Drug, bio-affecting and body treating compositions patents - Monitor Patents
FreshPatents.com Logo    FreshPatents.com icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents



USPTO Class 424  |  Browse by Industry: Previous - Next | All     monitor keywords
Recent  |  14: Jul | Jun | May | Apr | Mar | Feb | Jan | 13: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | 12: Dec | Nov | Oct | Sep | Aug | July | June | May | April | Mar | Feb | Jan | 11: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | 10: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan |  | 09: Dec | Nov | Oct | Sep | Aug | Jl | Jn | May | Apr | Mar | Fb | Jn |  | 2008 | 2007 |

Drug, bio-affecting and body treating compositions

Below are recently published patent applications awaiting approval from the USPTO. Recent week's RSS XML file available below.
Listing for abstract view: USPTO application #, Title, Abstract excerpt,Patent Agent. Listing format for list view: USPTO National Class full category number, title of the patent application.
  
07/24/2014 > 157 patent applications in 99 patent subcategories.

20140205537 - Lrrk2 inhibitors: Provided herein are compounds that inhibit or partially inhibit the activity of leucine rich repeat kinases. Also provided herein are methods of treatment of CNS disorders comprising administration of inhibitors of leucine rich repeat kinases.... Agent: Zenobia Therapeutics, Inc.

20140205539 - Dual acting prodrugs: The present invention relates to a prodrug which comprises at least two different pharmaceutically and/or diagnostically active compounds independently bound by cleavable linkers and a protein-binding moiety which is capable of binding to carrier a molecule.... Agent: Ktb Tumorforschungsgesellschaft Mbh

20140205538 - Vaccines targeting cellular death receptors: The invention provides therapeutics and methods to induce a mammalian host, including a human, to produce antibodies, which agonize death receptors and cause the apoptotic death of target cells within the host's body. The therapeutics are vaccine compositions, including genetic vaccines encoding death receptor antigens of the tumor necrosis factor... Agent: Wayne State University

20140205540 - Method of improving balance: Methods and compositions for modifying an individual's balance time are disclosed.... Agent:

20140205541 - Method for detection of characteristics of organ fibrosis: The disclosed invention is a method for detecting indications of the presence of liver disease and other fibrotic diseases using a magnetic-resonance based technique for measuring fine tissue and bone textures. Specifically, the invention focuses on adaptations to this prior art to facilitate assessment of the presence and severity of... Agent: Acuitas Medical Limited

20140205543 - Method for diagnosing or treating tumors using sphingomyelin containing liposomes: The invention provides compositions and methods for diagnosing tumors and augmentic therapeutic intervention and measuring response to cell stress using sphingomyelin containing liposomes. The liposomes can include radiotracers, contrast agents, chromophores, dyes, enzyme substrates, therapeutic agents, chemotherapeutic agents or DNA segments. The indicators enable measurement of the extent of cellular... Agent: Memorial Sloan-kettering Cancer Center

20140205544 - Cancer treatment comprising therapeutics that bind to phosphatidylserine: Disclosed is the surprising discovery that aminophospholipids, such as phosphatidylserine and phosphatidylethanolamine, are specific, accessible and stable markers of the luminal surface of tumor blood vessels. The present invention thus provides aminophospholipid-targeted diagnostic and therapeutic constructs for use in tumor intervention. Antibody-therapeutic agent conjugates and constructs that bind to aminophospholipids... Agent: Board Of Regents, The University Of Texas System

20140205542 - Perfusive organ hemostasis: Disclosed are compositions, methods and kits to control bleeding through the use of an internal occluder based on polymeric solutions, including use of reverse thermosensitive polymers in nephron-sparing surgeries, which produces a completely bloodless surgical field, allowing speedy resection. In certain embodiments, after a certain amount of time, the flow... Agent: Genzyme Corporation

20140205545 - Multivalent constructs for therapeutic and diagnostic applications: The invention provides compositions and methods for therapeutic and diagnostic applications.... Agent: Bracco Suisse S.a.

