gly Ile Gln 130 135 140 Ser Lys Gly Thr Thr Val Ile His Gln Lys Asp Gln Asp Pro Leu Gly 145 150 155 160 Asn Leu Glu Leu Phe Pro Gln Ala Pro Val Leu Thr Pro Glu Thr Tyr 165 170 175 Arg Ala Ile Gly Lys Asn Ala Ala Met Tyr Ala Lys Gly Glu Ser Pro 180 185 190 Glu Pro Val Pro Ala Lys Asn Asp Gln Leu Ala Arg Ile His Tyr Gln 195 200 205 Ala Ile Ser Ala Ile Met His Ile Arg Glu Thr His Gln Val Val Val 210 215 220 Gly Lys Pro Glu Glu Glu Ile Lys Val Thr Phe Asp 225 230 235 6 711 DNA Lactobacillus reuteri 6 atggctgata ttgatgaaaa cttattacgt aaaatcgtta aagaagtttt aagcgaaact 60 aatcaaatcg atactaagat tgactttgat aaaagtaatg atagtactgc aacagcaact 120 caagaggtgc aacaaccaaa tagtaaagct gttccagaaa agaaacttga ctggttccaa 180 ccagttggag aagcaaaacc tggatattct aaggatgaag ttgtaattgc agtcggtcct 240 gcattcgcaa ctgttcttga taagacagaa actggtattc ctcataaaga agtgcttcgt 300 caagttattg ctggtattga agaagaaggg cttaaggcgc gggtagttaa agtttaccgg 360 agttcagatg tagcattctg tgctgtccaa ggtgatcacc tttctggttc aggaattgct 420 attggtatcc aatcaaaagg gacgacagtt attcaccaaa aggatcaaga ccctcttggt 480 aaccttgagt tattcccaca agcgccagta cttactcccg aaacttatcg tgcaattggt 540 aagaatgccg ctatgtatgc taagggtgaa tctccagaac cagttccagc taaaaacgat 600 caacttgctc gtattcacta tcaagctatt tcagcaatta tgcatattcg tgaaactcac 660 caagttgttg ttggtaagcc tgaagaagaa attaaggtta cgtttgatta a 711 7 236 PRT Lactobacillus reuteri 7 Met Ala Asp Ile Asp Glu Asn Leu Leu Arg Lys Ile Val Lys Glu Val 1 5 10 15 Leu Asn Glu Thr Asn Gln Ile Asp Thr Lys Ile Asn Phe Asp Lys Glu 20 25 30 Asn Asn Ser Thr Ala Thr Ala Thr Glu Glu Val Gln Gln Pro Asn Ser 35 40 45 Lys Ala Val Pro Glu Lys Lys Leu Asp Trp Phe Gln Pro Ile Gly Glu 50 55 60 Ala Lys Pro Gly Tyr Ser Lys Asp Glu Val Val Ile Ala Val Gly Pro 65 70 75 80 Ala Phe Ala Thr Val Leu Asp Lys Thr Glu Thr Gly Ile Pro His Lys 85 90 95 Glu Val Leu Arg Gln Val Ile Ala Gly Ile Glu Glu Glu Gly Leu Lys 100 105 110 Ala Arg Val Val Lys Val Tyr Arg Ser Ser Asp Val Ala Phe Cys Ala 115 120 125 Val Gln Gly Asp His Leu Ser Gly Ser Gly Ile Ala Ile Gly Ile Gln 130 135 140 Ser Lys Gly Thr Thr Val Ile His Gln Lys Asp Gln Asp Pro Leu Gly 145 150 155 160 Asn Leu Glu Leu Phe Pro Gln Ala Pro Val Leu Thr Pro Glu Thr Phe 165 170 175 Arg Ala Ile Gly Lys Asn Ala Ala Met Tyr Ala Lys Gly Glu Ser Pro 180 185 190 Glu Pro Val Pro Ala Lys Asn Asp Gln Leu Ala Arg Ile His Tyr Gln 195 200 205 Ala Ile Ser Ala Ile Met His Ile Arg Glu Thr His Gln Val Val Val 210 215 220 Gly Lys Pro Glu Glu Glu Ile Lys Val Thr Phe Asp 225 230 235 8 711 DNA Lactobacillus reuteri 8 atggctgata tcgatgaaaa tttacttcgt aagatcgtta aagaagtttt aaacgagact 60 aatcaaattg atactaagat caattttgac aaggaaaata atagtaccgc aactgctact 120 gaagaagttc aacaaccaaa cagcaaggca gttcctgaaa agaaacttga ttggttccaa 180 ccaattggcg aagcaaaacc agggtactca aaggatgaag ttgtaatcgc agttggtcct 240 gcctttgcaa cagttctaga taaaacagaa actgggattc ctcataaaga ggtacttcgt 300 caagtaattg ccggaattga agaagaggga cttaaagcac gagtagttaa agtctatcgt 360 tcatcagacg ttgctttctg tgctgttcag ggtgaccact tatctggttc aggaattgca 420 attggaatcc aatctaaggg aacaactgtt attcaccaaa aagaccagga tccattagga 480 aacctagaat tattcccaca agctccggtt cttacaccag aaactttccg ggcaattggt 540 aagaatgcag caatgtacgc taaaggtgaa tctccagaac cagttccagc taagaacgat 600 caacttgctc gtattcacta ccaagctatt tcagcaatta tgcatattcg tgaaactcac 660 caagttgttg ttggaaagcc tgaagaagaa atcaaagtta cgttcgatta a 711 9 172 PRT Lactobacillus reuteri 9 Met Met Ser Glu Val Asp Asp Leu Val Ala Lys Ile Met Ala Gln Met 1 5 10 15 Gly Asn Ser Ser Ser Ala Asn Ser Ser Thr Gly Thr Ser Thr Ala Ser 20 25 30 Thr Ser Lys Glu Met Thr Ala Asp Asp Tyr Pro Leu Tyr Gln Lys

His 35 40 45 Arg Asp Leu Val Lys Thr Pro Lys Gly His Asn Leu Asp Asp Ile Asn 50 55 60 Leu Gln Lys Val Val Asn Asn Gln Val Asp Pro Lys Glu Leu Arg Ile 65 70 75 80 Thr Pro Glu Ala Leu Lys Leu Gln Gly Glu Ile Ala Ala Asn Ala Gly 85 90 95 Arg Pro Ala Ile Gln Lys Asn Leu Gln Arg Ala Ala Glu Leu Thr Arg 100 105 110 Val Pro Asp Glu Arg Val Leu Glu Met Tyr Asp Ala Leu Arg Pro Phe 115 120 125 Arg Ser Thr Lys Gln Glu Leu Leu Asn Ile Ala Lys Glu Leu Arg Asp 130 135 140 Lys Tyr Asp Ala Asn Val Cys Ala Ala Trp Phe Glu Glu Ala Ala Asp 145 150 155 160 Tyr Tyr Glu Ser Arg Lys Lys Leu Lys Gly Asp Asn 165 170 10 519 DNA Lactobacillus reuteri 10 atgatgagtg aagttgatga tttagtagca aagatcatgg ctcagatggg aaacagttca 60 tctgctaata gctctacagg tacttcaact gcaagtacta gtaaggaaat gacagcagat 120 gattacccac tttatcaaaa gcaccgtgat ttagtaaaaa caccaaaagg acacaatctt 180 gatgacatca atttacaaaa agtagtaaat aatcaagttg atcctaagga attacggatt 240 acaccagaag cattgaaact tcaaggtgaa attgcagcta atgctggccg tccagctatt 300 caaaagaatc ttcaacgagc tgcagaatta acacgagtac ctgacgaacg ggttcttgaa 360 atgtatgatg cattgcgtcc tttccgttca actaagcaag aattattgaa cattgcaaag 420 gaattacggg acaagtatga cgctaatgtt tgcgcagcat ggtttgaaga agctgctgat 480 tattatgaaa gtcgtaagaa gctaaagggc gataactaa 519 11 171 PRT Lactobacillus reuteri 11 Met Ser Glu Val Asp Asp Leu Val Ala Lys Ile Met Ala Gln Met Gly 1 5 10 15 Asn Ser Ser Ser Ser Asp Ser Ser Thr Ser Ala Thr Ser Thr Asn Asn 20 25 30 Gly Lys Glu Met Thr Ala Asp Asp Tyr Pro Leu Tyr Gln Lys His Arg 35 40 45 Asp Leu Val Lys Thr Pro Ser Gly Lys Lys Leu Asp Asp Ile Thr Leu 50 55 60 Gln Lys Val Val Asn Asp Gln Val Asp Pro Lys Glu Leu Arg Ile Thr 65 70 75 80 Pro Glu Ala Leu Lys Leu Gln Gly Glu Ile Ala Ala Asn Ala Gly Arg 85 90 95 Pro Ala Ile Gln Lys Asn Leu Gln Arg Ala Ala Glu Leu Thr Arg Val 100 105 110 Pro Asp Glu Arg Val Leu Gln Met Tyr Asp Ala Leu Arg Pro Phe Arg 115 120 125 Ser Thr Lys Gln Glu Leu Leu Asp Ile Ala Asn Glu Leu Arg Asp Lys 130 135 140 Tyr His Ala Glu Val Cys Ala Ala Trp Phe Glu Glu Ala Ala Asn Tyr 145 150 155 160 Tyr Glu Ser Arg Lys Lys Leu Lys Gly Asp Asn 165 170 12 516 DNA Lactobacillus reuteri 12 atgagtgaag ttgatgattt agtagcaaag atcatggcac agatgggaaa tagctcatct 60 tccgatagtt caacaagtgc tacttcaaca aataacggta aggaaatgac agcagatgac 120 tatcctcttt accaaaagca ccgtgattta gtaaagacac catcaggaaa gaaacttgat 180 gatattactt tacaaaaggt tgtaaatgat caagttgatc caaaagaatt acggattact 240 ccagaagcat taaaacttca aggtgagatc gcagcaaacg ctggtcggcc agcaattcaa 300 aagaacttac aacgggcagc tgaattaaca cgtgttccag acgaacgtgt tttgcaaatg 360 tatgatgcat tacggccatt ccgttcaacg aagcaagaat tactagatat tgctaatgaa 420 ctccgtgata aatatcatgc agaagtatgt gcagcttggt ttgaagaagc tgcaaattac 480 tatgaaagtc gaaagaagct caagggtgat aactag 516 13 379 PRT Lactobacillus reuteri 13 Met Gly Gly Ile Ile Pro Met Glu Lys Tyr Ser Met Pro Thr Arg Ile 1 5 10 15 Tyr Ser Gly Thr Asp Ser Leu Lys Glu Leu Glu Thr Leu Asn Asn Glu 20 25 30 Arg Ile Leu Leu Val Cys Asp Ser Phe Leu Pro Gly Ser Asp Thr Leu 35 40 45 Lys Glu Ile Glu Ser His Ile Lys Asp Asn Asn Lys Cys Glu Ile Phe 50 55 60 Ser Asp Val Val Pro Asp Pro Pro Leu Asp Lys Ile Met Glu Gly Val 65 70 75 80 Gln Gln Phe Leu Lys Leu Lys Pro Thr Ile Val Ile Gly Ile Gly Gly 85 90 95 Gly Ser Ala Leu Asp Thr Gly Lys Gly Ile Arg Phe Phe Gly Glu Lys 100 105 110 Leu Gly Lys Cys Lys Ile Asn Glu Tyr Ile Ala Ile Pro Thr Thr Ser 115 120 125 Gly Thr Gly Ser Glu Val Thr Asn Thr Ala Val Ile Ser Asp Thr Lys 130 135 140 Glu His Arg Lys Ile Pro Ile Leu Glu Asp Tyr Leu Thr Pro Asp Cys 145 150 155 160 Ala Leu Leu Asp Pro Lys Leu Val Met Thr Ala Pro Lys Ser Val Thr 165 170 175 Ala Tyr Ser Gly Met Asp Val Leu Thr His Ala Leu Glu Ser Leu Val 180 185 190 Ala Lys Asp Ala Asn Leu Phe Thr Val Ala Leu Ser Glu Glu Ala Ile 195 200 205 Asp Ala Val Ile Lys His Leu Val Glu Cys Tyr Arg His Gly Asp Asn 210 215 220 Val Asp Ala Arg Lys Ile Val His Glu Ala Ser Asn Ile Ala Gly Thr 225 230 235 240 Ala Phe Asn Ile Ala Gly Leu Gly Ile Cys His Ser Ile Ala His Gln 245 250 255 Leu Gly Ala Asn Phe His Val Pro His Gly Leu Ala Asn Thr Met Leu 260 265 270 Leu Pro Tyr Val Ile Ala Tyr Asn Ala Glu His Ser Glu Glu Ala Leu 275 280 285 His Lys Phe Ala Ile Ala Ala Lys Lys Ala Gly Ile Ala Ala Pro Gly 290 295 300 Val Gly Asp Arg Leu Ala Val Lys Arg Leu Ile Ala Lys Ile Arg Glu 305 310 315 320 Met Ala Arg Gln Met Asn Cys Pro Met Thr Leu Gln Ala Phe Gly Val 325 330 335 Asp Pro Ala Lys Ala Glu Glu Leu Ala Asp Thr Val Val Ala Asn Ala 340 345 350 Lys Lys Asp Ala Thr Phe Pro Gly Asn Pro Val Val Pro Ser Asp Asn 355 360 365 Asp Leu Lys Met Val Tyr Glu Ala Ile Ile Arg 370 375 14 1140 DNA Lactobacillus reuteri 14 atgggaggca taattccaat ggaaaaatat agtatgccaa cccggattta ttcgggaaca 60 gatagtttga aagaactaga gacacttaat aatgaacgta ttttattagt ctgtgattct 120 ttcttgcctg gtagtgatac cttaaaagaa attgagagtc acattaagga taataataag 180 tgtgaaattt tctctgatgt tgtccccgat cctccactag ataagattat ggaaggggtt 240 caacaattcc ttaaacttaa accaacaatt gtgattggta tcggtggcgg atcagctttg 300 gatactggta agggaattcg tttctttggt gaaaagttgg gcaagtgcaa gatcaatgaa 360 tatattgcta ttccaacaac gagtggtact ggttcagaag ttacgaatac tgcggttatt 420 tctgatacga aagaacatcg taaaattcct attttggaag attatttgac acctgattgt 480 gctttactag atcctaaact agttatgact gctcctaaga gtgtaactgc atattcagga 540 atggatgttt taacacatgc acttgaatct ttggttgcta aggatgcaaa tttattcaca 600 gttgcattat cagaagaagc aattgatgcc gttattaaac atttagttga gtgttatcgt 660 cacggcgata atgtggatgc tcgtaagatt gttcatgaag catcaaatat tgccggaact 720 gcatttaata ttgctggatt agggatttgc cactcaattg cgcatcaatt gggagctaat 780 ttccacgttc cccatggttt agcaaataca atgctcttgc catatgttat cgcatataat 840 gctgaacata gtgaagaggc attgcataag tttgcaattg ctgctaagaa agctggaatt 900 gctgctcctg gagtaggcga tcgtcttgca gtaaagcgac taattgctaa aattagggaa 960 atggcacgac aaatgaattg tccaatgact cttcaagcat tcggtgttga tcctgctaaa 1020 gctgaagaat tagctgatac tgttgttgca aatgcgaaga aagatgcaac attccctggc 1080 aatccagttg ttccttcaga taatgatctg aagatggttt acgaagcaat aattcgttaa 1140 15 379 PRT Lactobacillus reuteri 15 Met Gly Gly Ile Met Pro Met Glu Lys Phe Ser Met Pro Thr Arg Ile 1 5 10 15 Tyr Ser Gly Thr Asp Ser Leu Lys Glu Leu Glu Thr Leu His Asn Glu 20 25 30 Arg Ile Leu Leu Val Cys Asp