Human hac3 -> Monitor Keywords
Fresh Patents
Monitor Patents Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents Browse Locations
site info Site News  |  monitor Monitor Keywords  |  monitor archive Monitor Archive  |  organizer Organizer  |  account info Account Info  |  
06/07/07 - USPTO Class 435 |  16 views | #20070128653 | Prev - Next | About this Page  435 rss/xml feed  monitor keywords

Human hac3

USPTO Application #: 20070128653
Title: Human hac3
Abstract: The invention provides isolated nucleic acid and amino acid sequences of hHAC3, antibodies to hHAC3, methods of detecting hHAC3, and methods of screening for modulators hyperpolarization-activated cation channels using biologically active hHAC3. The invention further provides, in a computer system, a method of screening for mutations of human HAC3 genes as well as a method for identifying a three-dimensional structure of human HAC3 polypeptides. (end of abstract)



Agent: Townsend And Townsend And Crew, LLP - San Francisco, CA, US
Inventor: Timothy J. Jegla
USPTO Applicaton #: 20070128653 - Class: 435006000 (USPTO)

Related Patent Categories: Chemistry: Molecular Biology And Microbiology, Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip, Involving Nucleic Acid

Human hac3 description/claims


The Patent Description & Claims data below is from USPTO Patent Application 20070128653, Human hac3.

Brief Patent Description - Full Patent Description - Patent Application Claims
  monitor keywords

CROSS-REFERENCES TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Ser. No. 60/129,456, filed Apr. 15, 1999, herein incorporated by reference in its entirety.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0002] Not applicable.

FIELD OF THE INVENTION

[0003] The invention provides isolated nucleic acid and amino acid sequences of hHAC3, antibodies to hHAC3, methods of detecting hHAC3, and methods of screening for modulators hyperpolarization-activated cation channels using biologically active hHAC3. The invention further provides, in a computer system, a method of screening for mutations of human HAC3 genes as well as a method for identifying a three-dimensional structure of human HAC3 polypeptides.

BACKGROUND OF THE INVENTION

A. General Background to Cation Channels

[0004] Cation channels are a diverse group of proteins that regulate the flow of cations across cellular membranes. The selectivity of a cation channel for particular cations typically varies with the valency of the cations, as well as the specificity of a given channel for a particular cation. Some cation channels display almost no selectivity for cations with the same valence (see, e.g., Saitow et al, Biochim Biophys Acta 1327(1):52-60 (1997)). Other channels are clearly selective for particular cations but are permeable to other cations to varying degrees (see, e.g., Park & MacKinnon, Biochemistry 34(41):13328-33 (1995) and Gauss et al., Nature 393(6685):583-7 (1998)).

[0005] Cation channels are involved in a number of physiological processes, including regulation of heartbeat, dilation of arteries, release of insulin, excitability of nerve cells, transduction of sensory stimuli, and regulation of renal electrolyte transport. Cation channels are thus found in a wide variety of animal cells such as nervous, muscular, glandular, immune, reproductive, sensory, and epithelial tissue. These channels allow the flow of various cations in and/or out of the cell under certain conditions. For example, the inward flow of cations upon opening of these channels makes the interior of the cell more positive, thus depolarizing the cell. These channels are regulated, e.g., by calcium sensitivity, voltage-gating, cyclic nucleotides or other secondary messengers, extracellular ligands, and ATP-sensitivity.

[0006] Certain classes of cation channels are formed by four alpha subunits and can be homomeric (made of identical alpha subunits) or heteromeric (made of two or more distinct types of alpha subunits). Some cation channels may contain other structurally distinct auxiliary, or beta, subunits. These subunits do not form potassium channels themselves, but instead modify the functional properties of channels formed by the alpha subunits. For example, the Kv beta subunits are cytoplasmic and are known to increase the surface expression of Kv channels and/or modify their inactivation kinetics (Heinemann et al., J Phsyiol. (Lond); 493:625-633; 1996 and Shi et al., Neuron 16(4):843-852, 1996). In another example, the KQT family beta subunit, minK, primarily changes activation kinetics (Sanguinetti et al., Nature 384:80-83, 1996).

B. Hyperpolarization-activated Cation Channels: HAC1 and HAC2.

[0007] Specialized cells in the heart and brain can create rhythmic activity due in a large part to a depolarizing mixed sodium/potassium current known as I.sub.h (see, e.g., Santoro et al., Cell 93:717-729 (1998)). This pacemaker current is generated by hypolarization activated channels that are present in the heart (see, e.g., DiFrancesco, Ann. Rev Physiol. 55:455-72 (1993) and brain (see, e.g., Papa, Ann. Rev. Physiol. 58:299-327 (1996). In addition to contributing directly to rhythmic activity in the brain and heart, these channels may contribute significantly to resting membrane potentials in neurons and other cell types from a variety of tissues.

