| Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer -> Monitor Keywords |
|
|
  Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancerUSPTO Application #: 20060040278Title: Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer Abstract: Novel markers for ovarian cancer that are both sensitive and accurate. These markers are overexpressed and/or differentially expressed in ovarian cancer specifically, as opposed to normal ovarian tissue. The measurement of these markers, alone or in combination, in patient samples provides information that the diagnostician can correlate with a probable diagnosis, in ovarian cancer. The markers of the present invention, alone or in combination, show a high degree of differential detection between ovarian cancer and non-cancerous states. (end of abstract) Agent: Staas & Halsey LLP - Washington, DC, US Inventors: Gad S. Cojocaru, Sarah Pollock, Zurit Levine, Alexander Diber, Guy Kol, Amir Toporik, Rotem Sorek, Dvir Dahary, Michal Ayalon-Soffer, Pinchas Akiva, Amit Novik, Yossi Cohen, Osnat Sella-Tavor, Shira Walach, Shirley Sameah-Greenwald, Ronen Shemesh, Maxim Shklar USPTO Applicaton #: 20060040278 - Class: 435006000 (USPTO) Related Patent Categories: Chemistry: Molecular Biology And Microbiology, Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip, Involving Nucleic Acid The Patent Description & Claims data below is from USPTO Patent Application 20060040278. Brief Patent Description - Full Patent Description - Patent Application Claims
CROSS-REFERENCE TO RELATED APPLICATION(S) [0001] This application is related to novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer, and claims priority to the below U.S. Provisional Applications which are incorporated by reference herein: [0002] Application No. 60/620,916 filed Oct. 22, 2004--Differential Expression of Markers in Colon Cancer [0003] Application No. 60/628,123 filed Nov. 17, 2004--Differential Expression of Markers in Colon Cancer II [0004] Application No. 60/621,131 filed Oct. 25, 2004--Diagnostic Markers for Colon Cancer, and Assays and Methods of Use Thereof [0005] Application No. 60/620,917 filed Oct. 22, 2004--Differential Expression of Markers in Breast Cancer [0006] Application No. 60/628,101 filed Nov. 17, 2004--Differential Expression of Markers in Breast Cancer II [0007] Application No. 60/620,874 filed Oct. 22, 2004--Differential Expression of Markers in Ovarian Cancer [0008] Application No. 60/628,134 filed Nov. 17, 2004--Differential Expression of Markers in Ovarian Cancer II [0009] Application No. 60/620,924 filed Oct. 22, 2004--Differential Expression of Markers in Stomach Cancer [0010] Application No. 60/628,111 filed Nov. 17, 2004--Differential Expression of Markers in Stomach Cancer II [0011] Application No. 60/620,853 filed Oct. 22, 2004-28814--Differential Expression of Markers in Lung Cancer [0012] Application No. 60/628,112 filed Nov. 17, 2004--Differential Expression of Markers in Lung Cancer II [0013] Application No. 60/620,974 filed Oct. 22, 2004--Differential Expression of Markers in Pancreatic Cancer [0014] Application No. 60/628,145 filed Nov. 17, 2004--Differential Expression of Markers in Pancreatic Cancer II [0015] Application No. 60/620,656 filed Oct. 22, 2004--Differential Expression of Markers in Prostate Cancer [0016] Application No. 60/628,251 filed Nov. 17, 2004--Differential Expression of Markers in Prostate Cancer II [0017] Application No. 60/620,975 filed Oct. 22, 2004--Differential Expression of Markers in Brain Cancer [0018] Application No. 60/628,178 filed Nov. 17, 2004--Differential Expression of Markers in Brain Cancer II [0019] Application No. 60/622,320 filed Oct. 27, 2004--Diagnostic Markers for Cardiac Disease and/or Pathological Conditions, and Assays and Methods of Use Thereof [0020] Application No. 60/628,190 filed Nov. 17, 2004--Diagnostic Markers for Cardiac Disease and/or Pathological Conditions, and Assays and Methods of Use Thereof II [0021] Application No. 60/630,559 filed Nov. 26, 2004--Diagnostic Markers for Cardiac Disease and/or Pathological Conditions, and Assays and Methods of Use Thereof II [0022] Application No. 60/628,231 filed Nov. 17, 2004--Novel Diagnostic Serum Markers, and Assays and Methods of Use Thereof [0023] Application No. 60/620,918 filed Oct. 22, 2004--Diagnostic