Ser Phe Leu Pro Gly Ser Asp Thr Leu 35 40 45 Lys Glu Ile Glu Ser His Ile Asn Asp Ser Asn Lys Cys Glu Ile Phe 50 55 60 Ser Asp Val Val Pro Asp Pro Pro Leu Asp Lys Ile Met Glu Gly Val 65 70 75 80 Gln Gln Phe Leu Lys Leu Lys Pro Thr Ile Val Ile Gly Ile Gly Gly 85 90 95 Gly Ser Ala Met Asp Thr Gly Lys Gly Ile Arg Phe Phe Gly Glu Lys 100 105 110 Leu Gly Lys Cys Lys Ile Asn Glu Tyr Ile Ala Ile Pro Thr Thr Ser 115 120 125 Gly Thr Gly Ser Glu Val Thr Asn Thr Ala Val Ile Ser Asp Thr Lys 130 135 140 Glu His Arg Lys Ile Pro Ile Leu Glu Asp Tyr Leu Thr Pro Asp Cys 145 150 155 160 Ala Leu Leu Asp Pro Lys Leu Val Met Thr Ala Pro Lys Ser Val Thr 165 170 175 Ala Tyr Ser Gly Met Asp Val Leu Thr His Ala Leu Glu Ser Leu Val 180 185 190 Ala Lys Asp Ala Asn Leu Phe Thr Val Ala Leu Ser Glu Glu Ala Ile 195 200 205 Asp Ala Val Thr Lys Tyr Leu Val Glu Cys Tyr Arg His Gly Asp Asn 210 215 220 Val Asp Ala Arg Lys Ile Val His Glu Ala Ser Asn Ile Ala Gly Thr 225 230 235 240 Ala Phe Asn Ile Ala Gly Leu Gly Ile Cys His Ser Ile Ala His Gln 245 250 255 Leu Gly Ala Asn Phe His Val Pro His Gly Leu Ala Asn Thr Met Leu 260 265 270 Leu Pro Tyr Val Val Ala Tyr Asn Ala Glu His Cys Glu Glu Ala Leu 275 280 285 His Lys Phe Ala Ile Ala Ala Lys Lys Ala Gly Ile Ala Ala Pro Gly 290 295 300 Val Gly Asp Arg Leu Ala Val Lys Arg Leu Ile Ala Lys Ile Arg Glu 305 310 315 320 Met Ala Arg Gln Met Asn Cys Pro Met Thr Leu Gln Ala Phe Gly Val 325 330 335 Asp His Ala Lys Ala Glu Ala Ala Ala Asp Thr Val Val Ala Asn Ala 340 345 350 Lys Lys Asp Ala Thr Phe Pro Gly Asn Pro Val Val Pro Ser Asp Asp 355 360 365 Asp Leu Lys Met Ile Tyr Glu Ala Ile Ile Arg 370 375 16 1140 DNA Lactobacillus reuteri 16 atgggaggca taatgccgat ggaaaaattt agtatgccaa cccgaattta ttcgggaaca 60 gatagtttga aggaattaga aacccttcat aatgaacgaa ttttgttagt ttgtgactca 120 ttcttacctg gtagtgacac attaaaggaa attgagagtc atattaacga cagtaataaa 180 tgtgaaattt tctctgatgt tgtccctgat ccaccactag ataaaattat ggaaggggtt 240 caacagttct taaagctgaa accaacaatt gtaattggta tcggtggtgg ttctgcaatg 300 gacaccggta agggaattcg tttcttcggt gaaaagcttg gcaagtgcaa aattaatgaa 360 tatattgcaa ttccaacaac cagcggaacc ggttcagaag ttactaatac tgcggttatt 420 tctgatacta aggaacaccg gaagattccg attcttgaag attacttaac accagattgt 480 gcattgcttg atcctaagtt agtaatgaca gcaccaaaga gtgttactgc ctactcagga 540 atggatgtat taactcatgc tcttgaatca ttggttgcta aggacgctaa tttgtttacc 600 gttgcattat cagaagaagc cattgatgcg gtaactaagt atcttgttga atgttatcgt 660 catggcgata atgtcgatgc acgaaagatc gttcacgaag catcaaatat tgccggaaca 720 gcctttaaca ttgctggact aggtatttgc cactcaattg cccaccaatt aggtgctaac 780 ttccatgttc ctcatggttt agcaaacaca atgttattgc catatgttgt tgcatacaat 840 gctgaacact gtgaagaagc cttacacaag tttgcaattg ccgctaagaa agccggaatt 900 gctgcacctg gcgttggtga ccgtttggct gttaagcggc tgattgcaaa gattcgtgaa 960 atggcacggc aaatgaattg tccaatgact ctccaagcat ttggagttga ccacgcaaaa 1020 gcagaagcag ctgctgatac ggttgttgct aatgcgaaga aggatgcaac attcccaggc 1080 aatccagttg ttccttcaga tgatgatctg aagatgattt acgaagcaat aattcgttaa 1140 17 390 PRT Lactobacillus reuteri 17 Met Asn Arg Gln Phe Asp Phe Leu Met Pro Ser Val Asn Phe Phe Gly 1 5 10 15 Pro Gly Val Ile Ala Lys Ile Gly Asp Arg Ala Lys Met Leu Asn Met 20 25 30 His Lys Pro Leu Ile Val Thr Thr Glu Gly Leu Ser Lys Ile Asp Asn 35 40 45 Gly Pro Val Lys Gln Thr Val Ala Ser Leu Glu Lys Ala Gly Val Asp 50 55 60 Tyr Ala Val Phe Thr Gly Ala Glu Pro Asn Pro Lys Ile Arg Asn Val 65 70 75 80 Gln Ala Gly Lys Lys Met Tyr Gln Asp Glu Asn Cys Asp Ser Ile Ile 85 90 95 Thr Val Gly Gly Gly Ser Ala His Asp Cys Gly Lys Gly Ile Gly Ile 100 105 110 Val Leu Thr Asn Gly Asp Asp Ile Ser Lys Leu Ala Gly Ile Glu Thr 115 120 125 Leu Lys Asn Pro Leu Pro Pro Leu Met Ala Val Asn Thr Thr Ala Gly 130 135 140 Thr Gly Ser Glu Leu Thr Arg His Ala Val Ile Thr Asn Glu Lys Thr 145 150 155 160 His Leu Lys Phe Val Val Val Ser Trp Arg Asn Ile Pro Leu Val Ser 165 170 175 Phe Asn Asp Pro Met Leu Met Leu Asp Ile Pro Lys Asp Ile Thr Ala 180 185 190 Ala Thr Gly Cys Asp Ala Phe Val Gln Ala Ile Glu Pro Tyr Val Ser 195 200 205 Val Asp His Asn Pro Ile Thr Asp Ser Gln Cys Lys Glu Ala Ile Gln 210 215 220 Leu Ile Gln Thr Ala Leu Pro Glu Val Val Ala Asn Gly His Asn Ile 225 230 235 240 Glu Ala Arg Thr Lys Met Val Glu Ala Glu Met Leu Ala Gly Met Ala 245 250 255 Phe Asn Asn Ala Asn Leu Gly Tyr Val His Ala Met Ala His Gln Leu 260 265 270 Gly Gly Gln Tyr Asp Ala Pro His Gly Val Cys Cys Ala Leu Leu Leu 275 280 285 Thr Thr Val Glu Glu Tyr Asn Leu Ile Ala Cys Pro Glu Arg Phe Ala 290 295 300 Glu Leu Ala Lys Val Met Gly Phe Asp Thr Thr Gly Leu Thr Leu Tyr 305 310 315 320 Glu Ala Ala Gln Lys Ser Ile Asp Gly Met Arg Glu Met Cys Arg Leu 325 330 335 Val Gly Ile Pro Ser Ser Ile Lys Glu Ile Gly Ala Lys Pro Glu Asp 340 345 350 Phe Glu Met Met Ala Lys Asn Ala Leu Lys Asp Gly Asn Ala Phe Ser 355 360 365 Asn Pro Arg Lys Gly Thr Val Glu Asp Ile Val Lys Leu Tyr Gln Lys 370 375 380 Ala Tyr Asp Gly Ile Tyr 385 390 18 1173 DNA Lactobacillus reuteri 18 atgaatagac aatttgattt cttaatgcca agtgtgaact tctttggtcc tggtgttatt 60 gctaaaattg gtgatcgtgc aaagatgctc aatatgcaca aaccattgat tgttactact 120 gaaggtttat ccaagattga caatggtcct gtaaagcaaa ccgttgcttc attggaaaag 180 gctggcgttg actatgccgt atttactggc gctgaaccta accctaagat ccggaatgtt 240 caagctggta aaaagatgta ccaagatgaa aactgtgact caattattac tgttggtggg 300 ggttctgctc acgactgtgg taagggtatc ggtattgttt taactaacgg tgatgacatt 360 tccaagcttg ccggaattga aacattgaag aatccacttc caccattgat ggctgttaac 420 actactgccg gaactggttc tgaattaact cgtcacgctg ttattactaa cgaaaagact 480 catttgaagt ttgttgttgt ttcatggcgt aacattccat tggtatcatt caacgatcca 540 atgttgatgc ttgatattcc aaaagacatt accgctgcta ctggttgtga tgcttttgtt 600 caggctattg aaccatacgt ttctgttgac cataacccaa ttactgatag tcaatgtaaa 660 gaagctattc aattaattca aactgcttta ccagaagtag ttgctaatgg tcacaatatt 720 gaagcacgga ctaagatggt tgaagctgaa atgcttgccg gaatggcctt caataatgcc 780 aacttaggct atgttcacgc aatggctcac caactcggtg gtcaatatga tgctcctcat 840 ggtgtttgct gtgccttgct cttgaccact gttgaagaat ataacttaat cgcatgtcca 900 gagcggtttg ctgaattggc taaggtaatg ggctttgaca ctactggtct taccctttac 960 gaagcagcac aaaagtcaat tgacggtatg cgtgaaatgt gccggcttgt tggtattcca 1020 tcatcaatca aggaaattgg tgctaagcca gaagactttg aaatgatggc caagaatgcc 1080 ctcaaggatg gtaatgcctt ctctaaccca cgtaagggta ctgttgaaga tattgtaaag 1140 ctttatcaaa aggcttacga tggcatctac taa 1173 19 616 PRT Lactobacillus reuteri 19 Met Ala Thr Glu Lys Val Ile Gly Val Asp Ile Gly Asn Ser Ser Thr 1 5 10 15 Glu Val Ala Leu Ala Asp Val Ser Asp Ser Gly Gln Val His Phe Ile 20 25 30 Asn Ser Gly Ile Ala Pro Thr Thr Gly Ile Lys Gly Thr Lys Gln Asn 35 40 45 Leu Val Gly Ile Arg Asp Ser Ile Thr Gln Val Leu Asn Lys Ser Asn 50 55 60 Leu Thr Ile Asp Asp Ile Asp Leu Ile Arg Ile Asn Glu Ala Thr Pro 65 70 75 80 Val Ile Gly Asp Val Ala Met Glu Thr Ile Thr Glu Thr Val Val Thr 85 90 95 Glu Ser Thr Met Ile Gly His Asn Pro Asn Thr Pro Gly Gly Ile Gly 100 105 110 Thr Gly Ala Gly Ile Thr Val Arg Leu Leu Asp Leu Leu Lys Lys Thr 115 120 125 Asp Lys Ser Lys Asn Tyr Ile Val Val Val Pro Lys Asp Ile Asp Phe 130 135 140 Glu Asp Val Ala Lys Leu Ile Asn Ala Tyr Val Ala Ser Gly Tyr Lys 145 150 155 160 Ile Thr Ala Ala Ile Leu Arg Asn Asp Asp Gly Val Leu Val Asp Asn 165 170 175 Arg Leu Asn His Lys Ile Pro Ile Val Asp Glu Val Ala Met Ile Asp 180 185 190 Lys Val Pro Leu Asn Met Leu Ala Ala Val Glu Val Ala Gly Pro Gly 195 200 205 Gln Val Ile Ser Gln Leu Ser

Asn Pro Tyr Gly Ile Ala Thr Leu Phe 210 215 220 Gly Leu Thr Pro Glu Glu Thr Lys Asn Ile Val Pro Val Ser Arg Ala 225 230 235 240 Leu Ile Gly Asn Arg Ser Ala Val Val Ile Lys Thr Pro Ala Gly Asp 245 250 255 Val Lys Ala Arg Val Ile Pro Ala Gly Lys Ile Ile Ile Asn Gly Asp 260 265 270 Thr Gly Lys Glu Glu Val Gly Val Ser Glu Gly Ala Asp Ala Ile Met 275 280 285 Lys Lys Val Ser Ser Phe Arg His Ile Asn Asn Ile Thr Gly Glu Ser 290 295 300 Gly Thr Asn Val Gly Gly Met Leu Glu Asn Val Arg Gln Thr Met Ala 305 310 315 320 Asp Leu Thr Gly Lys Lys Asn Asp Glu Ile Ala Ile Gln Asp Leu Leu 325 330 335 Ala Val Asp Thr Gln Val Pro Val Glu Val Arg Gly Gly Leu Ala Gly 340 345 350 Glu Phe Ser Asn Glu Ser Ala Val Gly Ile Ala Ala Met Val Lys Ser 355 360 365 Asp His Leu Gln Met Glu Val Ile Ala Lys Leu Ile Glu Lys Glu Phe 370 375 380 Asn Thr Lys Val Glu Ile Gly Gly Ala Glu Val Glu Ser Ala Ile Arg 385 390 395 400 Gly Ala Leu Thr Thr Pro Gly Thr Asp Lys Pro Ile Ala Ile Leu Asp 405 410 415 Leu Gly Ala Gly Ser Thr Asp Ala Ser Ile Ile Asn Lys Glu Asn Asn 420 425 430 Thr Val Ala Ile His Leu Ala Gly Ala Gly Asp Met Val Thr Met Ile 435 440 445 Ile Asn Ser Glu Leu Gly Leu Asn Asp Ile His Leu Ala Glu Asp Ile 450 455 460 Lys Arg Tyr Pro Leu Ala Lys Val Glu Asn Leu Phe Gln Ile Arg His 465 470 475 480 Glu Asp Gly Ser Val Gln Phe Phe Lys Asp Pro Leu Pro Ser Ser Leu 485 490 495 Phe Ala Lys Val Val Val Ile Lys Pro Asp Gly Tyr Glu Pro Val Thr 500 505 510 Gly Asn Pro Ser Ile Glu Lys Ile Lys Leu Val Arg Gln Ser Ala Lys 515 520 525 Lys Arg Val Phe Val Thr Asn Ala Leu Arg Ala Leu Lys Tyr Val Ser 530 535 540 Pro Thr Gly Asn Ile Arg Asp Ile Pro Phe Val Val Ile Val Gly Gly 545 550 555 560 Ser Ala Leu Asp Phe Glu Ile Pro Gln Leu Val Thr Asp Glu Leu Ala 565 570 575 His Phe Asn Leu Val Ala Gly Arg Gly Asn Val Arg Gly Val Glu Gly 580 585 590 Pro Arg Asn Ala Val Ala Thr Gly Leu Ile Leu Arg Tyr Gly Glu Glu 595 600 605 Arg Arg Lys Arg Tyr Glu Gln Arg 610 615 20 1851 DNA Lactobacillus reuteri 20 atggcaactg aaaaagtaat tggtgttgat attgggaatt cttccactga agttgcattg 60 gcagatgtaa gcgatagtgg gcaagttcac tttattaact ctggtattgc tcctactact 120 gggattaaag gtactaagca gaatctagtt ggaattaggg attcaattac tcaagttctg 180 aataaatcta atctgacaat cgatgatatt gatttaattc gaatcaatga agccacgcca 240 gtaattggtg atgttgcaat ggaaactatt acagaaacag ttgtaacaga atcaacaatg 300 attgggcata atcctaatac accaggtggt ataggaacag gggctgggat aacagttcgt 