20140205546 - Nanoscale particle formulations and methods: Provided herein in some embodiments is a formulation comprising (a) one or more nanoscale particle; and (b) a film-forming polymer. In some instances, the formulation is an immediate and sustained released formulation suitable for topical administration or administration to surfaces. Also provided here in certain embodiments is a method of... Agent:

20140205547 - Arthropod pest control composition: Provided is an arthropod pest control composition, the composition having an superior effect on control of arthropod pests. The composition comprises 0.01 to 0.5% by weight of a neonicotinoid insecticidal compound, 10 to 50% by weight of an organic solvent selected from the group consisting of monoalcohols having 1 to... Agent: Sumitomo Chemical Company, Limited

20140205548 - Aerosol for controlling indoor insect pest: o

20140205549 - Stable compositions and methods for preparing the same: Described herein are stable aqueous stannous ion containing compositions and methods of preparing and using the same.... Agent: Gaba International Holding Ag

20140205550 - Method for cosmetically treating caspase-14 deficiency: A method of cosmetic care comprising activating capsase-14 expression in skin deficient in caspase-14 expression by applying, on at least one skin zone in need thereof, an effective amount of a plant extract selected from the group consisting of litchi, glasswort, peach, soja seed, sweet basil, cucumber, chanterelle, leek, kiwi... Agent:

20140205551 - Sunscreen: The present invention relates to a composition for topical application comprising at least a benzotriazol derivative and vitamin E or a derivative thereof. Furthermore, the invention relates to compositions that prevent staining of clothes and exhibit a reduced sand adherence on skin.... Agent: DsmIPAssets B.v.

20140205552 - Water-in-oil emulsified sunscreen cosmetic: The object of the present invention is to improve the poor texture due to a large blend ratio of said ultraviolet scattering agent powder and the poor washability due to the presence of the ultraviolet scattering agent powder in a water-in-oil emulsified sunscreen cosmetic into which hydrophobicized zinc oxide and... Agent: Shiseido Company, Ltd.

20140205553 - Agent for enhancing the effect of skin-whitening ingredients and uses thereof: The present invention has objects to provide an agent for enhancing the effect of skin-whitening ingredients which enhances the skin-whitening action of skin-whitening ingredients and has an improved safeness, and to provide a skin-whitening agent, which contains the above agent and a skin-whitening ingredient(s) and has an improved and enhanced... Agent: Hayashibara Co., Ltd.

20140205555 - Antiperspirant that reduces/eliminates yellowing on clothing: An antiperspirant composition that reduces or eliminates yellowing on clothing.... Agent: Colgate-palmolive Company

20140205554 - Bodily cooling fluid techniques:

20140205556 - Composition comprising an alkoxysilane, a fatty ester and a silicone, and cosmetic use thereof: The invention relates to a composition, especially a cosmetic composition, comprising: (i) one or more alkoxysilanes, (ii) one or more fatty esters; and (iii) one or more silicones. The invention also relates to a cosmetic process for treating keratin materials with this composition, and also to the use of this... Agent: L'oreal

20140205557 - Cationic conditioner replacements: Described are personal care compositions for hair, comprising a surfactant, a silicone, and a methylcellulose that gels at 45C or less, wherein personal care composition is substantially free of cationic polymers selected from cationic cellulose derivatives, cationic guar derivatives, cationic methacrylamido polymers, polyquaternium-6, or polyquaternium-7.... Agent: Union Carbide Chemicals & Plastics Technology LLC

20140205559 - Antifungal compositions for the treatment of skin and nails: Improvements in or relating to manually operated dispense heads for fluid containers... Agent: Alc Therapeutics, LLC

20140205558 - Sodium thiosulfate-containing pharmaceutical compositions: Provided herein are pharmaceutically acceptable sodium thiosulfate and pharmaceutical compositions thereof. Also provided herein are methods for determining the total non-purgeable organic carbon in a sodium thiosulfate-containing sample. Further provided herein are methods for producing pharmaceutically acceptable sodium thiosulfate. Still further provided herein are methods of treatment comprising the administration... Agent: Hope Medical Enterprises, Inc. Dba Hope Pharmaecuticals

20140205565 - Compositions and methods for treating organ dysfunction: A method of retarding cellular senescence comprising (i) providing an extracellular matrix (ECM) composition comprising ECM from an adolescent tissue source, the ECM comprising an exogenously added cytokine, and (ii) administering ECM composition to an organ with cells exhibiting cellular senescence, wherein, the cytokine interacts with at least one molecule... Agent:

20140205563 - Compositions derived from stem cell released molecules & methods for formulation thereof: Compositions for use in treatment of a variety of tissue diseases include stem cells and stem cell released molecules (SRM's) suspended in an aqueous solution with a cellulosic material or other thickening agent. The stem cells and SRM's can be derived from one or more distinct cell lines. The SRM's... Agent: Bioregenerative Sciences, Inc.