Markers for Renal Cancer, and Assays and Methods of Use Thereof [0024] Application No. 60/628,156 filed Nov. 17, 2004--Diagnostic Markers for Renal Cancer, and Assays and Methods of Use Thereof II [0025] Application No. 60/620,677 filed Oct. 22, 2004--Differential Expression of Markers in Bladder Cancer [0026] Application No. 60/628,167 filed Nov. 17, 2004--Differential Expression of Markers in Bladder Cancer II [0027] Application No. 60/621,004 filed Oct. 22, 2004--Differential Expression of Markers in Skin and Epithelial Cancer II [0028] Application No. ______ filed Nov. 17, 2004--Novel Diagnostic Markers, and Assays and Methods of Use Thereof [0029] Application No. 60/622,017 filed Oct. 27, 2004--Variants of Nonspecific Alkaline Phosphatase, Use of Diagnostic Markers, and Assays and Methods of Use Thereof [0030] Application No. 60/539,129 filed Jan. 27, 2004--Methods and Systems for Annotating Biomolecular Sequences [0031] Application No. 60/539,128 filed Jan. 27, 2004--Evolutionary Conserved Spliced Sequences and Methods and Systems for Identifying Thereof FIELD OF THE INVENTION [0032] The present invention is related to novel nucleotide and protein sequences that are diagnostic markers for ovarian cancer, and assays and methods of use thereof. BACKGROUND OF THE INVENTION [0033] Ovarian cancer causes more deaths than any other cancer of the female reproductive system. An estimated 25,580 new cases will be diagnosed during 2004 in the United States, and approximately 16,090 of these women will die of the disease. Despite advances in the management of advanced ovarian cancer, 70% to 80% of patients will ultimately succumb to disease that is diagnosed in late stages. When ovarian cancer is diagnosed in stage I, more than 90% of patients can be cured with conventional surgery and chemotherapy. At present, however, only 25% of ovarian cancers are detected in stage I. Detection of a greater fraction of ovarian cancers at an early stage might significantly affect survival. A worldwide research effort, aiming at early detection of ovarian cancer, is currently being performed; finding molecular markers for the disease is one of the major research topics (J Clin Oncol. 2003 May 15; 21(10 Suppl):200-5). [0034] No single marker has been shown to be sufficiently sensitive or specific to contribute to the diagnosis of ovarian cancer. The marker that is currently most frequently used is CA-125 (Br J Cancer. 2000 May; 82(9):1535-8). Its properties do not support its use for screening, but it is a major diagnostic tool. CA-125 is a member of the epithelial sialomucins markers group and is the most well documented and the best performing single marker from this group. Another name for CA-125 is mucin 16, and although it is a membrane protein, it can be found in the serum. Its greatest sensitivity is achieved for serous and emdometrioid ovarian tumors compared to mucinous or clear cell tumors. Other than diagnosis, it can be used for disease monitoring (Eur J Gynaecol Oncol. 2000; 21(1):64-9). In about 70% of patients, a rising level of CA-125 may be the first indication of relapse, predating clinical relapse by a median of 4 months. The serum concentration of CA-125 is elevated by the vascular invasion, tissue destruction and inflammation associated with malignant disease and is elevated in over 90% of those women with advanced ovarian cancer. Yet, CA-125 is not specific to ovarian cancer. It is elevated in 40% of all patients with advanced intra-abdominal malignancy. Levels can also be elevated during menstruation or pregnancy and in other benign conditions such as endometriosis, peritonitis or cirrhosis, particularly with ascites. CA-125 is not a marker that can be detected through use of urine samples due to a high molecular weight. [0035] There are other ovarian cancer markers originating from epithelial mucins but none can replace CA-125, due to poorer specificity and sensitivity. These other markers may prove complementary to CA-125. CA-50, CA 54-61, CA-195 and CA 19-9 all appear to have greater sensitivity for detection of mucinous tumors while STN and TAG-72 have better sensitivity for detection of clear cell tumors (Dis Markers. 