360 ttgcttgatc tcttaaagaa aactgataaa agcaaaaatt atattgttgt agttcctaag 420 gatattgatt ttgaagacgt tgctaaactt atcaatgctt atgttgcctc tggttataaa 480 ataacagcag caattctaag aaacgatgat ggtgttttag ttgataatcg gttaaatcat 540 aaaattccga ttgtcgatga agttgctatg attgacaaag ttccgttaaa tatgctggca 600 gctgtagaag ttgctggccc tggacaagta atttcacaac tttcaaaccc gtatggtatc 660 gctaccttat ttggactaac tccagaagag actaagaata ttgttccagt ttctcgagcg 720 cttattggaa atcgttcggc tgttgttatt aagactccag ctggggatgt taaagcgcga 780 gtaattccag caggtaaaat cataattaat ggtgatactg gaaaagaaga agttggagtt 840 tctgaaggtg ctgacgccat tatgaaaaag gtttctagtt tccgccatat taacaatata 900 actggtgagt ctggaaccaa tgttggagga atgttggaaa atgttcgtca aacaatggca 960 gatcttacag gaaagaaaaa tgatgaaatt gctattcaag atttacttgc tgttgatact 1020 caagtaccag ttgaagttcg aggcggtcta gctggtgaat tctcaaatga atcagcagtt 1080 gggatcgcag caatggttaa gtcagatcat cttcaaatgg aagttattgc taaacttatt 1140 gaaaaagaat ttaatacaaa ggttgaaatt ggtggtgctg aagttgaatc tgcaattcgt 1200 ggagcattaa caactccagg aacagataag ccaatcgcaa tccttgattt aggtgctggc 1260 tcaacagatg cttcaatcat taataaagaa aataatacag ttgcaattca cttagctggt 1320 gctggtgata tggtaacgat gattattaat tctgaattag gattgaatga tattcatctt 1380 gcagaagaca tcaaacgcta cccattagca aaggtagaaa acctttttca aattcgacat 1440 gaggatggtt cggttcaatt ctttaaagat ccgcttccat catcactgtt tgccaaagtt 1500 gtagtaatta aaccagatgg atacgaacca gtaactggga atccaagcat tgaaaaaatt 1560 aaattagtgc gtcaaagtgc aaagaaacga gtatttgtta cgaacgcttt acgggcactt 1620 aagtatgtta gtccaactgg aaatattcgt gatattccgt ttgttgtaat tgtcggtggt 1680 tcagccttag actttgaaat tccacaactt gttacagatg aattagcaca ctttaattta 1740 gttgctggtc gaggaaatgt tcgtggagtt gaaggaccac gaaatgccgt tgcaactgga 1800 ttgattttaa ggtatggcga agaaagaagg aagcgttatg aacaacgatg a 1851 21 615 PRT Lactobacillus reuteri 21 Met Ala Thr Glu Lys Val Ile Gly Val Asp Ile Gly Asn Ser Ser Thr 1 5 10 15 Glu Val Ala Leu Ala Asp Val Ala Asp Asn Gly Thr Ile Asn Phe Ile 20 25 30 Gly Ser Gly Ile Ala Pro Thr Thr Gly Ile Lys Gly Thr Lys Gln Asn 35 40 45 Leu Val Gly Ile Arg Asp Ser Ile Asn Gln Val Leu Asn Lys Ala Asn 50 55 60 Leu Thr Ile Asn Asp Ile Asp Leu Ile Arg Ile Asn Glu Ala Thr Pro 65 70 75 80 Val Ile Gly Asp Val Ala Met Glu Thr Ile Thr Glu Thr Val Val Thr 85 90 95 Glu Ser Thr Met Ile Gly His Asn Pro Asp Thr Pro Gly Gly Ile Gly 100 105 110 Thr Gly Ala Gly Ile Thr Val Arg Leu Leu Asp Leu Val Lys Lys Thr 115 120 125 Asp Lys Ser Gln Asn Tyr Ile Val Val Val Pro Lys Asp Ile Asp Phe 130 135 140 Glu Asp Val Ala Lys Leu Ile Asn Ala Tyr Val Ala Ser Gly Tyr Lys 145 150 155 160 Ile Thr Ala Ala Ile Leu Lys Asn Asp Asp Gly Val Leu Val Asp Asn 165 170 175 Arg Leu Asn Lys Pro Ile Pro Ile Val Asp Glu Val Ala Met Ile Asp 180 185 190 Lys Val Pro Leu Asn Met Leu Ala Ala Val Glu Val Ala Gly Ser Gly 195 200 205 Gln Val Ile Ser Gln Leu Ser Asn Pro Tyr Gly Ile Ala Thr Leu Phe 210 215 220 Gly Leu Asn Pro Glu Glu Thr Lys Asn Ile Val Pro Val Ser Arg Ala 225 230 235 240 Leu Ile Gly Asn Arg Ser Ala Val Val Ile Lys Thr Pro Ala Gly Asp 245 250 255 Val Lys Ala Arg Val Ile Pro Ala Gly Asn Ile Ile Ile Asn Ser Asp 260 265 270 Thr Gly Lys Glu Glu Val Gly Val Ser Glu Gly Ala Asp Ala Ile Met 275 280 285 Lys Lys Val Ser Ser Phe Arg His Ile Asn Asp Ile Thr Gly Glu Ser 290 295 300 Gly Thr Asn Val Gly Gly Met Leu Glu Asn Val Arg Gln Thr Met Ala 305 310 315 320 Asp Leu Thr Gly Lys Lys Asn Ser Glu Ile Ala Ile Gln Asp Leu Leu 325 330 335 Ala Val Asp Thr Gln Val Pro Val Glu Val Arg Gly Gly Leu Ala Gly 340 345 350 Glu Phe Ser Asn Glu Ser Ala Val Gly Ile Ala Ala Met Val Lys Ser 355 360 365 Asp His Leu Gln Met Glu Val Ile Ala Lys Leu Ile Glu Asp Glu Phe 370 375 380 His Thr Lys Val Glu Ile Gly Gly Ala Glu Val Glu Ser Ala Ile Arg 385 390 395 400 Gly Ala Leu Thr Thr Pro Gly Thr Asp Lys Pro Ile Ala Ile Leu Asp 405 410 415 Leu Gly Ala Gly Ser Thr Asp Ala Ser Ile Ile Asn Lys Glu Asn Gln 420 425 430 Thr Val Ala Ile His Leu Ala Gly Ala Gly Asp Met Val Thr Met Ile 435 440 445 Ile Asn Ser Glu Leu Gly Leu Asn Asp Ile His Leu Ala Glu Asp Ile 450 455 460 Lys Arg Tyr Pro Leu Ala Lys Val Glu Asn Leu Phe Gln Ile Arg His 465 470 475 480 Glu Asp Gly Ser Val Gln Phe Phe Glu Asp Pro Leu Pro Ser Ser Leu 485 490 495 Phe Ala Arg Val Val Val Ile Lys Pro Asp Gly Tyr Glu Pro Val Thr 500 505 510 Gly Asn Pro Ser Ile Glu Lys Ile Lys Leu Val Arg Gln Ser Ala Lys 515 520 525 Lys Arg Val Phe Val Thr Asn Ala Leu Arg Ala Leu Lys Tyr Val Ser 530 535 540 Pro Thr Gly Asn Ile Arg Asp Ile Pro Phe Val Val Ile Val Gly Gly 545 550 555 560 Ser Ala Leu Asp Phe Glu Ile Pro Gln Leu Val Thr Asp Glu Leu Ala 565 570 575 His Phe Asn Leu Val Ala Gly Arg Gly Asn Val Arg Gly Val Glu Gly 580 585 590 Pro Arg Asn Ala Val Ala Thr Gly Leu Ile Leu Arg Tyr Gly Glu Glu 595 600 605 Arg Arg Lys Gln Tyr Glu Gln 610 615 22 1848 DNA Lactobacillus reuteri 22 atggcaactg aaaaagtaat tggtgttgat attggtaatt cttccactga agtagcgtta 60 gctgatgttg ctgataatgg aacaattaac tttattggct ctggaatagc ccctactact 120 ggtatcaagg gtacaaaaca aaatctggtt ggaattagag attccatcaa tcaagtcctt 180 aataaggcta atttaacgat taatgatatt gatttaattc ggattaatga ggcaacgcca 240 gttatcggtg acgtagcgat ggaaacaatt accgaaacgg tcgtaaccga atcgactatg 300 atcggacata atcctgatac tcccggtggt attggaactg gtgcaggaat aacagttaga 360 ctattggatc ttgtcaaaaa gacggataaa agtcaaaact atattgttgt tgttcccaag 420 gatattgatt ttgaagatgt tgctaaactg attaacgcct atgttgcttc gggctataag 480 attacagctg cgatcctaaa aaatgatgat ggtgtgttag ttgataatcg attgaataaa 540 ccaattccga ttgttgatga agttgccatg attgataaag tcccattaaa tatgctggcg 600 gcagttgaag ttgctggttc gggacaagtt atctcgcaac tttcaaatcc atatggaatt 660 gctaccttgt ttggattgaa tccagaagaa accaagaata ttgttcctgt ctcacgtgca 720 cttattggta accgttctgc cgttgtcatt aagacaccag caggggatgt taaggcacgg 780 gtaattccag ccggaaacat tatcattaac agcgataccg gaaaagaaga agttggtgtt 840 tcagaaggtg ctgacgccat tatgaagaaa gtttccagtt tccgtcacat taatgatatt 900 actggagaat cagggactaa cgttggtgga atgcttgaaa atgttcgcca aacaatggct 960 gatttaactg gaaagaagaa tagtgaaatt gctattcaag atctattagc ggtagataca 1020 caggtgcctg tcgaagttcg cgggggcttg gctggtgaat tttcaaatga atcagcagtt 1080 ggtattgctg cgatggttaa gtctgatcat cttcaaatgg aagtaattgc taaattaatt 1140 gaggatgaat tccatacgaa ggttgagatt ggtggtgccg aagttgaatc tgcaattcgc 1200 ggtgcattaa cgacaccggg aacagataaa ccaattgcaa ttcttgattt aggtgccggc 1260 tcaacagatg cttcaattat caataaagaa aatcaaactg tagcaattca cttagctggt 1320 gctggtgaca tggttacgat gattattaac tctgaattgg gattaaatga cattcacttg 1380 gcagaggata ttaagcgcta tccattagct aaagtcgaaa atctattcca aattcgtcat 1440 gaagatggat cggtacaatt ctttgaagat ccgcttccgt catcattatt tgctcgtgtt 1500 gttgtaatca aaccagatgg gtatgaaccg gttacgggta atccaagcat tgagaagatc 1560 aagctggttc gtcaaagtgc taagaagcgg gtatttgtaa ccaatgcatt acgagctctt 1620 aagtacgtca gcccgacagg aaacattcgt gatattccgt ttgttgtaat tgtcggtgga 1680 tctgctcttg actttgaaat accacaactg gtaacagatg agttagcaca ctttaactta 1740 gttgccggac gtgggaatgt tcgtggagta gaaggcccac gaaacgcggt tgcaacagga 1800 ttaattctcc gttatggcga agaaagaaga aagcaatatg aacaatga 1848 23 119 PRT Lactobacillus reuteri 23 Met Asn Asn Asp Asp Ser Gln Arg Pro Ser Ile Val Val Gly Leu Glu 1 5 10 15 Asn Gly Ile Thr Ile Pro Asp Ser Val Lys Pro Leu Phe Tyr Gly Ile 20 25 30 Glu Glu Glu Gln Ile Pro Val Ser Val Arg Lys Ile Asn Ile Asn Asp 35 40 45 Thr Val Glu Arg Ala Tyr Gln Ser Ala Leu Ala Ser Arg Leu Ser Val 50 55 60 Gly Ile Ala Phe Glu Gly Asp His Phe Ile Val His Tyr Lys Asn Leu 65 70 75 80 Lys Glu Asn Gln Pro Leu Phe Asp Met Thr Ile Asn Asp Lys Lys Gln 85 90 95 Leu Arg Ile Leu Gly Ala Asn Ala Ala Arg Leu Val Lys Gly Ile Pro 100 105 110 Phe Lys Glu Met Ala Asn Arg 115 24 360 DNA Lactobacillus reuteri 24 atgaacaacg atgattcaca acgtccctcg attgtcgtcg gactagaaaa tggaataacg 60 attccagata gtgtcaagcc acttttttat ggaattgaag aagaacagat cccagtctca 120 gttcgtaaaa tcaatataaa tgatactgtt gaaagagcat accaatcagc tcttgcatca 180 aggctatctg taggaattgc ttttgaagga gatcatttta ttgttcacta taagaactta 240 aaagaaaatc agcctttatt tgatatgaca atcaatgata aaaagcaatt acgaatttta 300 ggagcaaatg cagcgagatt agtaaaagga atccctttta aggaaatggc aaacaggtga 360 25 118 PRT Lactobacillus reuteri 25 Met Asn Asn Asp Ser Glu Arg Pro Ser Ile Ile Val Gly Val Glu Asn 1 5 10 15 Gly Thr Ala Ile Pro Gln Asn Ala Ala Pro Leu Phe Asn Gly Ile Glu 20 25 30 Glu Glu Gln Ile Pro Val Ala Val Arg Glu Ile Asp Ile Asp Asn Val 35 40 45 Leu Ser Arg Ala Tyr Gln Ser Ala Leu Ala Ser Arg Leu Ser Val Gly 50 55 60 Ile Ala Phe Asp Gly Asp Arg Phe Ile Val His Tyr Lys Asn Leu Lys 65 70 75 80 Glu Asn Lys Pro Leu Phe Asp Lys Thr Ile Ser Asp Gly Lys Gln Leu 85 90 95 Arg Val Leu Gly Ala Asn Ala Ala Arg Leu Val Lys Gly Ile Pro Phe 100 105 110 Lys Glu Met Val Asn Arg 115 26 357 DNA Lactobacillus reuteri 26 atgaacaatg attcagagcg tccctcaatt atcgtaggtg ttgagaatgg aacagctatt 60 cctcaaaatg cagcaccgct ttttaacgga attgaagaag aacaaatacc ggtggcggtt 120 agagaaatcg acattgataa tgttttaagt cgggcatacc agtcggccct cgcctcacga 180 ttatcagtag ggattgcttt tgatggtgat cgatttatcg ttcactataa aaacttaaaa 240 gaaaacaaac cactatttga taaaacaatt agtgatggta agcaactacg agttctagga 300 gcaaatgcag cgcgactagt aaagggaatc ccctttaagg aaatggtaaa caggtga 357 27 37 DNA Artificial primer 27 atgaaacgtc aaaaacgatt tgaagaacta gaaaaac 37 28 32 DNA Artificial primer 28 ttagttatcg ccctttagct tcttacgact tt 32 29 30 DNA Artificial primer 29 atgaaacgtc aaaaacgttt tgaagaacta 30 30 25 DNA Artificial primer 30 ctagttatca cccttgagct tcttt 25 31 29 DNA Artificial primer 31 atgggaggca taattccaat ggaaaaata 29 32 31 DNA Artificial primer 32 ttaacgaatt attgcttcgt aaaccatctt c 31 33 21 DNA Artificial primer 33 atgggaggca taatgccgat g 21 34 31 DNA Artificial primer 34 ttaacgaatt attgcttcgt aaatcatctt c 31 35 32 DNA Artificial primer 35 atgaatagac aatttgattt cttaatgcca ag 32 36 26 DNA Artificial primer 36 ttagtagatg ccatcgtaag cctttt 26 37 33 DNA Artificial primer 37 atggcaactg aaaaagtaat tggtgttgat att 33 38 31 DNA Artificial primer 38 tcacctgttt gccatttcct taaaagggat t 31 39 28 DNA Artificial primer 39 atggcaactg aaaaagtaat tggtgttg 28 40 26 DNA Artificial primer 40 tcacctgttt accatttcct taaagg 26 41 477 PRT Lactobacillus reuteri 41 Met Gln Ile Asn Asp Ile Glu Ser Ala Val Arg Lys Ile Leu Ala Glu 1 5 10 15 Glu Leu Asp Asn Ala Ser Ser Ser Ser Ala Asn Val Ala Ala Thr Thr 20 25 30 Asp Asn Gly His Arg Gly Ile Phe Thr Asn Val Asn Asp Ala Ile Ala 35 40 45 Ala Ala Lys Ala Ala Gln Glu Ile Tyr Arg Asp Lys Pro Ile Ala Val 50 55 60 Arg Gln Gln Val Ile Asp Ala Ile Lys Glu Gly Phe Arg Pro Tyr Ile 65 70 75 80 Glu Lys Met Ala Lys Asp Ile Lys Glu Glu Thr Gly Met Gly Thr Val 85 90 95 Glu Ala Lys Ile Ala Lys Leu Asn Asn Ala Leu Tyr Asn Thr Pro Gly 100 105 110 Pro Glu Ile Leu Glu Pro Val Val Glu Asn Gly Asp Gly Gly Met Val 115 120 125 Met Tyr Glu Arg Leu Pro Tyr Gly Val Ile Gly Ala Val Gly Pro Ser 130 135 140 Thr Asn Pro Ser Glu Thr Val Ile Ala Asn Ala Ile Met Met Leu Ala 145 150 155 160 Gly Gly Asn Thr Leu Tyr Phe Gly Ala His Pro Gly Ala Lys Asn Val 165 170 175 Thr Arg Trp Thr Ile Glu Lys Met Asn Asp Phe Ile Ala Asp Ala Thr 180 185 190 Gly Leu His Asn Leu Val Val Ser Ile Glu Thr Pro Thr Ile Glu Ser 195 200 205 Val Gln Gln Met Met Lys His Pro Asp Ile Ala Met Leu Ala Val Thr 210 215 220 Gly Gly Pro Ala Val Val His Gln Ala