20140205564 - Hepatitis c virus inhibitors: The present disclosure relates to compounds, compositions and methods for the treatment of hepatitis C virus (HCV) infection. Also disclosed are pharmaceutical compositions containing such compounds and methods for using these compounds in the treatment of HCV infection.... Agent:

20140205562 - Il-1 binding proteins: Proteins that bind IL-1α and IL-1β are described along with their use in compositions and methods for treating, preventing, and diagnosing IL-1-related disorders and for detecting IL-1α and IL-1β in cells, tissues, samples, and compositions.... Agent: Abbvie, Inc.

20140205561 - Mitigation of cutaneous injury with il-12: The present application relates to treatment of cutaneous wounds using IL-12. The methods of the invention result in improved wound closure. The methods comprise treating cutaneous wounds using topical, subcutaneous, and/or intramuscular administration of IL-12.... Agent: Neumedicines, Inc.

20140205560 - Multimeric il-15 soluble fusion molecules and methods of making and using same: The invention provides soluble fusion protein complexes having at least two soluble fusion proteins. The first fusion protein is a biologically active polypeptide covalently linked to an interleukin-15 (IL-15) polypeptide or a functional fragment thereof. The second fusion protein is a second biologically active polypeptide covalently linked to a soluble... Agent: Altor Bioscience Corporation

20140205566 - Cyclic nucleuoside derivatives and uses thereof: e

20140205567 - Macrocyclic heterocyclic compound for inhibiting hepatitis c virus and preparation and use thereof: The present invention discloses a class of novel macro-heterocyclic compounds represented by the formula Ia or Ib, and their intermediates, preparation methods and the uses. The macro-heterocyclic compounds of the present invention have good inhibitory activities against hepatitis C virus (HCV), and can be used to treat HCV infection effectively... Agent: Ab Pharma Ltd.

20140205568 - Promyelocytic leukemia protein as a redox sensor: The present invention relates to a method for determining the redox status of a cell or tissue comprising a step consisting of determining the level of PML nuclear bodies in said cell or tissue.... Agent: Institut National De La Sante Et De La Recherche Medicale (inserm)

20140205569 - Methods and compositions for preventing and treating osteoarthritis: The invention provides methods for preventing and treating osteoarthritis, preventing and treating the degradation of articular cartilage, and promoting and maintaining joint health in an animal. The methods comprise administering DGLA to the animals, preferably in amounts of from about 0.01 to about 100 mg/kg/day.... Agent:

20140205570 - Recombinant adeno-associated virus-mediated expression of fractalkine for treatment of neuroinflammatory and neurodegenerative diseases: The subject invention pertains to the use of fractalkine (FKN, CX3CL1) and its receptor CX3CR1 for treatment of neuroinflammation and/or neurodegeneration. In one embodiment, the present invention provides a method for treatment of neuroinflammation and/or neurodegenerative diseases, comprising: administering, to cells of a subject in need of such treatment, an... Agent: University Of South Florida

20140205571 - Strain of l. bulgaricus capable of inhibiting the adhesion of h. pylori strains to epithelial cells: The present invention relates to a new strain of Lactobacillus delbrueckii subsp. bulgaricus, suitable for use in the treatment or prevention of Helicobacter pylori infection.... Agent: Compagnie Gervais Danone

20140205579 - Methods and compositions for alteration of a cystic fibrosis transmembrane conductance regulator (cftr) gene: Nucleases and methods of using these nucleases for alteration of a CFTR gene and generation of cells and animal models.... Agent: Sangamo Biosciences, Inc.

20140205578 - Methods for increasing insulin sensitivity and treating diabetes: Described herein are methods for increasing insulin sensitivity and for treating Diabetes (Type I and Type II). Also described herein are methods for increasing the amount of brown fat in a subject and for treating metabolic disorders, including obesity.... Agent: The John Hopkins University

20140205572 - Composition and method for increasing effectiveness of radiation or chemotherapy: This invention is a composition containing prebiotics, Lentinula edodes mycelia extract, and Litchi chinensis fruit polyphenol and use of the same in increasing the effectiveness of radiation or chemotherapy and in the prevention, mitigation and/or treatment of colorectal neoplasia.... Agent: Kibow Biotech, Inc.