2004; 20(2):53-70). [0036] Kallikreins, a family of serine proteases, and other protease-related proteins are also potential markers for ovarian cancer. Indeed, the entire family of kallikreins map to a region on chromosome 19q which is shown to be amplified in ovarian cancers. In particular, kallikrein 6 (protease M) and kallilrein 10 have been reported to have sensitivity up to 75% and specificity up to 100%. Matrix metalloproteinases (MMPs) are another family of proteases useful in ovarian cancer screening and prognosis. MMP-2 was reported to have 66% sensitivity and 100% specificity in one study. Cathepsin L, a cystein protease, was described to have a lower false positive rate compared with CA-125. Based on their biochemical proteolytic role, it would seem likely that these proteases would be active in invasion and metastasis formation and indeed these markers appear to have higher sensitivity for advanced stages of the disease. Due to their relatively low molecular weight, such proteases are candidates to be urine markers, or markers which can be detected in urine samples (Dis Markers. 2004; 20(2):53-70). [0037] Hormones have a role in normal ovarian physiology. Therefore, it is not surprising that hormones, and growth and inhibition factors as well, are suitable for ovarian cancer detection. Measurements of fragments of gonadotropin in the urine were found to have sensitivity up to 83% and specificity up to 92% for detecting ovarian cancer. Inhibins, members of the Transforming Growth Factors (TGF) beta superfamily, have been shown to have a diagnostic value in the detection of granulosa cell tumor, a relatively uncommon type of ovarian cancer, associated with better prognosis overall. Serum inhibin is an ovarian product which decreases to non detectable levels after menopause, however, certain ovarian cancers (mucinous carcinomas and sex cord stromal tumours such as granulosa cell tumours) continue to produce inhibin. Studies have shown that that inhibin assays which detect all inhibin forms (as opposed to test detecting specific members of the inhibins family) provide the highest sensitivity/specificity characteristics as an ovarian cancer diagnostic test (Mol Cell Endocrinol. 2002 May 31; 191(1):97-103). Measurement of serum TGF-alpha itself was found to have sensitivity up to 70% and specificity of 89% in early stage disease. The growth factor Mesothelin was also found to have diagnostic value but only for late stage disease. [0038] Immunohistochemistry is frequently used to assess the origin of tumor and staging when a pathological tissue sample is available. A few molecular markers have been shown to have diagnostic value in Immunohistochemistry of ovarian cancer, among them Epidermal Growth Factor, p53 and HER-2. P53 expression is much lower at early stage than late stage disease. P53 high expression is more typical or characteristic of invasive serous tumors than of mucinous tumors. No benign tumors are stained with P53. HER-2 is found in less than 25% of newly diagnosed ovarian cancers. Ovarian cancer of type granulosa cell tumor has in general better prognosis with late relapse and/or metastasis formation. However, about 50% of patients still die within 20 years of diagnosis. In this specific tumor type, immunohistochemistry staining of estrogen receptor beta (ERb) and proliferating cell nuclear antigen (PCNA) showed that loss of ERb expression and high PCNA expression, characterized a subgroup of granulosa cell tumors with a worse outcome (Histopathology. 2003 September; 43(3):254-62). Survivin expression was also shown to be correlated to tumor grade, histologic type and mutant p53, but actual correlation to survival is questionable (Mod Pathol. 2004 February; 17(2):264) [0039] Many other markers have been tested over the years for ovarian cancer detection. Some markers have shown only limited value while others are still under investigation. Among them are TPA and TPS, two cytokeratins whose inclusion in a panel with CA-125 resulted in diagnoses with sensitivity up to 93% and specificity up to 98%. LPA--lysophosphatidic acid--was a very promising marker with one study demonstrating 98% sensitivity and 90% specificity. However, this marker is very unstable and requires quick processing and freezing of plasma, and therefore has limited usage. [0040] As previously described, no single marker has been shown to be sufficiently sensitive or specific to contribute to the diagnosis of ovarian cancer. Therefore combinations of markers in panel are being tested. Usually CA-125 is one of the panel members. The best performing panel combinations so far have been CA-125 with CA 15-3 with sensitivity of 93% and specificity of 93%, CA-125 with CEA (which has very little sensitivity by itself) with specificity of 93% and specificity of 93%, and CA-125 with TAG-72 and CA 15-3 where specificity becomes 95% but sensitivity is diminished (Dis Markers. 