Met Thr Ser Gly Lys Lys Ala 225 230 235 240 Val Gly Ala Gly Pro Gly Asn Pro Pro Ala Met Val Asp Ala Thr Ala 245 250 255 Asp Ile Asp Leu Ala Ala His Asn Ile Ile Thr Ser Ala Ser Phe Asp 260 265 270 Asn Asp Ile Leu Cys Thr Ala Glu Lys Glu Val Val Ala Glu Ser Ser 275 280 285 Ile Lys Asp Glu Leu Ile Arg Lys Met Gln Asp Glu Gly Ala Phe Val 290 295 300 Val Asn Arg Glu Gln Ala Asp Lys Leu Ala Asp Met Cys Ile Gln Glu 305 310 315 320 Asn Gly Ala Pro Asp Arg Lys Phe Val Gly Lys Asp Ala Thr Tyr Ile 325 330 335 Leu Asp Gln Ala Asn Ile Pro Tyr Thr Gly His Pro Val Glu Ile Ile 340 345 350 Cys Glu Leu Pro Lys Glu His Pro Leu Val Met Thr Glu Met Leu Met 355 360 365 Pro Ile Leu Pro Val Val Ser Cys Pro Thr Phe Asp Asp Val Leu Lys 370 375 380 Thr Ala Val Glu Val Glu Lys Gly Asn His His Thr Ala Thr Ile His 385 390 395 400 Ser Asn Asn Leu Lys His Ile Asn Asn Ala Ala His Arg Met Gln Cys 405 410 415 Ser Ile Phe Val Val Asn Gly Pro Ser Tyr Val Gly Thr Gly Val Ala 420 425 430 Asp Asn Gly Ala His Ser Gly Ala Ser Ala Leu Thr Ile Ala Thr Pro 435 440 445 Thr Gly Glu Gly Thr Cys Thr Ala Arg Thr Phe Thr Arg Arg Val Arg 450 455 460 Leu Asn Ser Pro Gln Gly Phe Ser Val Arg Asn Trp Tyr 465 470 475 42 1434 DNA Lactobacillus reuteri 42 atgcagatta atgatattga aagtgctgta cgcaaaattc ttgccgaaga actagataat 60 gccagctctt caagtgcaaa cgttgcagct actactgata atggtcatcg cggaattttc 120 actaatgtca atgatgcaat tgctgctgca aaagctgctc aagaaatata tcgggataag 180 ccaattgctg ttcgccaaca agtgattgat gccattaagg aaggattccg cccatatatt 240 gaaaaaatgg ctaaagatat caaagaagaa acaggaatgg gaacagtaga ggccaaaatt 300 gctaagttaa acaatgcctt gtacaacact cctggtcccg agattcttga accagttgta 360 gaaaacggtg acggtgggat ggttatgtat gaacggttac catatggtgt tattggtgcg 420 gttggcccaa gtacaaaccc ttcagaaact gtaattgcta atgcgatcat gatgcttgcc 480 ggtggtaata ctctttactt tggtgctcac cctggcgcaa agaatgttac tcgctggaca 540 attgaaaaga tgaacgattt tattgcagat gcaacaggcc ttcataattt agttgtaagt 600 attgaaacac caacaattga atcagttcaa caaatgatga agcaccccga cattgcaatg 660 ttagcagtaa ctggtggccc agctgttgtt caccaagcaa tgaccagtgg taagaaagcg 720 gttggtgctg gtcctggtaa tcctcctgca atggttgatg ctactgctga tattgattta 780 gctgctcata atatcattac atctgcttca tttgataatg atattttatg tactgctgaa 840 aaggaagtag ttgcagaaag tagcattaaa gatgaattaa ttcgtaagat gcaagatgaa 900 ggtgcctttg tagttaaccg tgaacaagcc gataaattag ctgatatgtg tatccaagaa 960 aatggtgctc ctgatcgtaa atttgttggt aaggatgcaa cttatatctt agaccaagct 1020 aatattcctt acacaggcca cccagttgaa attatttgtg aacttcctaa ggaacatcca 1080 ttagtaatga ctgaaatgtt aatgccaatt ttaccagttg tttcttgtcc aacatttgat 1140 gatgttttga agactgctgt tgaagttgaa aaaggtaacc atcacacagc tactattcat 1200 tccaataacc ttaagcatat taataatgct gctcaccgga tgcaatgttc aatctttgtt 1260 gttaatggcc catcctatgt tggtacaggt gttgcagata atggagctca ctcaggtgct 1320 tcagcattaa caattgctac gccaactggt gaaggaacat gtactgcacg aacatttact 1380 cgtcgggttc gtttgaactc accacaagga ttctcagtac gtaactggta ttaa 1434 43 395 PRT Lactobacillus reuteri 43 Met Met Ser Lys Lys Ile Leu Ala Ile Asn Ser Gly Ser Ser Ser Ile 1 5 10 15 Lys Phe Lys Leu Tyr Leu Met Pro Glu Glu Lys Leu Leu Ile Ser Gly 20 25 30 Ser Ala Glu Asn Leu Gly Ser Ser Thr Ser Gln Leu Ser Tyr Lys Thr 35 40 45 Asp Lys Thr Asn Glu Thr Arg Gln Ile Pro Leu Lys Asn His Ser Glu 50 55 60 Ala Ile Asp His Ile Ile Asp Val Leu Met Ser Ser Gly Val Val Lys 65 70 75 80 Asp Lys Ser Glu Ile Tyr Gly Val Gly His Arg Ile Ser His Gly Gly 85 90 95 Ser Tyr Tyr Thr His Ala Val Ala Val Thr Pro Glu Val Glu Lys Arg 100 105 110 Ile Asp Glu Leu Lys Val Leu Ser Pro Leu His Asn Pro Asn Gly Leu 115 120 125 Ala Gly Ile Lys Ala Phe Glu Lys Phe Leu Pro Asp Ala Lys Glu Val 130 135 140 Val Thr Phe Asp Asn Ser Phe His His Thr Ile Pro Lys Lys Ala Tyr 145 150 155 160 Met Tyr Ala Leu Pro Tyr Glu Phe Tyr Glu Lys Tyr Gln Ile Arg Arg 165 170 175 Tyr Gly Phe His Ala Pro Ser His Gln Tyr Val Ser Glu Lys Ala Arg 180 185 190 Glu Leu Phe Gly Lys Glu Lys Thr Arg Arg Met Ile Thr Cys His Leu 195 200 205 Gly Asn Gly Ser Ser Val Ser Ala Ile Leu Asp Gly Lys Ser Val Asn 210 215 220 Ser Ser Met Gly Phe Thr Pro Leu Ala Gly Val Val Met Gly Thr Arg 225 230 235 240 Cys Gly Asp Ile Asp Pro Glu Ile Ile Pro Phe Leu Glu Glu Glu Leu 245 250 255 Asn Ile Asp Ser His Glu Met Arg Arg Ile Met Asn Glu Asp Ser Gly 260 265 270 Leu Lys Gly Leu Ser Gly Ile Ser Asn Asp Glu Arg Glu Ile Glu Ser 275 280 285 Ala Ala Lys Asn Gly Asn Glu Arg Ala Gln Leu Ala Leu Asp Val Phe 290 295 300 Val His Ser Ile Gln Gln Tyr Ile Gly Ala Tyr Thr Thr Asp Leu Asp 305 310 315 320 Gly Leu Asp Thr Leu Val Phe Thr Ala Gly Ile Gly Glu His Ala Ala 325 330 335 Tyr Ile Arg Ser Gln Ile Cys Lys Asn Leu Asp Tyr Leu Gly Val Lys 340 345 350 Ile Asp Glu Glu Lys Asn Lys Asn Asn Glu Leu Ser Ile Glu Ala Pro 355 360 365 Asp Ser Lys Val Lys Ile Ala Val Ile Pro Thr Asn Glu Glu Ile Ile 370 375 380 Ile Ala Arg Asp Val Met Asn Val Thr Gln Gln 385 390 395 44 1188 DNA Lactobacillus reuteri 44 ttgatgtcaa aaaaaatact tgcaattaat tctggtagtt catcaattaa gttcaaactt 60 tacttgatgc cagaggagaa actattaatt agtggttctg ctgaaaatct tggttcttcg 120 acaagtcagc tttcatataa aactgataaa actaacgaga caagacaaat ccctttaaaa 180 aaccactcag aggcaattga ccatattatt gatgttttaa tgtctagtgg ggttgttaag 240 gataagtcag aaatttatgg tgttggtcac cggatttctc atggcggaag ttactatact 300 catgcagtgg cagtcactcc agaagttgaa aaacggattg atgaattgaa ggtgttatca 360 cctctgcata atccaaatgg actagcaggg ataaaagcct ttgaaaagtt tcttccagat 420 gccaaggaag tagttacttt cgataattca tttcatcata caatccctaa gaaagcttat 480 atgtatgctt tgccatatga gttttatgaa aagtatcaaa ttaggcgcta cgggttccat 540 gccccttcac atcagtatgt gtcagaaaaa gcgcgtgaac tttttggtaa agaaaagact 600 cgtcgtatga tcacgtgtca tttgggaaat ggatcaagcg tttcggcgat cttagatgga 660 aagtcggtta actcttcaat gggctttact ccgttagcag gtgtagtgat gggaacgcga 720 tgtggagata ttgatccaga aattattcct tttcttgaag aagaactcaa tattgattca 780 catgaaatgc gtcgaataat gaatgaagac tcagggctta aaggcttatc tgggatttct 840 aatgatgaac gtgagattga aagtgcggct aaaaacggta acgaacgggc acaattagct 900 ttagatgtat ttgtacattc aattcaacaa tatattggag catatacaac ggatcttgat 960 ggattggata cattagtatt tacagccgga attggtgaac atgctgctta tattagaagt 1020 cagatctgta agaatttaga ctatcttgga gtcaaaattg acgaagagaa aaataaaaat 1080 aatgagctaa gcattgaagc acctgatagt aaggttaaaa tagctgttat tccaactaac 1140 gaagaaataa ttattgcccg tgatgtaatg aatgtaactc agcaataa 1188 45 1122 DNA Lactobacillus reuteri 45 atggttgaag aatttggctc accatcgtct tacatccaag gaaaaggtgt cctttttgaa 60 agtgataagt atcttaaaaa ctttggcaca aaaccgttat tattggctgg cgaaacagtc 120 tataaaattg taggtaagcg ttttgaacag tatcttcaag aaagtggtta tgatgtcacc 180 cgtgttcaat ttaatggtga atcatccact aacgaagtaa accgggttac agaaattggt 240 aaagaaaata atgtaactgt cgtttatggt cttggtggtg gtaaaacagt tgataccgcc 300 aaagcaattg ccgacaatct ccatctacca gttgtaatta tgccaacatt ggcttcaaat 360 gatgcacctt gttctcgtct ttcagtaatc tacactgatg acggtggctt cgatcattat 420 cgtttctaca accaaaaccc taatctggtt ttagttgata ctcaagttat cgctaatggt 480 cccgttcgga tgcttatttc tggaattgct gatgctttag ctaccaatgt tgaggcacaa 540 gcagttgctc aagctcatag tgatacaatg cttggtgaaa aacaaaccct tgttggaaat 600 gcaatcgccc agaaatgtga agagacatta tttaattact cgcacctagc tgtagctgat 660 gcagaaaccc atgtcgttac accagcattt tctaatattg ttgaagcaaa tacactaatg 720 agcggtctcg gttttgaaag tggtggtcta tctggtgccc acgctattca tgatggctta 780 acaattttag aagagactca tgatttaaca cacggtgaaa aggtcgcata cggtacctta 840 acacaattaa tgttggaagg cgctgaccag gaacgctata acaagtactt ccaatttatt 900 ctttctttag gcctaccaac tactcttgct gatctacatt tagaaaatgt caccgatgaa 960 gaactgctca atgctggaaa agccgcttgt tcagaacaag ataccatgga tcgtttgcca 1020 tttaaggtaa ctccagatga cgttgctcaa gcattacgag cagttgatgc atatactaaa 1080 caatatttaa ctaatcatcg ttgtcaccat agtcgtatgt aa 1122 46 1021 DNA Artificial recombinant DNA 46 gataagacgg ttcgtgttcg tgctgacttg caccatatca taaaaatcga aacagcaaag 60 aatggcggaa acgtaaaaga agttatggaa ataagactta gaagcaaact taagagtgtg 120 ttgatagtgc agtatcttaa aattttgtat aataggaatt gaagttaaat tagatgctaa 180 aaatttgtaa ttaagaagga gtgattacat gaacaaaaat ataaaatatt ctcaaaactt 240 tttaacgagt gaaaaagtac tcaaccaaat aataaaacaa ttgaatttaa aagaaaccga 300 taccgtttac gaaattggaa caggtaaagg gcatttaacg acgaaactgg ctaaaataag 360 taaacaggta acgtctattg aattagacag tcatctattc aacttatcgt cagaaaaatt 420 aaaactgaat actcgtgtca ctttaattca ccaagatatt ctacagtttc aattccctaa 480 caaacagagg tataaaattg ttgggagtat tccttaccat ttaagcacac aaattattaa 540 aaaagtggtt tttgaaagcc atgcgtctga catctatctg attgttgaag aaggattcta 600 caagcgtacc ttggatattc accgaacact