20140205580 - Combinations of fungicidally active yeast and fungicides: Compositions are provided that improve overall plant vigor and yield by combining agriculturally effective amounts of at least one environmentally friendly biological control agent and at least one chemical fungicide. A composition of the present invention is particularly effective in the presence of fungal species. Use of a composition of... Agent: Bayer Cropscience Ag

20140205581 - Formulations containing saccharomyces boulardii and superoxide dismutase (sod) to control obesity: Disclosed is a composition containing Saccharomyces cerevisiae var boulardii and the enzyme superoxide dismutase.... Agent: Gnosis Spa

20140205573 - Oncolytic virotherapy for the therapy of sarcoma: The present invention relates to a parvovirus for the treatment of mesenchymal tumors, preferably malignant bone tumors such as localized and metastasized bone tumors, in particular osteosarcoma and Ewing's sarcoma. A preferred parvovirus includes a replication competent parvovirus H-1PV.... Agent: Deutsches Krebsforschungszentrum

20140205575 - In vivo iron labeling of stem cells and tracking these labeled stem cells after their transplantation: Intravenous ferumoxytol is used to effectively label mesenchymal stem cells (MSCs) in vivo and is used for in vivo tracking of stem cell transplants with magnetic resonance (MR) imaging. The method eliminates risk of contamination and biologic alteration of MSCs associated with ex-vivo-labeling procedures.... Agent:

20140205576 - Methods and compositions for increased transgene expression: Described herein are methods of expressing nucleic acids in T cells pre-exposed to a co-stimulatory signal and then transduced with adenoviral vectors. In some embodiments, the co-stimulation is provided by anti-CD3 and anti-CD28 antibodies and the adenoviral vector is pseudotyped for T-cell entry. The invention also relates to compositions for... Agent: Sangamo Biosciences, Inc.

20140205577 - Treatment of cardiovascular disorders using the cell differentiation signaling protein nell1: It has been identified in accordance with the present invention that Nell1 is essential for normal cardiovascular development by promoting proper formation of the heart and blood vessels. The present invention therefore provides therapeutic methods for treating cardiovascular disorders by employing a Nell1 protein or nucleic acid molecule.... Agent: Ut-battelle, LLC

20140205574 - Use of stem cells or progenitor cells to treat, delay, prevent, or repair tearing of cruciate ligaments: Methods for treating a partial or complete rupture of cranial cruciate ligament (CrCL) damage and for preventing or delaying CrCL damage with or without synovitis in dogs are disclosed. For example, this document provides methods for using stem cells and/or progenitor cells to prevent or reduce the likelihood of CrCL... Agent: Animal Cell Therapies, Inc.

20140205582 - Megakaryocyte progenitor cells for production of platelets: Provided herein are methods of generating megakaryocyte lineage cells from hematopoietic stem cells in the absence of feeder cells and serum. The megakaryocyte progenitor cells (MKPs) generated as described result in rapid production of significant numbers of platelets when administered in vivo.... Agent: Cellerant Therapeutics, Inc.

20140205583 - Use of plp with peg-rmetase in vivo for enhanced efficacy: This invention relates to methods of modifying pyridoxal 5′ phosphate (PLP) dependent enzymes to extend the serum half-life of the enzyme, extend the in vivo period of methionine depletion in a host, and decrease the immunogenicity of the enzyme. A preferred PLP-dependent enzyme to be modified is a methioninase, preferably... Agent: Anticancer, Inc.

20140205584 - Anti-tnf-alpha therapy for the mucopolysaccharidoses and other lysosomal disorders: The present invention relates to methods of treating a subject with a lysosomal disorder, by administering an agent for enzyme replacement therapy and an agent for anti-TNF-α therapy; by administering a pentosan polysulfate therapy; or by administering a substrate reduction therapy and an anti-TNF-α therapy. The invention further relates to... Agent: Icahn School Of Medicine At Mount Sinai

20140205586 - Control of biofilm formation: The invention relates to control of biofilm development. Specifically, some embodiments of the present invention relate to control of bacterial biofilm formation through addition or breakdown of signal(s) that induce biofilm formation. More specifically, some embodiments of the present invention relate to control (e.g., promotion, prevention) of biofilm development by... Agent: The Regents Of The University Of Michigan

20140205585 - Methods for purification of arylsulfatase a: Methods of producing arylsulfatase A are described herein. The methods can include one or more steps of chromatography. Exemplary chromatographic steps include ion exchange chromatography, mixed mode chromatography, and hydrophobic interaction chromatography. Compositions containing and methods using arylsulfatase A produced by the methods described herein are also disclosed.... Agent: Shire Human Genetic Therapies, Inc.