2004; 20(2):53-70). SUMMARY OF THE INVENTION [0041] The background art does not teach or suggest markers for ovarian cancer that are sufficiently sensitive and/or accurate, alone or in combination. [0042] The present invention overcomes these deficiencies of the background art by providing novel markers for ovarian cancer that are both sensitive and accurate. These markers are differentially expressed and preferably overexpressed in ovarian cancer specifically, as opposed to normal ovarian tissue. The measurement of these markers, alone or in combination, in patient (biological) samples provides information that the diagnostician can correlate with a probable diagnosis of ovarian cancer. The markers of the present invention, alone or in combination, show a high degree of differential detection between ovarian cancer and non-cancerous states. [0043] According to preferred embodiments of the present invention, examples of suitable biological samples which may optionally be used with preferred embodiments of the present invention include but are not limited to blood, serum, plasma, blood cells, urine, sputum, saliva, stool, spinal fluid or CSF, lymph fluid, the external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, milk, neuronal tissue, ovarian tissue, any human organ or tissue, including any tumor or normal tissue, any sample obtained by lavage (for example of the bronchial system or of the female reproductive system), and also samples of in vivo cell culture constituents. In a preferred embodiment, the biological sample comprises ovarian tissue and/or a serum sample and/or a urine sample and/or secretions or other samples from the female reproductive system and/or any other tissue or liquid sample. The sample can optionally be diluted with a suitable eluant before contacting the sample to an antibody and/or performing any other diagnostic assay. [0044] Information given in the text with regard to cellular localization was determined according to four different software programs: (i) tmhmm (from Center for Biological Sequence Analysis, Technical University of Denmark DTU, http://www.cbs.dtu.dk/services/TMHMM/TMHMM2.0b.guide.php) or (ii) tmpred (from EMBnet, maintained by the ISREC Bionformatics group and the LICR Information Technology Office, Ludwig Institute for Cancer Research, Swiss Institute of Bioinformatics, http://www.ch.embnet.org/sof- tware/TMPRED_form.html) for transmembrane region prediction; (iii) signalp_hmm or (iv) signalp_nn (both from Center for Biological Sequence Analysis, Technical University of Denmark DTU, http://www.cbs.dtu.dk/serv- ices/SignalP/background/prediction.php) for signal peptide prediction. The terms "signalp_hmm" and "signalp_nn" refer to two modes of operation for the program SignalP: hmm refers to Hidden Markov Model, while nn refers to neural networks. Localization was also determined through manual inspection of known protein localization and/or gene structure, and the use of heuristics by the individual inventor. In some cases for the manual inspection of cellular localization prediction inventors used the ProLoc computational platform [Einat Hazkani-Covo, Erez Levanon, Galit Rotman, Dan Graur and Amit Novik; (2004) "Evolution of multicellularity in metazoa: comparative analysis of the subcellular localization of proteins in Saccharomyces, Drosophila and Caenorhabditis." Cell Biology International 2004; 28(3):171-8.], which predicts protein localization based on various parameters including, protein domains (e.g., prediction of trans-membranous regions and localization thereof within the protein), pI, protein length, amino acid composition, homology to pre-annotated proteins, recognition of sequence patterns which direct the protein to a certain organelle (such as, nuclear