agggttgctc ttgcacactc aagtctcgat 660 tcagcaattg cttaagctgc cagcggaatg ctttcatcct aaaccaaaag taaacagtgt 720 cttaataaaa cttacccgcc ataccacaga tgttccagat aaatattgga agctatatac 780 gtactttgtt tcaaaatggg tcaatcgaga atatcgtcaa ctgtttacta aaaatcagtt 840 tcatcaagca atgaaacacg ccaaagtaaa caatttaagt accgttactt atgagcaagt 900 attgtctatt tttaatagtt atctattatt taacgggagg aaataattct atgagtcgct 960 tttgtaaatt tggaaagtta cacgttacta aagggaatgt agataaatta ttaggtatac 1020 t 1021 47 30 DNA Artificial primer 47 atgcagatta atgatattga aagtgctgta 30 48 27 DNA Artificial primer 48 ttaataccag ttacgtactg agaatcc 27 49 34 DNA Artificial primer 49 ttgatgtcaa aaaaaatact tgcaattaat tctg 34 50 29 DNA Artificial primer 50 ttattgctga gttacattca ttacatcac 29 51 23 DNA Artificial primer 51 atggttgaag aatttggctc acc 23 52 24 DNA Artificial primer 52 ttacatacga ctatggtgac aacg 24 53 19860 DNA Lactobacillus reuteri 53 tttttgtgta ttaatttgta aaatattgcc gttattgaac agttaatcca ataaagacaa 60 taaaatacat aattaatgtg ttagcattat atgtatagaa aacgcataca atttgggaat 120 aatataaaaa ggttggtgtt tagacatgca tggatttatt ggcgaatttt ttggcaccat 180 ggttttaatc ctattaggag caggatgttg tgctggtaat agtttgaata aaacatatgg 240 gaaacaaagt ggctggtggt ttatctgtat ttcatggggc ttagcagtta caatgggagt 300 ttatgttgca ggatttctgg gttcattagg gcacttaaat cccgctgtaa caattccttt 360 tgctattttt ggcttattcc catggagtaa cgttatacct tacttacttg gtcaatttct 420 tggtgcgttt gttggtgcag tattagtaat tattcaattc tatccacaat ttaaagcaac 480 cccaaatgaa gaagaaggaa ataatgttgg tatttttgct actcgtccag cgataaatag 540 tccaattttt aactttttct cagaagtgat tgcgaccttt gcatttattt tcatcttatt 600 aaatcttggc aactttacac agggattgaa gccatttatc gtaggaatgg ttattgcagt 660 tgttggtaca tgtctcggga caactactgg ctttgcatta aacccagctc gtgattggtc 720 accacgttta gcatatacta ttttgccaat tcctaataag ggtgtttcag aatggtggta 780 tgcatgggtt ccaatgtgtg gcccaattgt tgggggcctt cttgcttgtg ctttacaaac 840 ggcactagtt tagtgaacct agagaaaagg aggctaatta atatagcctc tttatttagt 900 ttaaataaaa tatgaaatat ctcgtaggag aaaattaatg aaaaaagaat ttttaaaaag 960 tagtaatgaa caattaaaaa aattttccga gattgttaat ggggataagc ctttacgtaa 1020 agttacggct gatgaaaagc taaaggtcgg tgtagattta ggaacttctt caattgtttt 1080 aacagtgctg gattccaaag ataagattgt atacggagcg tatgaatatg accatgcagt 1140 tcaagatggt attgtagtta atttcatgga atcagttaat attttaagac gcttaaaaga 1200 aaaagctgag aaagtattag gacgtgaact taaaacggca tgtggtgcta ttccaccgaa 1260 gacaggagag aagagtgcca aagtggttgc taatgttatc gaagagacag gcttgctttg 1320 tacaggtgtt gaagatgaac cgacagcagc tgcgaagttc ttaagattgt caaatggtac 1380 agttgtagat attggaggag gaacaactgg gattagtatt tttaaagata acaagctcat 1440 ccatgttatt gatgaagcaa caggcggatt tcatatgacg cttgttcttg gaggaagata 1500 taaaataaaa aatgatgaag cagaaaaatt aaagcgtaac aagaataaag aatctgaagt 1560 atatgctgtt attaaacctg tagttgagaa aatggcagca attgttcaaa atatgggagt 1620 agaaattatt gatccagtaa tagtggtggg aggtgcaact aactttactg aatttacaac 1680 aacctttagt aaagatttaa agcgtaaagt ttataaaccg ctttatcctc aatttgttac 1740 gccactaggg attgcaatgt ttgatgatta gaataaataa gaggctgggc acccccaacc 1800 tctttttaat tttaaataat tttttcagta taaatccatt gaattactga acgatcaaat 1860 acattaatct cactagctgg aataataggt tgagaacaat ctactgtata gacccaacct 1920 gctttattac taacatcatt cagatcattt attgaataga tatatggata cccatttaaa 1980 tcacgggctt taaaggaaat atcattttta ttgaaaaaat cttttgagat ttcataaacg 2040 gacttatttg agcgccattg taaatctctt ggaatagtat agattttctt tattgcggaa 2100 ttatattttc gatactttga tggtgtcatt cctacttttt gcttgaaaat tttagtaaag 2160 taacttgtct gtgaaaaacc aacttgatga gccaatttat taattggtgt atttgaaaaa 2220 attaattttt cttgagcaag tgcaattttt tgtagattta tatagttaat aaaattgtca 2280 ttaaaataat ttttaaagat tcgacttaag tatgatggtg agagataaat cctttgagaa 2340 acgttttcta aagtaagcga tttttctaaa ttggaattaa tgtatttaag cgccatggtt 2400 atattttttt caatatcact tagagtacca tcatttctgt tattaagaat aggaggatta 2460 gtaacgttag ctattgaatc atctccagaa atattcaaaa tcccattaag gactttgatt 2520 agtgaactta gcttaggagc ctcgaatggg gtaaggacag ctatgcagtc attggaactg 2580 tcaataaaat ttttgcaaga aatttcaata tatttactac ataaatcaat agcgtctgat 2640 tctatatgtg attcatcaag aacaaagaaa ccacttaaag atgagcttat aactagtgga 2700 aaaacaaagt aatttttaaa atcgagtttt cgtaaatgtt caagtgaaat atttgagtca 2760 aaaagaaggg tgttgcaatc aacaattgct ccggtaatgc ttgtgaaaat tatattatta 2820 ttggttattt cctgaaatgt ttttgttacc ttttgaatgt cattcaagaa ttttgaagaa 2880 tattcgtaca tttgaatttc gcctactttt taccaaattt tttaagaaag atgccgttta 2940 cctctatata ttagcataca tttacacata aaaacgcttt cctgtaaatt ttgtgataca 3000 taataataaa ttattgttct ttttaagtat catacatttt ttaagataat atatcataaa 3060 tatcatgtta taaaattaac atgtaccaaa ttgtaagcga tttctcatta tcgctatttg 3120 tttttatact taggaggcat tcttatggga caagaagcac ttggtttaat tgaaaccgaa 3180 ggacttgtag cttcaattga agctgctgat gcaatggtaa aagctgctaa tgttaaatta 3240 attggtcaag aaaagattgg tcatggatta gtcacagtaa tggttcgtgg tgatgttgga 3300 gctgttaagg cttcagttga tgccggagta caagctgccg aaaatattgg agaagttgtt 3360 tcgagttacg taattcctcg tcctcaatct gaagttgata agctcttacc gcatcatgga 3420 gaataattga taaaaaatta aagcccttat acagacggct aggtacagaa atctgtatta 3480 agagctttat tgttaagagc ttttatagtc aggaggaaaa ataatgaatg attttctgaa 3540 ttctactagt actgttccag aatttgttgg tgctagcgaa attggagata ccattggaat 3600 ggtaattccg agagttgatc aacaactatt agataaatta cacgttacaa aacaatacaa 3660 gactttaggt attttgagtg atcgtactgg tgctggtcca caaattatgg caatggatga 3720 aggaattaag gctactaaca tggaatgtat tgatgttgaa tggccacgtg atactaaagg 3780 tggaggaggc catggatgtt taattatcat cggtggtgat gatcctgcag atgcacgcca 3840 agctattcgg gttgcacttg ataatcttca tcgtacattt ggtgacgttt ataacgccaa 3900 agcgggtcac cttgaattac aatttacagc tcgtgctgca ggtgctgcac atcttggatt 3960 aggtgcagtt gaagggaaag catttgggtt gatttgtggt tgtccttccg ggattggtgt 4020 cgtgatggga gataaggctt taaagactgc tggtgttgaa ccgcttaact ttacttcacc 4080 aagtcatggt acaagtttct ctaacgaagg ttgcctaact attaccggtg actcaggagc 4140 tgttcgtcaa gctgttatgg ctggacgtga agtaggatta aagttattgt cacagtttgg 4200 tgaagaacca gttaatgatt tcccatcata cattaagtag atctagaagg aggactactt 4260 tattatgaaa cgtcaaaaac gatttgaaga actagaaaaa cggccaattc atcaagatac 4320 atttgttaaa gaatggccag aagaaggttt cgttgcaatg atggggccta atgaccctaa 4380 gcctagtgta aaagttgaaa atggcaagat cgtagagatg gatggtaaaa agctcgaaga 4440 ttttgatttg attgacttgt acattgctaa gtatggaatc aatattgaca acgttgaaaa 4500 agttatgaat atggattcta ccaagattgc acggatgctt gttgatccta atgtttctcg 4560 tgatgaaatt attgaaatta catcagcttt gactcctgct aaggctgaag agatcatcag 4620 taagcttgat tttggtgaaa tgattatggc tgtcaagaag atgcgcccac gtcgtaagcc 4680 tgacaaccag tgtcacgtta ccaatactgt tgataaccca gttcaaattg ctgctgatgc 4740 tgctgatgcc gctcttcgtg gatttccaga acaagaaacc acgacagctg tggcacgtta 4800 tgcaccattc aatgctattt caattttaat tggtgcacaa acaggtcgcc ctggtgtatt 4860 gacacaatgt tctgttgaag aagctactga attgcaatta ggtatgcgtg gttttaccgc 4920 atatgctgaa accatttcag tttacggtac tgatcgtgta tttaccgatg gtgatgatac 4980 tccatggtct aaaggcttct tggcatcttg ttatgcatca cgtggtttga agatgcgatt 5040 tacttcaggt gccggttcag aagttttgat gggttatcca gaaggtaagt caatgcttta 5100 ccttgaagcg cgttgtattt tacttactaa ggcttcaggt gttcaaggac ttcaaaatgg 5160 tgccgtaagt tgtattgaaa ttcctggtgc tgttcctaat ggtattcgtg aagttctcgg 5220 tgaaaacttg ttatgtatga tgtgtgacat cgaatgtgct tctggttgtg accaagcata 5280 ctcacactcc gatatgcggc ggactgaacg gtttattggt caatttattg ccggtactga 5340 ttatattaac tctggttact catcaactcc taactacgat aataccttcg ctggttcaaa 5400 cactgatgct atggactacg atgatatgta tgttatggaa cgtgacttgg gtcaatatta 5460 tggtattcac cctgttaagg aagaaaccat tattaaggca cgtaataagg ccgctaaagc 5520 ccttcaagca

gtatttgaag atcttggatt accaaagatt actgatgaag aggtcgaagc 5580 agcaacgtat gctaacaccc atgatgacat gccaaagcgg gatatggttg cagatatgaa 5640 ggctgctcaa gatatgatgg atcgtggaat tactgctatt gatattatca aggcattgta 5700 caaccacgga tttaaagatg tcgctgaagc aattttgaac cttcaaaaac aaaaagttgt 5760 tggtgattac cttcaaacat cttctatttt tgataaagat tggaacgtca cttctgctgt 5820 taacgacgga aatgattatc aaggaccagg tactggatac cgtctatatg aagacaagga 5880 agaatgggat cggattaaag acttaccatt cgcccttgat ccagaacatt tggaactgta 5940 gagaggaggt aatctgttat ggctgatatt gatgaaaact tattacgtaa aatcgttaaa 6000 gaagttttaa gcgaaactaa tcaaatcgat actaagattg actttgataa aagtaatgat 6060 agtactgcaa cagcaactca agaggtgcaa caaccaaata gtaaagctgt tccagaaaag 6120 aaacttgact ggttccaacc agttggagaa gcaaaacctg gatattctaa ggatgaagtt 6180 gtaattgcag tcggtcctgc attcgcaact gttcttgata agacagaaac tggtattcct 6240 cataaagaag tgcttcgtca agttattgct ggtattgaag aagaagggct taaggcgcgg 6300 gtagttaaag tttaccggag ttcagatgta gcattctgtg ctgtccaagg tgatcacctt 6360 tctggttcag gaattgctat tggtatccaa tcaaaaggga cgacagttat tcaccaaaag 6420 gatcaagacc ctcttggtaa ccttgagtta ttcccacaag cgccagtact tactcccgaa 6480 acttatcgtg caattggtaa gaatgccgct atgtatgcta agggtgaatc tccagaacca 6540 gttccagcta aaaacgatca acttgctcgt attcactatc aagctatttc agcaattatg 6600 catattcgtg aaactcacca agttgttgtt ggtaagcctg aagaagaaat taaggttacg 6660 tttgattaag gaggcagaat gatgagtgaa gttgatgatt tagtagcaaa gatcatggct 6720 cagatgggaa acagttcatc tgctaatagc tctacaggta cttcaactgc aagtactagt 6780 aaggaaatga cagcagatga ttacccactt tatcaaaagc accgtgattt agtaaaaaca 6840 ccaaaaggac acaatcttga tgacatcaat ttacaaaaag tagtaaataa tcaagttgat 6900 cctaaggaat tacggattac accagaagca ttgaaacttc aaggtgaaat tgcagctaat 6960 gctggccgtc cagctattca aaagaatctt caacgagctg cagaattaac acgagtacct 7020 gacgaacggg ttcttgaaat gtatgatgca ttgcgtcctt tccgttcaac taagcaagaa 7080 ttattgaaca ttgcaaagga attacgggac aagtatgacg ctaatgtttg cgcagcatgg 7140 tttgaagaag ctgctgatta ttatgaaagt cgtaagaagc taaagggcga taactaagct 7200 ttttagtcag agtagggagt tttatgtatg gcaactgaaa aagtaattgg tgttgatatt 7260 gggaattctt ccactgaagt tgcattggca gatgtaagcg atagtgggca agttcacttt 7320 attaactctg gtattgctcc tactactggg attaaaggta ctaagcagaa tctagttgga 7380 attagggatt caattactca agttctgaat aaatctaatc tgacaatcga tgatattgat 7440 ttaattcgaa tcaatgaagc cacgccagta