20140205588 - Plasminogen and plasmin variants: The invention relates to variants of plasminogen and plasmin comprising one or more point mutations in the catalytic domain which reduce or prevent autocatalytic destruction of the protease activity of plasmin. Compositions, uses and methods of using said variants of plasminogen and plasmin are also disclosed.... Agent: Thrombogenics Nv

20140205587 - Proteases for degrading gluten: Gluten-degrading proteases can be used to degrade gluten and for making gluten-containing food safer for patients suffering from gluten intolerance.... Agent: Alvine Pharmaceuticals, Inc.

20140205590 - Botulinum toxin treatments of neurological and neuropsychiatric disorders: Methods for preventing or treating neuropsychiatric disorder and/or a neurological disorder including a neurological disorder mediated by the thalamus. Neuropsychiatric disorders and/or a neurological disorders, including a thalamically mediated disorder can be treated by peripheral administration of a botulinum toxin to or to the vicinity of a trigeminal sensory nerve,... Agent: Allergan, Inc.

20140205589 - New stable anesthetic composition for reducing skin reactions: A composition is described with reduced degradation rate and/or improved stability of its components. The composition can alleviate or even annihilate cutaneous reactions and can include an emulsion with an oil phase and an aqueous phase, wherein the oil phase can be a eutectic mixture of at least one anesthetic... Agent: Galderma Research & Development

20140205591 - Metabolite biomarkers for diagnosis and prognosis of pediatric septic shock: The present invention provides methods for differentiating a pediatric subject with pediatric septic shock from a healthy pediatric subject or one having sudden inflammatory response syndrome (SIRS). Also provided is a method of predicting pediatric septic shock mortality in a pediatric septic shock patient.... Agent: Uti Limited Partnership

20140205592 - Stratification of cancer patients for susceptibility to therapy with ptk2 inhibitors: The present invention relates to a method for determining whether a cancer patient is susceptible to treatment with a protein tyrosine kinase 2 (PTK2) inhibitor, comprising detecting the expression of the E-cadherin protein in a cancer sample of said cancer patient, wherein an E-cadherin protein immunoreactivity score (IRS) of 0-2... Agent: Boehringer Ingelheim International Gmbh

20140205595 - Compounds and methods of prophylaxis and treatment regarding nicotinic receptor antagonists: It is an object of the present invention that the novel nicotinic receptor antagonists disclosed herein may be used in a broad array of clinical or medicinal facets. For example, it is a contemplated use of the present invention that the novel nicotinic receptor antagonists be used to inhibit the... Agent:

20140205598 - Methods for treating disseminated intravascular coagulation by inhibiting masp-2 dependent complement activation: In one aspect, the invention provides methods of inhibiting the effects of MASP-2-dependent complement activation in a living subject. In one embodiment, the invention provides methods of treating a subject suffering from a complement mediated coagulation disorder, such as disseminated intravascular coagulation. The methods comprise the step of administering, to... Agent: Omeros Corporation

20140205593 - Monovalent antibody fragments useful as therapeutics: The invention provides methods and compositions comprising a novel stabilized monovalent antibody fragment.... Agent: Genentech, Inc.

20140205596 - Organic compounds: The invention relates to compounds and methods of treatment relating to nicotinic receptor antagonists. For example, the compounds and methods of treatment function block the activity of certain acetylcholine receptors and subtypes therein, and are useful treating diseases and conditions mediated by nicotinic receptor stimulation, e.g., small cell lung cancer.... Agent: Intra-cellular Therapies, Inc.

20140205597 - Techniques for predicting, detecting and reducing aspecific protein interference in assays involving immunoglobulin single variable domains: This invention provides, and in certain specific but non-limiting aspects relates to: assays that can be used to predict whether a given ISV will be subject to protein interference as described herein and/or give rise to an (aspecific) signal in such an assay (such as for example in an ADA... Agent: Ablynx N.v.