localization signal, NLS, mitochondria localization signal), signal peptide and anchor modeling and using unique domains from Pfam that are specific to a single compartment. [0045] Information is given in the text with regard to SNPs (single nucleotide polymorphisms). A description of the abbreviations is as follows. "T->C", for example, means that the SNP results in a change at the position given in the table from T to C. Similarly, "M->Q", for example, means that the SNP has caused a change in the corresponding amino acid sequence, from methionine (M) to glutamine (Q). If, in place of a letter at the right hand side for the nucleotide sequence SNP, there is a space, it indicates that a frameshift has occurred. A frameshift may also be indicated with a hyphen (-). A stop codon is indicated with an asterisk at the right hand side (*). As part of the description of an SNP, a comment may be found in parentheses after the above description of the SNP itself. This comment may include an FTId, which is an identifier to a SwissProt entry that was created with the indicated SNP. An FTId is a unique and stable feature identifier, which allows construction of links directly from position-specific annotation in the feature table to specialized protein-related databases. The FTId is always the last component of a feature in the description field, as follows: FTId=XXX_number, in which XXX is the 3-letter code for the specific feature key, separated by an underscore from a 6-digit number. In the table of the amino acid mutations of the wild type proteins of the selected splice variants of the invention, the header of the first column is "SNP position(s) on amino acid sequence", representing a position of a known mutation on amino acid sequence. SNPs may optionally be used as diagnostic markers according to the present invention, alone or in combination with one or more other SNPs and/or any other diagnostic marker. Preferred embodiments of the present invention comprise such SNPs, including but not limited to novel SNPs on the known (WT or wild type) protein sequences given below, as well as novel nucleic acid and/or amino acid sequences formed through such SNPs, and/or any SNP on a variant amino acid and/or nucleic acid sequence described herein. [0046] Information given in the text with regard to the Homology to the known proteins was determined by Smith-Waterman version 5.1.2 using special (non default) parameters as follows: [0047] model=sw.model [0048] GAPEXT=0 [0049] GAPOP=100.0 [0050] MATRIX=blosum 100 [0051] Information is given with regard to overexpression of a cluster in cancer based on ESTs. A key to the p values with regard to the analysis of such overexpression is as follows: [0052] library-based statistics: P-value without including the level of expression in cell-lines (P1) [0053] library based statistics: P-value including the level of expression in cell-lines (P2) [0054] EST clone statistics: P-value without including the level of expression in cell-lines (SP1) [0055] EST clone statistics: predicted overexpression ratio without including the level of expression in cell-lines (R3) [0056] EST clone statistics: P-value including the level of expression in cell-lines (SP2) [0057] EST clone statistics: predicted overexpression ratio including the level of expression in cell-lines (R4) [0058] Library-based statistics refer to statistics over an entire library, while EST clone statistics refer to expression only for ESTs from a particular tissue or cancer. [0059] Information is given with regard to overexpression of a cluster in cancer based on microarrays. As a microarray reference, in the specific segment paragraphs, the unabbreviated tissue name was used as the reference to the type of chip for which expression was measured. [0060] There are two types of microarray results: those from microarrays prepared according to a design by the present inventors, for which the microarray fabrication procedure is described in detail in Materials and Experimental Procedures section herein; and those results from microarrays using Affymetrix technology. As a microarray reference, in the specific segment paragraphs, the unabbreviated tissue name was used as the reference to the type of chip for which expression was measured. For microarrays prepared