attggtgatg ttgcaatgga aactattaca 7500 gaaacagttg taacagaatc aacaatgatt gggcataatc ctaatacacc aggtggtata 7560 ggaacagggg ctgggataac agttcgtttg cttgatctct taaagaaaac tgataaaagc 7620 aaaaattata ttgttgtagt tcctaaggat attgattttg aagacgttgc taaacttatc 7680 aatgcttatg ttgcctctgg ttataaaata acagcagcaa ttctaagaaa cgatgatggt 7740 gttttagttg ataatcggtt aaatcataaa attccgattg tcgatgaagt tgctatgatt 7800 gacaaagttc cgttaaatat gctggcagct gtagaagttg ctggccctgg acaagtaatt 7860 tcacaacttt caaacccgta tggtatcgct accttatttg gactaactcc agaagagact 7920 aagaatattg ttccagtttc tcgagcgctt attggaaatc gttcggctgt tgttattaag 7980 actccagctg gggatgttaa agcgcgagta attccagcag gtaaaatcat aattaatggt 8040 gatactggaa aagaagaagt tggagtttct gaaggtgctg acgccattat gaaaaaggtt 8100 tctagtttcc gccatattaa caatataact ggtgagtctg gaaccaatgt tggaggaatg 8160 ttggaaaatg ttcgtcaaac aatggcagat cttacaggaa agaaaaatga tgaaattgct 8220 attcaagatt tacttgctgt tgatactcaa gtaccagttg aagttcgagg cggtctagct 8280 ggtgaattct caaatgaatc agcagttggg atcgcagcaa tggttaagtc agatcatctt 8340 caaatggaag ttattgctaa acttattgaa aaagaattta atacaaaggt tgaaattggt 8400 ggtgctgaag ttgaatctgc aattcgtgga gcattaacaa ctccaggaac agataagcca 8460 atcgcaatcc ttgatttagg tgctggctca acagatgctt caatcattaa taaagaaaat 8520 aatacagttg caattcactt agctggtgct ggtgatatgg taacgatgat tattaattct 8580 gaattaggat tgaatgatat tcatcttgca gaagacatca aacgctaccc attagcaaag 8640 gtagaaaacc tttttcaaat tcgacatgag gatggttcgg ttcaattctt taaagatccg 8700 cttccatcat cactgtttgc caaagttgta gtaattaaac cagatggata cgaaccagta 8760 actgggaatc caagcattga aaaaattaaa ttagtgcgtc aaagtgcaaa gaaacgagta 8820 tttgttacga acgctttacg ggcacttaag tatgttagtc caactggaaa tattcgtgat 8880 attccgtttg ttgtaattgt cggtggttca gccttagact ttgaaattcc acaacttgtt 8940 acagatgaat tagcacactt taatttagtt gctggtcgag gaaatgttcg tggagttgaa 9000 ggaccacgaa atgccgttgc aactggattg attttaaggt atggcgaaga aagaaggaag 9060 cgttatgaac aacgatgatt cacaacgtcc ctcgattgtc gtcggactag aaaatggaat 9120 aacgattcca gatagtgtca agccactttt ttatggaatt gaagaagaac agatcccagt 9180 ctcagttcgt aaaatcaata taaatgatac tgttgaaaga gcataccaat cagctcttgc 9240 atcaaggcta tctgtaggaa ttgcttttga aggagatcat tttattgttc actataagaa 9300 cttaaaagaa aatcagcctt tatttgatat gacaatcaat gataaaaagc aattacgaat 9360 tttaggagca aatgcagcga gattagtaaa aggaatccct tttaaggaaa tggcaaacag 9420 gtgatttaat tatgaagtct ttgggctatg tagaatgtaa tggattatct ggcgctattg 9480 tggctgctga caggatgcta aaaactgcag atgttgaact tagtagtatt caaaatacga 9540 aaggtaatgg atgggtcacc ttacaagttt ctggtgaact atcagctata actgttgcgg 9600 ttcaagctgt aaaagactat ttacctgatg tatatgtaac gtcagcgata atagggcgtc 9660 cagcaatagg gttgaactcc ttgggcaaaa cagatttatt gcaaccaaat ccagaaaagc 9720 agcaaaatat tgctgaaaag gaaaaggttg ctgaaccatc ttcaattaaa gaagagatag 9780 tacagaatag tgaaaattct gctgaaccta gtgttcaaac tgagcgatca ttagagggca 9840 aagatgaaat cgaagcttcg gattcgtcta atgataaaca agataccaac tctaatgata 9900 atgaagtcac atgcaatatg tgtggagatc caaaatgtcc acggaaatta ggagaaccgc 9960 ataagaagtg tatccattac aatgaattaa agaaaaagta ggaggaaata actatgaata 10020 acgctttagg aatgattgaa acacgcggat tagttgcatc tattgaagct gctgatcaaa 10080 tggtaaaggc tgctaatgta acattaactg gccaagaaaa gattggtagt ggattggtaa 10140 ctgttatgat tcgtggtgat gttggtgctg taaaggctgc cgttgatgct ggtgtacaag 10200 ctgctgaagg tgtcggcgaa gttgtatcgt cttacgtaat tcctcgtcca catgaagaag 10260 ttgaaaagat tttaccaggt ggatcagatt cagacgctga atagaaaatt ttaataaaaa 10320 ggaagattac gtatggatga agaacattta agaacactta tccggacgat tgttagagaa 10380 acacttaatc ctaacctagt tccaattggt gtttcaaatc accatgtaca tttgacggaa 10440 gaagactttc aaaagctatt ccctggtcaa aagattgaaa tgctaaagaa acttcgtcaa 10500 catgcggact ttgctgcaaa gcaaactgtt gatctgatcg ggcccaaagg caccattgaa 10560 catgttcgtc taatggggcc ataccgttca cactcacagg tagaaattgc ccgttcagaa 10620 aactttacac taggaattga tgctccaatt agaatgtctg gtgatcttga tggcacccct 10680 tcaattaagg ttcggtcacc atatgcggaa attgaaattc aaggtgtaat tgttgcaaag 10740 cgacacatcc acatgagttt agaagatgcc aagcgctttg gcgtaaagct cggtgattca 10800 atgcaggttg aagtagatgg cgatggtgga cgtaaaacca tttttgatga cgtagttgct 10860 cgccctcgtg aagactttgt ccttgaaatg catattgata ctgatgaagc caatgcagct 10920 aatgtcggac taggtaataa ttctttcgga aaagttatta tcaagaagaa aaactaactt 10980 tttgagaaac taataagggg gtgaatagat ggataaccta gtacaacagg ttatgcaacg 11040 attagaagaa cgaaagcata cgagcgttga agttactttt aatcatcaag ttgccccgcc 11100 tagtgaacag atttttttga gaaacggaaa agttattcta aaagatattt cgattgagtt 11160 aataacggac ttatattcaa tggaaaagac taacgcttgg gttaaatggg tgttagaagg 11220 aattagctat gatgttaaat tttacttttt aattaatgaa cagatggtta attttattcc 11280 acggatgatg attttggact ggccgatctt gtttgttgta aataacgaat cgccagtaat 11340 tgccagttat aatcggatta ttaccagaga agagatagct gctaaaccag ataaatcgat 11400 tcttgttaga tatcaaaagc aacatattac agatgaagca cttgatatct gtaactataa 11460 aaaaattaaa ataaagatta ggactgaaga aaattgtata tggcgagagt agtaggtagt 11520 gttgttgcaa cccaaaagga tccatcctta gttggaaaga aactaatgat agttcaacag 11580 attaattccg accaacaacc agttcgattt gaacaagttg ccgctgatac agtaaatgct 11640 gggattggtg ataatgtatt aatagttcgt ggtgctggtg caagacgtgc tgataaagag 11700 cgtgatgagg atcaagtaag ggacgttaat gactgtacga tagttggaat aattgaccgt 11760 tttgataagt agtgtgcatt ggaggcatca aaatggctat ttacacaaaa ggtggtgaca 11820 agggagaaac aagtttattc gatggaacga gggtacctaa ggattcatta cgagttgaaa 11880 cttatggaac ttttgatgaa ttaaacgcta atattagttt ggcagataaa ttctgtgaaa 11940 gtaaacgtaa taagaagctt ttacaagaga tcgaatataa aatgtttttc cttcaaggtg 12000 agatagcgac agaaaaacgg cagtatttta ctgataaaag taagattatt actgatgaag 12060 atactcgaaa acttgaaaag gttattgatg aatatacatc aaaactgcca cctgttcata 12120 gttttatctt acctggttcg agtactgcgg gtgcacaact tcatatttgt cgaacaatct 12180 gtcgtcgtgc agagcgacta tttgtgcggc tatcaaagaa tgtaaaattt cgtccagagc 12240 tagaaagata tattaatcgt ttgtcggatt ttttatatat tgtagcgcgt gatgaagact 12300 atgaagattt attaaatagt gtaactgatg acgtgttaaa aatttacaaa cgttatcaag 12360 aagaaaagga tgtgcgttaa gaatgaacga ggaacaaatt agtaagattg ttgaaaacgt 12420 aatcaagaat aatgcttcta aaaatctatt tgatcggcac aaaatggaaa aagtaatcga 12480 tgcggctgta gctcgtgcta atgaattggg tgttggagta acaattgcta ttatgaaagc 12540 tgatcaagta ttgcaaatga gctaccatat gccaaatgct aatttagtaa gttgtacttt 12600 agctcctaaa aaggcatggt cagcattagc aatgaaggaa cctaccaagg atattagtaa 12660 ggatatccaa ccaggtgccg gattatatca aatggaaaca atgcttgatg gtaagttagc 12720 atcttttgca ggtggtattc cattgaagat taacgatgaa attattggag cgattggtgt 12780 tagtggtgga ttggttgaag aagatcaatc aatttgtgaa gctgctgttg cagaattttt 12840 gaaggagagt aagtagatat gcagattaat gatattgaaa gtgctgtacg caaaattctt 12900 gccgaagaac tagataatgc cagctcttca agtgcaaacg ttgcagctac tactgataat 12960 ggtcatcgcg gaattttcac taatgtcaat gatgcaattg ctgctgcaaa agctgctcaa 13020 gaaatatatc gggataagcc aattgctgtt cgccaacaag tgattgatgc cattaaggaa 13080 ggattccgcc catatattga aaaaatggct aaagatatca aagaagaaac aggaatggga 13140 acagtagagg ccaaaattgc taagttaaac aatgccttgt acaacactcc tggtcccgag 13200 attcttgaac cagttgtaga aaacggtgac ggtgggatgg ttatgtatga acggttacca 13260 tatggtgtta ttggtgcggt tggcccaagt acaaaccctt cagaaactgt aattgctaat 13320 gcgatcatga tgcttgccgg tggtaatact ctttactttg gtgctcaccc tggcgcaaag 13380 aatgttactc gctggacaat tgaaaagatg aacgatttta ttgcagatgc aacaggcctt 13440 cataatttag ttgtaagtat tgaaacacca acaattgaat cagttcaaca aatgatgaag 13500 caccccgaca ttgcaatgtt agcagtaact ggtggcccag ctgttgttca ccaagcaatg 13560 accagtggta agaaagcggt tggtgctggt cctggtaatc ctcctgcaat ggttgatgct 13620 actgctgata ttgatttagc tgctcataat atcattacat ctgcttcatt tgataatgat 13680 attttatgta ctgctgaaaa ggaagtagtt gcagaaagta gcattaaaga tgaattaatt 13740 cgtaagatgc aagatgaagg tgcctttgta gttaaccgtg aacaagccga taaattagct 13800 gatatgtgta tccaagaaaa tggtgctcct gatcgtaaat ttgttggtaa ggatgcaact 13860 tatatcttag accaagctaa tattccttac acaggccacc cagttgaaat tatttgtgaa 13920 cttcctaagg aacatccatt agtaatgact gaaatgttaa tgccaatttt accagttgtt 13980 tcttgtccaa catttgatga tgttttgaag actgctgttg aagttgaaaa aggtaaccat 14040 cacacagcta ctattcattc caataacctt aagcatatta ataatgctgc tcaccggatg 14100 caatgttcaa tctttgttgt taatggccca tcctatgttg gtacaggtgt tgcagataat 14160 ggagctcact caggtgcttc agcattaaca attgctacgc caactggtga aggaacatgt 14220 actgcacgaa catttactcg tcgggttcgt ttgaactcac cacaaggatt ctcagtacgt 14280 aactggtatt aatgggaggc ataattccaa tggaaaaata tagtatgcca acccggattt 14340 attcgggaac agatagtttg aaagaactag agacacttaa taatgaacgt attttattag 14400 tctgtgattc tttcttgcct ggtagtgata ccttaaaaga aattgagagt cacattaagg 14460 ataataataa gtgtgaaatt ttctctgatg ttgtccccga tcctccacta gataagatta 14520 tggaaggggt tcaacaattc cttaaactta aaccaacaat tgtgattggt atcggtggcg 14580 gatcagcttt ggatactggt aagggaattc gtttctttgg tgaaaagttg ggcaagtgca 14640 agatcaatga atatattgct attccaacaa cgagtggtac tggttcagaa gttacgaata 14700 ctgcggttat ttctgatacg aaagaacatc gtaaaattcc tattttggaa gattatttga 14760 cacctgattg tgctttacta gatcctaaac tagttatgac tgctcctaag agtgtaactg 14820 catattcagg aatggatgtt ttaacacatg cacttgaatc tttggttgct aaggatgcaa 14880 atttattcac agttgcatta tcagaagaag caattgatgc cgttattaaa catttagttg 14940 agtgttatcg tcacggcgat aatgtggatg ctcgtaagat tgttcatgaa gcatcaaata 15000 ttgccggaac tgcatttaat attgctggat tagggatttg ccactcaatt gcgcatcaat 15060 tgggagctaa tttccacgtt ccccatggtt tagcaaatac aatgctcttg ccatatgtta 15120 tcgcatataa tgctgaacat agtgaagagg cattgcataa gtttgcaatt gctgctaaga 15180 aagctggaat tgctgctcct ggagtaggcg atcgtcttgc agtaaagcga ctaattgcta 15240 aaattaggga aatggcacga caaatgaatt gtccaatgac tcttcaagca ttcggtgttg 15300 atcctgctaa agctgaagaa ttagctgata ctgttgttgc aaatgcgaag aaagatgcaa 15360 cattccctgg caatccagtt gttccttcag ataatgatct gaagatggtt tacgaagcaa 15420 taattcgtta atttagttta tttggagtga tttgatgtca aaaaaaatac ttgcaattaa 15480 ttctggtagt tcatcaatta agttcaaact ttacttgatg ccagaggaga aactattaat 15540 tagtggttct gctgaaaatc ttggttcttc gacaagtcag ctttcatata aaactgataa 15600 