[0008] Recently a family of hyperpolarization-activated channels, given the acronym HAC, was isolated from mouse (see, Ludwig et al., Nature 393:587-91 (1998)). Ludwig et al. reported isolating three different ion channels (mHAC1, mHAC2 and mHAC3). The mouse HAC proteins are members of the voltage-gated cation channel super family and also have a cyclic nucleotide binding domain capable of binding cAMP and cGMP. Mouse HAC1 exhibits the general properties of I.sub.h and may be responsible for pacemaker activity.

[0009] Another group also identified the same gene family, in this instance identified by the acronym BCNG. For instance, the BCNG-1 (HAC2) ion channel was isolated from mouse cells and is expressed in the brain (see, e.g., Santoro et al., Proc. Natl. Sci. USA 94:14815-20 (1997)). The human BCNG-2/HAC1 and BCNG-1/HAC2 have also been cloned (see, e.g., Santoro et al., Cell 93:717-729 (1998)). Since then, several related mouse genes (e.g., BCNG-1/HAC2, partial BCNG2/HAC1, partial BCNG3/HAC4, and partial BCNG4/HAC3) with expression in various tissues, including heart and brain, have been isolated (see, e.g., Santoro et al., Cell 93:717-729 (1998)).

[0010] Phylogenetic analysis indicates that mHAC3 is more distantly related to mHAC 1 or mHAC2 than are mHAC 1 and mHAC2 to each other. Human HAC3 has not been previously isolated. Isolation of human HAC3 is therefore desirable, to better understand the physiology of HAC3 in humans and for the development of therapeutic and diagnostic applications to diseases related to hHAC3 in humans.

SUMMARY OF THE INVENTION

[0011] The current invention provides the first isolation and characterization of the human HAC3 cation channel, which has neither been previously cloned nor identified. The present invention provides both the nucleotide and amino acid sequence of hHAC3, as well as methods of assaying for modulators of hHAC3, antibodies to hHAC3, and methods of detecting hHAC3 nucleic acids and proteins.

[0012] The present invention provides an isolated nucleic acid encoding a polypeptide monomer comprising an alpha subunit of a cation channel wherein the polypeptide monomer has two attributes. First, the polypeptide monomer forms, with at least one additional HAC alpha subunit, a cation channel having the characteristic of activation upon hyperpolarization. Second, the polypeptide monomer has an amino acid sequence that has greater than about 75% identity to an N-terminal region (amino acids 1-50) of a human HAC3 amino acid sequence (e.g., SEQ ID NO:1) or greater than about 90% identity to amino acids 640-775 of a human HAC3 amino acid sequence (e.g., SEQ ID NO:1).

[0013] In one embodiment of the invention, the nucleic acid encodes SEQ ID NO:1. In another embodiment, the nucleic acid has a nucleotide sequence of SEQ ID NO:2. In yet another embodiment, the nucleic acid is a splice variant of SEQ ID NO:2.

[0014] In one embodiment of the invention includes a nucleic acid that is amplified by primers that selectively hybridize under stringent conditions to the same sequence as any two primers selected from CAGCCATGGAGGCAGAGCAGCGGC (SEQ ID NO:3), GGAGGAGATCTTTCACATGACATACGAC (SEQ ID NO:4), AGTAGGATCCATCGGTGAGGCGTG (SEQ ID NO:5), and TTACATGTTGGCAGAAAGCTGGAGACC (SEQ ID NO:6).

[0015] In one embodiment of the invention, the nucleic acid selectively hybridizes under moderately stringent hybridization conditions to the nucleotide of SEQ ID NO:2.

[0016] In one embodiment of the invention, the nucleic acid has a nucleotide sequence that has greater than about 90% identity to SEQ ID NO:2. In another embodiment, the nucleic acid encodes a polypeptide having an amino acid sequence that has greater than about 96% identity to SEQ ID NO:1.

[0017] The present invention also provides an isolated protein monomer comprising an alpha subunit of a cation channel wherein the polypeptide monomer 1) forms, with at least one additional HAC alpha subunit, a cation channel having the characteristic of activation upon hyperpolarization, and 2) has an amino acid sequence that has greater than about 75% identity to an N-terminal region (amino acids 1-50) or greater than about 90% identity to amino acids 640-775 of a human HAC3 amino acid sequence.

Continue reading about Human hac3...
Full patent description for Human hac3

Brief Patent Description - Full Patent Description - Patent Application Claims

Click on the above for other options relating to this Human hac3 patent application.
###
monitor keywords

How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Human hac3 or other areas of interest.
###


Previous Patent Application:
Human fgf-21 gene and gene expression products
Next Patent Application:
Hybridization of pna probes in alcohol solutions
Industry Class:
Chemistry: molecular biology and microbiology

###

FreshPatents.com Support
Thank you for viewing the Human hac3 patent info.
IP-related news and info


Results in 0.26357 seconds


Other interesting Feshpatents.com categories:
Software:  Finance AI Databases Development Document Navigation Error 174
filepatents (1K)

* Protect your Inventions
* US Patent Office filing
patentexpress PATENT INFO