according to a design by the present inventors, the probe name begins with the name of the cluster (gene), followed by an identifying number. These probes are listed below with their respective sequences. TABLE-US-00001 >H61775_0_11_0 (SEQ ID NO:1031) CCCCAGCTTTTATAGAGCGGCCCAAGGAAGAATATTTCCAAGAAGTAGGG >HSAPHOL_0_11_0 (SEQ ID NO:1012) GGAACATTCTGGATCTGACCCTCCCAGTCTCATCTCCTGACCCTCCCACT >HUMGRP5E_0_0_16630 (SEQ ID NO:1013) GCTGATATGGAAGTTGGGGAATCTGAATTGCCAGAGAATCTTGGGAAGAG >HUMGRP5E_0_2_0 (SEQ ID NO:1014) TCTCATAGAAGCAAAGGAGAACAGAAACCACCAGCCACCTCAACCCAAGG >D56406_0_5_0 (SEQ ID NO:1015) TCTGACTTTTACGGACTTGGCTTGTTAGAAGGCTGAAAGATGATGGCAGG >M77904_0_8_0 (SEQ ID NO:1016) AGTCTGTGTTTGAGGGTGAAGGCTCAGCAACCCTGATGTCTGCCAACTAC >Z25299_0_3_0 (SEQ ID NO:1017) AACTCTGGCACCTTGGGCTGTGGAAGGCTCTGGAAAGTCCTTCAAAGCTG >Z44808_0_8_0 (SEQ ID NO:1018) AAAAGCATGAGTTTCTGACCAGCGTTCTGGACGCGCTGTCCACGGACATG >Z44808_0_0_72347 (SEQ ID NO:1019) ATGTTCTTAGGAGGCAAGCCAGGAGAAGCCGGGTCTGACTTTTCAGCTCA >Z44808_0_0_72349 (SEQ ID NO:1020) TCCTCCAGACCCAAAGCCACAACCCATCGCAAGTCAAGAACACTTTCCAG >S67314_0_0_741 (SEQ ID NO:1021) CACAGAGCCAGGATGTTCTTCTGACCTCAGTATCTACTCCAGCTCCAGCT >S67314_0_0_744 (SEQ ID NO:1022) TGGCATGCTGGAACATGGACTCTAGCTAGCAAGAAGGGCTCAAGGAGGTG >Z39337_0_0_66755 (SEQ ID NO:1023) GCAGGGGTTAAAAGGACGTTCCAGAAGCATCTGGGGACAGAACCAGCCTC >Z39337_0_9_0 (SEQ ID NO:1024) TAATAAACGCAGCGACGTGAGGGTCCTGATTCTCCCTGGTTTTACCCCAG >HUMPHOSLIP_0_0_18458 (SEQ ID NO:1025) AAGGAAGCAGGACCAGTGGATGTGAGGCGTGGTCGAAGAACAACAGAAAG >HUMPHOSLIP_0_0_18487 (SEQ ID NO:1026) ACAGGGGCCAGATGGTGACCCATGACCCAGCCTAAAAGGCAGCCAGAGGG >M78530_0_6_0 (SEQ ID NO:1027) CTTCCTACACACATCTAGACGTTCAAGTTTGCAAATCAGTTTTTAGCAAG >HSMUC1A_0_37_0 (SEQ ID NO:1028) AAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCCAGCTCTACTGAG >HSMUC1A_0_0_11364 (SEQ ID NO:1029) AAAGGCTGGCATAGGGGGAGGTTTCCCAGGTAGAAGAAGAAGTGTCAGCA >HSMUC1A_0_0_11365 (SEQ ID NO:1030) AATTAACCCTTTGAGAGCTGGCCAGGACTCTGGACTGATTACCCCAGCCT Continue reading... Full patent description for Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer Brief Patent Description - Full Patent Description - Patent Application Claims Click on the above for other options relating to this Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer patent application. Patent Applications in related categories: 20080108057 - Allelic imbalance in the diagnosis and prognosis of cancer - Methods for assessing the extent of allelic imbalance in a genomic nucleic acid sample. Methods for diagnosing cancer and determining the prognosis of a patient with cancer, including breast or prostate cancer, by assessing the extent of allelic imbalance in a genomic nucleic acid sample. ... 20080108069 - Forensic identification - The invention provides allelic ladder mixtures and individual alleles suitable for use in such mixtures. The allelic ladder mixtures give improved identification and distinguishing capabilities, particularly suitable in forensic investigations. ... 20080108079 - Genes associated with copd - A method of screening a small molecule compound for use in treating COPD, comprising screening a test compound against a target selected from the group consisting of the gene products encoded by CELSR3, CHRNA5-THRU-CHRNB4, GPR55, LGR8, PMPCB, SENP1, UCHL1, UQCRC1, BRD2, CCK, HTR6, KCNK3, MBTPS2, NCOA6, PRSS7, SMO, THRA, or ... 20080108078 - Genes associated with migraine - A method of screening a small molecule compound for use in treating Migraine, comprising screening a test compound against a target selected from the group consisting of the gene products encoded by APOE, GNAL, NEDD4L, PDIP, TPCN1, TRPM8, ADRA1B, P2RX4, TAAR2, TAAR3, USP11, CHRNA5, RAB5A, DPP8, F2RL1, FZD5, PTGER1, SPI, ... 20080108080 - Genes associated with obesity - A method of screening a small molecule compound for use in treating obesity, comprising screening a test compound against a target selected from the group consisting of the gene products encoded by IRS1, IL12A, ADAMTS7, APG4C, CITED1, GGTLA1, PKD1, TSC2, APG4B, CST7, CXCL5, GPR75, CAPN9, DPYS, F13A1, HFE, GPR173, A2M, ... 20080108077 - Genes associated with rheumatoid arthritis - A method of screening a small molecule compound for use in treating rheumatoid arthritis, comprising screening a test compound against a target selected from the group consisting of the gene products encoded by ACHE, ADAMTS16, AGER, BAT3, BRD2, C2, BF, C4A-THRU-TNXB, C6ORF21, LY6G6D, CACNA1D, CCR4, CLIC1, DNM1, EDG1, FAS, HLA-DQB1, ... 