aactaacgag acaagacaaa tccctttaaa aaaccactca gaggcaattg accatattat 15660 tgatgtttta atgtctagtg gggttgttaa ggataagtca gaaatttatg gtgttggtca 15720 ccggatttct catggcggaa gttactatac tcatgcagtg gcagtcactc cagaagttga 15780 aaaacggatt gatgaattga aggtgttatc acctctgcat aatccaaatg gactagcagg 15840 gataaaagcc tttgaaaagt ttcttccaga tgccaaggaa gtagttactt tcgataattc 15900 atttcatcat acaatcccta agaaagctta tatgtatgct ttgccatatg agttttatga 15960 aaagtatcaa attaggcgct acgggttcca tgccccttca catcagtatg tgtcagaaaa 16020 agcgcgtgaa ctttttggta aagaaaagac tcgtcgtatg atcacgtgtc atttgggaaa 16080 tggatcaagc gtttcggcga tcttagatgg aaagtcggtt aactcttcaa tgggctttac 16140 tccgttagca ggtgtagtga tgggaacgcg atgtggagat attgatccag aaattattcc 16200 ttttcttgaa gaagaactca atattgattc acatgaaatg cgtcgaataa tgaatgaaga 16260 ctcagggctt aaaggcttat ctgggatttc taatgatgaa cgtgagattg aaagtgcggc 16320 taaaaacggt aacgaacggg cacaattagc tttagatgta tttgtacatt caattcaaca 16380 atatattgga gcatatacaa cggatcttga tggattggat acattagtat ttacagccgg 16440 aattggtgaa catgctgctt atattagaag tcagatctgt aagaatttag actatcttgg 16500 agtcaaaatt gacgaagaga aaaataaaaa taatgagcta agcattgaag cacctgatag 16560 taaggttaaa atagctgtta ttccaactaa cgaagaaata attattgccc gtgatgtaat 16620 gaatgtaact cagcaataaa atggggatga tactatggct aggcaggata tcaaacggac 16680 aattcaagaa tatgttccgg gtaaacaggt aacattagca catatcgttg ctaaccctac 16740 gccagacatt tatgagaaat tagggataca aactcctaaa aatgcgcttg gtattttgac 16800 aataacgcca agtgaagcct caattatcgc tggggatatt gctacaaagt cgagtaatgt 16860 tactctaggg ttcattgatc gatttagtgg ctcggttgta attgtgggag aagtttctga 16920 aattgaatca gctttgcgtc atgtggttga taagctacaa acgttactgg ggtttgatgt 16980 tcctgaaatt acacgaacat aacattagaa gtgtattcat ttacgctaac gtgtagtaga 17040 tgaatacact ttttagaaag gagggagatg caatatggcg aatcatcagc gaattctagc 17100 gtttgaaaat ggatttaatt ttcgagatct tggtggttat agaactattg atggcgaaag 17160 tctgaaatgg aataatcttg ttcgttctgc gcatctctcc tattttacac ataatgagca 17220 aagaaaactt tatggatatg gtattaggac aattattgac tttcgttcaa cttccgaagt 17280 agctttttat cccgaccaat taacatcatt gatgaattat attcggatac cggtctttga 17340 gaatgacctt actgaaagta atattagtat tgctgaagca cgaaaaagtt tttcaaagga 17400 tccacaagcg ggttttaatc gcatgatgga agtatattgt caatttgtca ctgatgagaa 17460 agcacaagaa gcatttcaca cctttattaa aaaattatgc ctacattcag cgcagggtgg 17520 tgttttattt cattgctctg cggggaaaga ccgtactggt ttaggagcaa tttatttact 17580 aagtcttcta caagttccag tagatataat ttatcaagat tatattttaa ctaataaagc 17640 atcaacaaaa aggataaaag aacgattacg ttatgctata aaaaataacc taggtgataa 17700 ttatcttcac tcaatttacg atctttcaac agcaaatagg tgttattatg atcaagcaat 17760 ctctcttatt aataataaat atggtggaat gacctcttac ttaaaagatg tgttacaaat 17820 cagtgattca atggttgaac aactaagata cttatatctg acaaagtgaa tttaggctta 17880 gtaaaaatta aaagccattg atataataat ggctaaaaaa gaggctagaa ttgaatagcc 17940 tctttaacat acataattct tataggtgga tggtaataat gacaactttt ttttaattcg 18000 tcacggggaa acctatgcta atcgattaaa ttatatccaa ggtacattaa atgatagatt 18060 aacaagtctg accaaacagg gaatgctgga agcagcgaat tatcaaaaat tgtttgataa 18120 taatcaaatt gattatgtct atacaagtcc gttaaggcga gcagtaaaaa cggggcaaat 18180 aatttgtgct acgactaata ttaagttgca ggttgatgaa cgtctagcag aaatatctta 18240 cggtaaatgg aatggggcag atattagtaa attaaagcaa cagtattcga tgtattttga 18300 tgttgaaacg aatgacgtgc gaccacattc aattttgata aatcaaggcg aaaactttga 18360 acatgctcgt gcacgaatat ggtcattttt attggatact tcttataagt atccacaaca 18420 aaatatttta ataattacac atggctggat aataaaaaat atcatttcgt tgtgtcttga 18480 gaatattgat gggacttcat tcaaaaatcc caataatcta agtattagta agatccaatt 18540 gaatccggca ttaaagcagc aacgaatatg ttattataat cgaccgttca tagggacgat 18600 gatattatga gtcttattac aattcttttg atatttgtgg gacttaatat tgatacgttt 18660 attgcactat tatttctttt acgaaactat aattaccggt taccgattat tggctttgga 18720 gtagcaacgc ttattttatg gatctttggg gtaattttag gaaaagggct agcatttcta 18780 tttccagatt ggattacagg atttatgggc attattttaa tctttatagc gctttttgaa 18840 caggatgacg aaaaaaagac aactaataca agttttctct cattacttct gttttgttta 18900 agccttggtg gagataatct tgctgtttat attccattgg tggttaacct tagttggagt 18960 cagattatat acgtaggaat aatttttgaa atttgttcag tcctattaat tctattagga 19020 aaacaatttg ttttaataaa acctgtggca tatttgttgg aaaaatatgg taattttgga 19080 agcaaaattg tttatgtttt agcgggttta tatattattt ggaatagtca tttaattaat 19140 caccttatta gaatttttaa ttaagttcag caactaattt atcgatatta atattttcaa 19200 ctgccgaaac aggaattacc ttctttaccc cagcgcttaa cagaagattc ttggaatatt 19260 caatgtcggc agggtctttt acaagatcaa tctttgtaac tacacctaaa gtaggtttcg 19320 aaaacattga acagaagcca gccgggaaaa caagtcgttt gtcaaccgca ctttgtaata 19380 aaacaactat atcagcatcc atcgaggtta cacgtaacgt gctcatcata ttatgatgct 19440 ccatatattc tcctggtgtg tcaataatat ttgatgaaaa ttcaattgct tgtgttttat 19500 tatatttaat ttgttgattt tctaatcgtt gagtaagggt tgttttacca catgctattg 19560 ctccgataaa catagttcgt ttcataatta aatacctcca ccaattctac aaaaatatac 19620 tatttatctg tattataata aaagcggtta cacatagcca tagataaaaa aagattagtg 19680 aggaattata gatgctaaca gcacatgtag tttatgccac gatgactggt aataatgagg 19740 aagtagcaaa cattgtatgt gatagtttga ctaatttaaa tgttaaagtg acagagtctg 19800 agatatcaca aactgatgta gcagatttta tgaaggctga cattttagtt gtttgtgctt 19860 54 708 DNA Lactobacillus reuteri 54 atgcatggat ttattggcga attttttggc accatggttt taatcctatt aggagcagga 60 tgttgtgctg gtaatagttt gaataaaaca tatgggaaac aaagtggctg gtggtttatc 120 tgtatttcat ggggcttagc agttacaatg ggagtttatg ttgcaggatt tctgggttca 180 ttagggcact taaatcccgc tgtaacaatt ccttttgcta tttttggctt attcccatgg 240 agtaacgtta taccttactt acttggtcaa tttcttggtg cgtttgttgg tgcagtatta 300 gtaattattc aattctatcc acaatttaaa gcaaccccaa atgaagaaga aggaaataat 360 gttggtattt ttgctactcg tccagcgata aatagtccaa tttttaactt tttctcagaa 420 gtgattgcga cctttgcatt tattttcatc ttattaaatc ttggcaactt tacacaggga 480 ttgaagccat ttatcgtagg aatggttatt gcagttgttg gtacatgtct cgggacaact 540 actggctttg cattaaaccc agctcgtgat tggtcaccac gtttagcata tactattttg 600 ccaattccta ataagggtgt ttcagaatgg tggtatgcat gggttccaat gtgtggccca 660 attgttgggg gccttcttgc ttgtgcttta caaacggcac

tagtttag 708 55 834 DNA Lactobacillus reuteri 55 atgaaaaaag aatttttaaa aagtagtaat gaacaattaa aaaaattttc cgagattgtt 60 aatggggata agcctttacg taaagttacg gctgatgaaa agctaaaggt cggtgtagat 120 ttaggaactt cttcaattgt tttaacagtg ctggattcca aagataagat tgtatacgga 180 gcgtatgaat atgaccatgc agttcaagat ggtattgtag ttaatttcat ggaatcagtt 240 aatattttaa gacgcttaaa agaaaaagct gagaaagtat taggacgtga acttaaaacg 300 gcatgtggtg ctattccacc gaagacagga gagaagagtg ccaaagtggt tgctaatgtt 360 atcgaagaga caggcttgct ttgtacaggt gttgaagatg aaccgacagc agctgcgaag 420 ttcttaagat tgtcaaatgg tacagttgta gatattggag gaggaacaac tgggattagt 480 atttttaaag ataacaagct catccatgtt attgatgaag caacaggcgg atttcatatg 540 acgcttgttc ttggaggaag atataaaata aaaaatgatg aagcagaaaa attaaagcgt 600 aacaagaata aagaatctga agtatatgct gttattaaac ctgtagttga gaaaatggca 660 gcaattgttc aaaatatggg agtagaaatt attgatccag taatagtggt gggaggtgca 720 actaacttta ctgaatttac aacaaccttt agtaaagatt taaagcgtaa agtttataaa 780 ccgctttatc ctcaatttgt tacgccacta gggattgcaa tgtttgatga ttag 834 56 1080 DNA Lactobacillus reuteri 56 atgtacgaat attcttcaaa attcttgaat gacattcaaa aggtaacaaa aacatttcag 60 gaaataacca ataataatat aattttcaca agcattaccg gagcaattgt tgattgcaac 120 acccttcttt ttgactcaaa tatttcactt gaacatttac gaaaactcga ttttaaaaat 180 tactttgttt ttccactagt tataagctca tctttaagtg gtttctttgt tcttgatgaa 240 tcacatatag aatcagacgc tattgattta tgtagtaaat atattgaaat ttcttgcaaa 300 aattttattg acagttccaa tgactgcata gctgtcctta ccccattcga ggctcctaag 360 ctaagttcac taatcaaagt ccttaatggg attttgaata tttctggaga tgattcaata 420 gctaacgtta ctaatcctcc tattcttaat aacagaaatg atggtactct aagtgatatt 480 gaaaaaaata taaccatggc gcttaaatac attaattcca atttagaaaa atcgcttact 540 ttagaaaacg tttctcaaag gatttatctc tcaccatcat acttaagtcg aatctttaaa 600 aattatttta atgacaattt tattaactat ataaatctac aaaaaattgc acttgctcaa 660 gaaaaattaa ttttttcaaa tacaccaatt aataaattgg ctcatcaagt tggtttttca 720 cagacaagtt actttactaa aattttcaag caaaaagtag gaatgacacc atcaaagtat 780 cgaaaatata attccgcaat aaagaaaatc tatactattc caagagattt acaatggcgc 840 tcaaataagt ccgtttatga aatctcaaaa gattttttca ataaaaatga tatttccttt 900 aaagcccgtg atttaaatgg gtatccatat atctattcaa taaatgatct gaatgatgtt 960 agtaataaag caggttgggt ctatacagta gattgttctc aacctattat tccagctagt 1020 gagattaatg tatttgatcg ttcagtaatt caatggattt atactgaaaa aattatttaa 1080 57 282 DNA Lactobacillus reuteri 57 atgggacaag aagcacttgg tttaattgaa accgaaggac ttgtagcttc aattgaagct 60 gctgatgcaa tggtaaaagc tgctaatgtt aaattaattg gtcaagaaaa gattggtcat 120 ggattagtca cagtaatggt tcgtggtgat gttggagctg ttaaggcttc agttgatgcc 180 ggagtacaag ctgccgaaaa tattggagaa gttgtttcga gttacgtaat tcctcgtcct 240 caatctgaag ttgataagct cttaccgcat catggagaat aa 282 58 717 DNA Lactobacillus reuteri 58 atgaatgatt ttctgaattc tactagtact gttccagaat ttgttggtgc tagcgaaatt 60 ggagatacca ttggaatggt aattccgaga gttgatcaac aactattaga taaattacac 120 gttacaaaac aatacaagac tttaggtatt ttgagtgatc gtactggtgc tggtccacaa 180 attatggcaa tggatgaagg aattaaggct actaacatgg aatgtattga tgttgaatgg 240 ccacgtgata ctaaaggtgg aggaggccat ggatgtttaa ttatcatcgg tggtgatgat 300 cctgcagatg cacgccaagc tattcgggtt gcacttgata atcttcatcg tacatttggt 360 gacgtttata acgccaaagc gggtcacctt gaattacaat ttacagctcg tgctgcaggt 420 gctgcacatc ttggattagg tgcagttgaa gggaaagcat ttgggttgat ttgtggttgt 480 ccttccggga ttggtgtcgt gatgggagat aaggctttaa agactgctgg tgttgaaccg 540 cttaacttta cttcaccaag tcatggtaca agtttctcta acgaaggttg cctaactatt 600 accggtgact caggagctgt tcgtcaagct gttatggctg gacgtgaagt aggattaaag 660 ttattgtcac agtttggtga agaaccagtt aatgatttcc catcatacat taagtag 717 59 570 DNA Lactobacillus reuteri 59 atgaagtctt tgggctatgt agaatgtaat ggattatctg gcgctattgt ggctgctgac 60 aggatgctaa aaactgcaga tgttgaactt agtagtattc aaaatacgaa aggtaatgga 120 tgggtcacct tacaagtttc