20140205594 - Treatment of cancer: Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101.... Agent:

20140205600 - Methods of promoting fat loss comprising administering an alk7 inhibitor: The invention relates to ALK7 soluble receptors and their uses as antagonists of the function of certain ligands such as GDF-8 (Myostatin) and GDF-11. The ALK7 soluble receptor of the invention is useful as antagonists of GDF-8 and GDF-11 in the treatment of neuronal diseases or conditions such as stroke,... Agent: Acceleron Pharma Inc.

20140205599 - Polypeptide that binds aberrant cells and induces apoptosis: Described are proteinaceous molecules comprising at least a domain that comprises an amino acid sequence that specifically binds to an MHC-peptide complex on an aberrant cell, functionally connected with a substance that induces apoptosis in aberrant cells, but not in normal cells. These proteinaceous molecules are preferably used in selectively... Agent:

20140205601 - Amino acid sequences directed against rank-l and polypeptides comprising the same for the treatment of bone diseases and disorders: The present invention relates to amino acid sequences that are directed against RANK-L, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. The invention also relates to nucleic acids encoding such amino acid... Agent: Ablynx N.v.

20140205602 - Antagonist anti-cd40 monoclonal antibodies and methods for their use: Compositions and methods of therapy for treating diseases mediated by stimulation of CD40 signaling on CD40-expressing cells are provided. The methods comprise administering a therapeutically effective amount of an antagonist anti-CD40 antibody or antigen-binding fragment thereof to a patient in need thereof. The antagonist anti-CD40 antibody or antigen-binding fragment thereof... Agent: Novartis Vaccines And Diagnostics, Inc.

20140205604 - Antigen binding constructs: The present invention is directed to antigen binding constructs comprising one or two epitope binding domains separated by a single chain Fc region of an antibody, wherein each epitope binding domain in capable of binding to VEGF, to dimers comprising two antigen binding constructs of the invention, pharmaceutical compositions comprising... Agent: Glaxo Group Limited

20140205603 - Siglec-15 antibodies in treating bone loss-related disease: Novel antibodies and antigen binding fragments that specifically binds to Siglec-15 are described herein In some embodiments, the antibodies or antigen binding fragments may block the biological activity of Siglec-15 and are useful in composition for the treatment of bone loss, more particularly in bone diseases that have increased cell... Agent: Alethia Biotherapeutics Inc.

20140205606 - Anti c-met antibodies: The present invention relates to antibodies that specifically bind to the human c-Met receptor protein and that act as strict antagonists of hepatocyte growth factor (HGF)-mediated activation of the c-Met receptor and also inhibit HGF-independent activation of the human c-Met protein.... Agent: Argen-x B.v.

20140205607 - Focused evolution of hiv-1 neutralizing antibodies revealed by crystal structures and deep sequencing: Antibody VRC01 represents a human immunoglobulin that neutralizes—˜90% of diverse HIV-1 isolates. To understand how such broadly neutralizing HIV-1 antibodies develop and recognize the viral envelope, we used X-ray crystallography and 454 pyrosequencing to characterize additional antibodies from HIV-1-infected individuals. Crystal structures revealed a convergent mode of binding of different... Agent: And Human Services

20140205605 - Optimized antibodies that target hm1.24: The present disclosure describes antibodies that target HM1.24. In various aspects, the antibodies have specific CDR, variable, or full length sequences, have modifications with the parent antibody, or include at least one modification relative to a parent antibody that alters affinity to an FcγR or alters effector function as compared... Agent: Xencor, Inc.

20140205608 - Use of c-fms antagonists: The present invention relates generally to a method for the treatment and/or prophylaxis of osteoarthritis (OA) and/or pain. In accordance with the present invention, an antagonist of c-Fms is effective in the treatment of osteoarthritis and/or pain. An antagonist of M-CSF includes, but is not limited to, an antibody that... Agent: The University Of Melbourne

20140205609 - Methods for inducing systemic immune responses to cancer: Pharmaceutical compositions comprising molecules produced by antigen-stimulated peripheral blood mononuclear cells (PBMCs) that induce systemic immune responses to cancers are encompassed herein, as are methods for making and administering such molecules and pharmaceutical compositions comprising same. Also encompassed herein are mixtures of molecules produced by antigen-stimulated PBMCs and compositions thereof... Agent:

20140205610 - Anti-folr1 antibody: The present invention provides an anti-human FOLR1 antibody against diseases associated with human FOLR1-expressing cells, which specifically recognizes and binds to an amino acid sequence of human FOLR1 or a conformational structure thereof and also has a high effector activity such as antibody-dependent cellular cytotoxicity activity (ADCC activity). The present... Agent: Kyowa Hakko Kirin Co., Ltd

20140205611 - Monoclonal antibodies that bind to hgm-csf and medical compositions comprising same: Disclosed herein are anti-hGM-CSF monoclonal antibodies and antigen-binding fragments of such antibodies, with improved neutralizing capacity to hGM-CSF activity. Pharmaceutical compositions comprising such an antibody or antigen-binding fragment are also provided. The present invention is useful for the treatment of various diseases that are associated with aberrant expression of hGM-CSF.... Agent: Evec Inc.

20140205612 - Human immunodeficiency virus (hiv)-neutralizing antibodies: The invention provides a method for obtaining a broadly neutralizing antibody (bNab), including screening memory B cell cultures from a donor PBMC sample for neutralization activity against a plurality of HIV-1 species, cloning a memory B cell that exhibits broad neutralization activity; and rescuing a monoclonal antibody from that memory... Agent: The Scripps Research Institute

20140205613 - Anti-tnf and anti-il 17 combination therapy biomarkers for inflammatory disease: The invention provides methods for predicting the efficacy of anti-TNF and anti-IL17 combination therapies in the treatment of a subject suffering from inflammatory disease by determining the level CXCL1 and/or CXCL5 markers in a sample derived from the subject.... Agent: Abbvie Inc.

20140205615 - Human cytomegalovirus neutralizing antibodies and use thereof: The invention relates to neutralizing antibodies, and antibody fragments thereof, having high potency in neutralizing hCMV, wherein said antibodies and antibody fragments are specific for one, or a combination of two or more, hCMV gene UL products. The invention also relates to immortalized B cells that produce, and to epitopes... Agent: Institute For Research In Biomedicine

20140205614 - Neutralizing antibodies to influenza viruses: The present invention concerns methods and means for identifying, producing, and engineering neutralizing antibodies against influenza A viruses, and to the neutralizing antibodies produced. In particular, the invention concerns neutralizing antibodies against various influenza A virus subtypes, including neutralizing antibodies against two or more of H1, H2, H3, H5, H7... Agent: Sea Lane Biotechnologies, LLC

20140205616 - Compositions and methods for the diagnosis and treatment of tumor: The invention is directed to antibody drug conjugate compositions of matter useful for the diagnosis and treatment of tumors in mammals and to methods of using those compositions of matter for the same.... Agent: Genentech, Inc.

20140205617 - Compositions and methods for treatment of neoplastic disease: The present invention comprises the use of sickle cells or sickle cell precursors loaded with a therapeutic agent that localize in tumors and induce a tumoricidal response.... Agent:

20140205618 - Human fertility enhancement with cortisol reduction food: A method of using a medical food to increase human fertility. This medical food consists of transfer factor, lactic acid generating bacteria, and glucans in appropriate combinations. The medical food, administered correctly, reduces cortisol levels. Progesterone increases as cortisol decreases, and progesterone is needed to support pregnancy and ovulation. Dosage... Agent: Cortcontrol, Inc.

20140205619 - Recombinant avian influenza vaccine and uses thereof: The present invention encompasses influenza vaccines, in particular avian influenza vaccines. The vaccine may be a subunit vaccine based on the hemagglutinin of influenza. The hemagglutinin may be expressed in plants including duckweed. The invention also encompasses recombinant vectors encoding and expressing influenza antigens, epitopes or immunogens which can be... Agent: Merial Limited

20140205621 - Canine coronavirus vaccine: A new pantropic canine coronavirus (CCoV) strain, having reduced pathogenicity, and capable of eliciting an immune response, is described.... Agent:

20140205620 - Engineered respiratory syncytial viruses with control of cell-to-cell virus transmission for enhanced safety of live virus vaccines: Highly antigenic yet safe vaccines against diseases caused by Paramyxoviridae viruses such as respiratory syncytial virus (RSV) are provided. The vaccines comprise attenuated Paramyxoviridae viruses with high antigenicity but which display impaired cell-to-cell transmission as a result of genetic manipulation of the gene encoding the matrix (M) protein. In the... Agent: The Board Of Regents For Oklahoma State University