20080108076 - Genes associated with unipolar depression - A method of screening a small molecule compound for use in treating unipolar depression, comprising screening a test compound against a target selected from the group consisting of the gene products encoded by ADCYAP1R1, HMGB1, MIP, NIPSNAP3A, SRC, WFS1, CLIC6, GABRR3, KDR, PKD1L1, ADARB2, MAP3K1, PPARGC1A, DRD3, PTHR1, BF, CART, ... 20080108081 - Genetic polymorphisms associated with coronary stenosis, methods of detection and uses thereof - The present invention is based on the discovery of genetic polymorphisms that are associated with coronary stenosis. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods ... 20080108075 - Kits and methods for assessing oxidative stress - The invention relates to kits and methods for assessing the susceptibility of a human to oxidative stress or damage. The methods involve assessing occurrence in the human's genome of one or more polymorphisms (e.g., single nucleotide polymorphisms) that occur in one or more genes associated with oxidative stress and that ... 20080108072 - Maize event dp-098140-6 and compositions and methods for the identification and/or detection thereof - Compositions and methods related to transgenic glyphosate/ALS inhibitor-tolerant maize plants are provided. Specifically, the present invention provides maize plants having a DP-098140-6 event which imparts tolerance to glyphosate and at least one ALS-inhibiting herbicide. The maize plant harboring the DP-098140-6 event at the recited chromosomal location comprises genomic/transgene junctions having ... 20080108074 - Methods and compositions for efficient nucleic acid sequencing - Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the ... 20080108071 - Methods and systems to determine fetal sex and detect fetal abnormalities - Non-invasive methods for determining the sex of a human fetus and predicting other genetic abnormalities are disclosed. The methods include screening a maternal sample for biomarkers known to be associated with risk of genetic abnormalities; removing all or substantially all nucleated and anucleated cell populations from the maternal sample to ... 20080108073 - Methods of analysis of methylation - Methods for determining the methylation status of a plurality of cytosines are disclosed. In some aspects genomic DNA target sequences containing CpGs are targeted for analysis by multiplex amplification using target specific probes that can be specifically degraded prior to amplification. The targets may be modified with bisulfite prior to ... 20080108070 - Methods, compositions, and kits for the detection and monitoring of colon cancer - Methods and compositions for the diagnosis and monitoring of colon cancer are disclosed. ... 20080108082 - Polymerase enzymes and reagents for enhanced nucleic acid sequencing - Compositions that include DNA polymerases having increased residence times for nucleotide analogues, particularly modified recombinant Φ29-type DNA polymerases with such increased residence times, are provided. Methods of making the polymerases and of using the polymerases in sequencing and DNA amplification are also provided. Compositions including α-thiophosphate nucleotide analogues with four ... ###  How KEYWORD MONITOR works... a FREE service from FreshPatents1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored. 3. Each week you receive an email with patent applications related to your keywords. Start now! - Receive info on patent apps like Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer or other areas of interest. ### Previous Patent Application: Novel compositions and methods in cancer Next Patent Application: Nucleic sequences encoding an at2 receptor-interacting protein (atip) and their applications Industry Class: Chemistry: molecular biology and microbiology ### FreshPatents.com Support Thank you for viewing the Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of ovarian cancer patent info. IP-related news and info Results in 3.91969 seconds Other interesting Feshpatents.com categories: Accenture , Agouron Pharmaceuticals , Amgen , AT&T , Bausch & Lomb , Callaway Golf |
||