tggtgaacta tcagctataa ctgttgcggt tcaagctgta 180 aaagactatt tacctgatgt atatgtaacg tcagcgataa tagggcgtcc agcaataggg 240 ttgaactcct tgggcaaaac agatttattg caaccaaatc cagaaaagca gcaaaatatt 300 gctgaaaagg aaaaggttgc tgaaccatct tcaattaaag aagagatagt acagaatagt 360 gaaaattctg ctgaacctag tgttcaaact gagcgatcat tagagggcaa agatgaaatc 420 gaagcttcgg attcgtctaa tgataaacaa gataccaact ctaatgataa tgaagtcaca 480 tgcaatatgt gtggagatcc aaaatgtcca cggaaattag gagaaccgca taagaagtgt 540 atccattaca atgaattaaa gaaaaagtag 570 60 291 DNA Lactobacillus reuteri 60 atgaataacg ctttaggaat gattgaaaca cgcggattag ttgcatctat tgaagctgct 60 gatcaaatgg taaaggctgc taatgtaaca ttaactggcc aagaaaagat tggtagtgga 120 ttggtaactg ttatgattcg tggtgatgtt ggtgctgtaa aggctgccgt tgatgctggt 180 gtacaagctg ctgaaggtgt cggcgaagtt gtatcgtctt acgtaattcc tcgtccacat 240 gaagaagttg aaaagatttt accaggtgga tcagattcag acgctgaata g 291 61 645 DNA Lactobacillus reuteri 61 atggatgaag aacatttaag aacacttatc cggacgattg ttagagaaac acttaatcct 60 aacctagttc caattggtgt ttcaaatcac catgtacatt tgacggaaga agactttcaa 120 aagctattcc ctggtcaaaa gattgaaatg ctaaagaaac ttcgtcaaca tgcggacttt 180 gctgcaaagc aaactgttga tctgatcggg cccaaaggca ccattgaaca tgttcgtcta 240 atggggccat accgttcaca ctcacaggta gaaattgccc gttcagaaaa ctttacacta 300 ggaattgatg ctccaattag aatgtctggt gatcttgatg gcaccccttc aattaaggtt 360 cggtcaccat atgcggaaat tgaaattcaa ggtgtaattg ttgcaaagcg acacatccac 420 atgagtttag aagatgccaa gcgctttggc gtaaagctcg gtgattcaat gcaggttgaa 480 gtagatggcg atggtggacg taaaaccatt tttgatgacg tagttgctcg ccctcgtgaa 540 gactttgtcc ttgaaatgca tattgatact gatgaagcca atgcagctaa tgtcggacta 600 ggtaataatt ctttcggaaa agttattatc aagaagaaaa actaa 645 62 504 DNA Lactobacillus reuteri 62 atggataacc tagtacaaca ggttatgcaa cgattagaag aacgaaagca tacgagcgtt 60 gaagttactt ttaatcatca agttgccccg cctagtgaac agattttttt gagaaacgga 120 aaagttattc taaaagatat ttcgattgag ttaataacgg acttatattc aatggaaaag 180 actaacgctt gggttaaatg ggtgttagaa ggaattagct atgatgttaa attttacttt 240 ttaattaatg aacagatggt taattttatt ccacggatga tgattttgga ctggccgatc 300 ttgtttgttg taaataacga atcgccagta attgccagtt ataatcggat tattaccaga 360 gaagagatag ctgctaaacc agataaatcg attcttgtta gatatcaaaa gcaacatatt 420 acagatgaag cacttgatat ctgtaactat aaaaaaatta aaataaagat taggactgaa 480 gaaaattgta tatggcgaga gtag 504 63 273 DNA Lactobacillus reuteri 63 atggcgagag tagtaggtag tgttgttgca acccaaaagg atccatcctt agttggaaag 60 aaactaatga tagttcaaca gattaattcc gaccaacaac cagttcgatt tgaacaagtt 120 gccgctgata cagtaaatgc tgggattggt gataatgtat taatagttcg tggtgctggt 180 gcaagacgtg ctgataaaga gcgtgatgag gatcaagtaa gggacgttaa tgactgtacg 240 atagttggaa taattgaccg ttttgataag tag 273 64 609 DNA Lactobacillus reuteri 64 gtgtgcattg gaggcatcaa aatggctatt tacacaaaag gtggtgacaa gggagaaaca 60 agtttattcg atggaacgag ggtacctaag gattcattac gagttgaaac ttatggaact 120 tttgatgaat taaacgctaa tattagtttg gcagataaat tctgtgaaag taaacgtaat 180 aagaagcttt tacaagagat cgaatataaa atgtttttcc ttcaaggtga gatagcgaca 240 gaaaaacggc agtattttac tgataaaagt aagattatta ctgatgaaga tactcgaaaa 300 cttgaaaagg ttattgatga atatacatca aaactgccac ctgttcatag ttttatctta 360 cctggttcga gtactgcggg tgcacaactt catatttgtc gaacaatctg tcgtcgtgca 420 gagcgactat ttgtgcggct atcaaagaat gtaaaatttc gtccagagct agaaagatat 480 attaatcgtt tgtcggattt tttatatatt gtagcgcgtg atgaagacta tgaagattta 540 ttaaatagtg taactgatga cgtgttaaaa atttacaaac gttatcaaga agaaaaggat 600 gtgcgttaa 609 65 474 DNA Lactobacillus reuteri 65 atgaacgagg aacaaattag taagattgtt gaaaacgtaa tcaagaataa tgcttctaaa 60 aatctatttg atcggcacaa aatggaaaaa gtaatcgatg cggctgtagc tcgtgctaat 120 gaattgggtg ttggagtaac aattgctatt atgaaagctg atcaagtatt gcaaatgagc 180 taccatatgc caaatgctaa tttagtaagt tgtactttag ctcctaaaaa ggcatggtca 240 gcattagcaa tgaaggaacc taccaaggat attagtaagg atatccaacc aggtgccgga 300 ttatatcaaa tggaaacaat gcttgatggt aagttagcat cttttgcagg tggtattcca 360 ttgaagatta acgatgaaat tattggagcg attggtgtta gtggtggatt ggttgaagaa 420 gatcaatcaa tttgtgaagc tgctgttgca gaatttttga aggagagtaa gtag 474 66 348 DNA Lactobacillus reuteri 66 atggctaggc aggatatcaa acggacaatt caagaatatg ttccgggtaa acaggtaaca 60 ttagcacata tcgttgctaa ccctacgcca gacatttatg agaaattagg gatacaaact 120 cctaaaaatg cgcttggtat tttgacaata acgccaagtg aagcctcaat tatcgctggg 180 gatattgcta caaagtcgag taatgttact ctagggttca ttgatcgatt tagtggctcg 240 gttgtaattg tgggagaagt ttctgaaatt gaatcagctt tgcgtcatgt ggttgataag 300 ctacaaacgt tactggggtt tgatgttcct gaaattacac gaacataa 348 67 795 DNA Lactobacillus reuteri 67 atggcgaatc atcagcgaat tctagcgttt gaaaatggat ttaattttcg agatcttggt 60 ggttatagaa ctattgatgg cgaaagtctg aaatggaata atcttgttcg ttctgcgcat 120 ctctcctatt ttacacataa tgagcaaaga aaactttatg gatatggtat taggacaatt 180 attgactttc gttcaacttc cgaagtagct ttttatcccg accaattaac atcattgatg 240 aattatattc ggataccggt ctttgagaat gaccttactg aaagtaatat tagtattgct 300 gaagcacgaa aaagtttttc aaaggatcca caagcgggtt ttaatcgcat gatggaagta 360 tattgtcaat ttgtcactga tgagaaagca caagaagcat ttcacacctt tattaaaaaa 420 ttatgcctac attcagcgca gggtggtgtt ttatttcatt gctctgcggg gaaagaccgt 480 actggtttag gagcaattta tttactaagt cttctacaag ttccagtaga tataatttat 540 caagattata ttttaactaa taaagcatca acaaaaagga taaaagaacg attacgttat 600 gctataaaaa ataacctagg tgataattat cttcactcaa tttacgatct ttcaacagca 660 aataggtgtt attatgatca agcaatctct cttattaata ataaatatgg tggaatgacc 720 tcttacttaa aagatgtgtt acaaatcagt gattcaatgg ttgaacaact aagatactta 780 tatctgacaa agtga 795 68 321 DNA Lactobacillus reuteri 68 atgtattttg atgttgaaac gaatgacgtg cgaccacatt caattttgat aaatcaaggc 60 gaaaactttg aacatgctcg tgcacgaata tggtcatttt tattggatac ttcttataag 120 tatccacaac aaaatatttt aataattaca catggctgga taataaaaaa tatcatttcg 180 ttgtgtcttg agaatattga tgggacttca ttcaaaaatc ccaataatct aagtattagt 240 aagatccaat tgaatccggc attaaagcag caacgaatat gttattataa tcgaccgttc 300 atagggacga tgatattatg a 321 69 558 DNA Lactobacillus reuteri 69 atgagtctta ttacaattct tttgatattt gtgggactta atattgatac gtttattgca 60 ctattatttc ttttacgaaa ctataattac cggttaccga ttattggctt tggagtagca 120 acgcttattt tatggatctt tggggtaatt ttaggaaaag ggctagcatt tctatttcca 180 gattggatta caggatttat gggcattatt ttaatcttta tagcgctttt tgaacaggat 240 gacgaaaaaa agacaactaa tacaagtttt ctctcattac ttctgttttg tttaagcctt 300 ggtggagata atcttgctgt ttatattcca ttggtggtta accttagttg gagtcagatt 360 atatacgtag gaataatttt tgaaatttgt tcagtcctat taattctatt aggaaaacaa 420 tttgttttaa taaaacctgt ggcatatttg ttggaaaaat atggtaattt tggaagcaaa 480 attgtttatg ttttagcggg tttatatatt atttggaata gtcatttaat taatcacctt 540 attagaattt ttaattaa 558 70 429 DNA Lactobacillus reuteri 70 atgaaacgaa ctatgtttat cggagcaata gcatgtggta aaacaaccct tactcaacga 60 ttagaaaatc aacaaattaa atataataaa acacaagcaa ttgaattttc atcaaatatt 120 attgacacac caggagaata tatggagcat cataatatga tgagcacgtt acgtgtaacc 180 tcgatggatg ctgatatagt tgttttatta caaagtgcgg ttgacaaacg acttgttttc 240 ccggctggct tctgttcaat gttttcgaaa cctactttag gtgtagttac aaagattgat 300 cttgtaaaag accctgccga cattgaatat tccaagaatc ttctgttaag cgctggggta 360 aagaaggtaa ttcctgtttc ggcagttgaa aatattaata tcgataaatt agttgctgaa 420 cttaattaa 429 71 65 DNA Artificial Synthetic DNA 71 atggaccgca ttattcaatc accgggtaaa tacatccagg gcgctgatgt gattaatcgt 60 taacc 65 72 58 DNA Artificial synthetic DNA 72 ctgggcgaat acctgaagcc gctggcagaa cgctggttag tggtgggtga caaatttg 58 73 1257 DNA Artificial synthetic DNA 73 atggaccgca ttattcaatc accgggtaaa tacatccagg gcgctgatgt gattaatcgt 60 taaccatgtt caaaacgacg ctctgcgcct tattaattac cgcctcttgc tccacatttg 120 ctgcccctca acaaatcaac gatattgtgc atcgcacaat taccccgctt atagagcaac 180 aaaagatccc gggtatggcg gtggcggtaa tttatcaggg taaaccttat tactttacct 240 ggggctatgc ggacatcgcc aaaaagcagc ccgtcacaca gcaaacgttg tttgagttag 300 gttcggtcag caaaacattt actggcgtgc ttggtggcga cgctattgct cgaggggaaa 360 tcaagttaag cgatcccaca acaaaatact ggcctgaact taccgctaaa cagtggaatg 420 ggatcacact attacatctc gcaacctaca ctgctggcgg cctgccattg caggtgccgg 480 atgaggtgaa atcctcaagc gacttgctgc gcttctatca aaactggcag cctgcatggg 540 ctccaggaac acaacgtctg tatgccaact ccagtatcgg tttgttcggc gcactggctg 600 tgaagccgtc tggtttgagt tttgagcagg cgatgcaaac tcgtgtcttc cagccactca 660 aactcaacca tacgtggatt aatgtaccgc ccgcagaaga aaagaattac gcctggggat 720 atcgcgaagg taaggcagtg catgtttcgc ctggggcgtt agatgctgaa gcttatggtg 780 tgaagtcgac cattgaagat atggcccgct gggtgcaaag caatttaaaa ccccttgata 840 tcaatgagaa aacgcttcaa caagggatac aactggcaca atctcgctac tggcaaaccg 900 gcgatatgta tcagggcctg ggctgggaaa tgctggactg gccggtaaat cctgacagca 960 tcattaacgg cagtgacaat aaaattgcac tggcagcacg ccccgtaaaa gcgattacgc 1020 ccccaactcc tgcagtacgc gcatcatggg tacataaaac aggggcgacc ggcggatttg 1080 gtagctatgt cgcgtttatt ccagaaaaag agctgggtat cgtgatgctg gcaaacaaaa 1140 actatcccaa tccagcgaga gtcgacgccg cctggcagat tcttaacgct ctacagtaac 1200 tgggcgaata cctgaagccg ctggcagaac gctggttagt ggtgggtgac aaatttg 1257 74 50 DNA Artificial synthetic DNA 74 ggaatttagg tttttcgcaa accagctatt tttgcaaagt gtttcgccag 50 75 50 DNA Artificial synthetic DNA 75 atcgataccc ccggggaata tctggaaaac cgctgcctgt acagtgcact 50




You can also Monitor Keywords and Search for tracking patents relating to this Process for producting 1,3-propanediol and or/3-hydroxypropionic acid patent application.
###
monitor keywords



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Process for producting 1,3-propanediol and or/3-hydroxypropionic acid or other areas of interest.
###




###

FreshPatents.com Support - Terms & Conditions
Thank you for viewing the Process for producting 1,3-propanediol and or/3-hydroxypropionic acid patent info.
- - - AAPL - Apple, BA - Boeing, GOOG - Google, IBM, JBL - Jabil, KO - Coca Cola, MOT - Motorla

Results in 0.90371 seconds


Other interesting Freshpatents.com categories:
Software:  Finance AI Databases Development Document Navigation Error g2