20140205622 - Vaccines against influenza virus: were M2e is the influenza M2 ectodomain (M2e) peptide; Cys is a cysteine amino acid residue present in the M2e peptide; S the sulfur present in the cysteine amino acid residue; CH2-CO—NH—CH2-CH2-CO the linking group; NH the amine group present in a lysine residue of the carrier; Lys is a... Agent: The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services

20140205623 - Protein-based streptococcus pneumoniae vaccines: Vaccine compositions and methods for protecting a mammalian subject against infection with S. pneumoniae are disclosed. These vaccine compositions include as the active ingredient a purified preparation of the cell wall protein NADH oxidase (NOX) having the Accession No. NP_345923 and the amino acid sequence set forth in SEQ ID... Agent: Ben-gurion University Of The Negev Research And Development Authority

20140205624 - Tetravalent and mixed head bivalent dengue vaccine: The present invention relates to immunogenic compositions and vaccines of flavivirus. In particular, the present invention relates to improved Dengue vaccines and the design and making of such vaccines that enhance immunogenicity of the vaccine. The vaccines and immunogenic compositions of the present invention relate to mixed head bivalent flagellin-dengue... Agent:

20140205625 - Methods to increase antigenicity of membrane-bound polypeptides produced in plants: Increased antigenicity of a membrane-bound polypeptide produced from a plant is provided in a process in which extraction of the polypeptide or other compounds from the plant is such that phospholipids are associated with the polypeptide. Reducing fat by supercritical fluid extraction increases antigenicity of such plant-produced membrane-bound polypeptides. Methods... Agent: Applied Biotechnology Institute, Inc.

20140205626 - Anti-inflammatory and immune-boosting composition containing fermented green coffee beans which are fermented with monascus: Disclosed herein are fermented coffee beans prepared by inoculating and culturing mycelium of fungus into coffee beans. The fermented coffee beans according to the present invention may have immune-boosting and anti-inflammatory activities.... Agent:

20140205627 - Composition and method to improve blood lipid profiles and reduce low density lipoprotein (ldl) per-oxidation in humans using algae based oils and astaxanthin: In accordance with a non-limiting example, an algae based oil is used in place of a krill oil to treat low density lipoprotein (LDL) oxidation in humans by administering a therapeutic amount of a dietary supplement composition comprising an algae based oil comprising glycolipids and phospholipids and Eicosapentaenoic (EPA) fatty... Agent: U.s. Nutraceuticals, LLC D/b/a Valensa International

20140205628 - High molecular weight polysaccharide that binds and inhibits virus: This invention provides a high molecular weight polysaccharide capable of binding to and inhibiting virus and related pharmaceutical formulations and methods of inhibiting viral infectivity and/or pathogenicity, as well as immunogenic compositions. The invention further includes methods of inhibiting the growth of cancer cells and of ameliorating a symptom of... Agent: World Force Technologies, LLC

20140205629 - Tc-83-derived alphavirus vectors, particles and methods: The present disclosure provides TC-83 VEE-derived replicons, alphaviral replicon particles and immunogenic compositions containing TC-83 alphaviral replicon particles which direct the expression of at least one antigen when introduced into a suitable host cell. The TC-83 VEE-derived ARPs described herein are improved in that they are subject to a lower... Agent: Alphavax, Inc.

20140205630 - Compositions comprising a b subunit of shiga toxin and a means stimulating nkt cells: The present invention relates to a composition comprising a) a B subunit of Shiga toxin or a functional equivalent thereof which is able to bind the Gb3 receptor, complexed with an antigen and b) at least one ligand of CDl capable of stimulating NK T cells; and to a pharmaceutical... Agent: Institut Curie

20140205631 - Stimulation of vaccination by angiotensin peptides: The present invention provides angiotensin peptide compositions and methods for use of the compositions in vaccination.... Agent:

20140205632 - Down regulation of the gene expression by means of nucleic acid-loaded virus-like particles: The present invention relates to compositions of virus-like particles for the introduction of RNA-interference (RNAi-) inducing molecules into eukaryotic cells and methods for the cell type-specific transduction of a plurality of eukaryotic cells with RNAi-inducing molecules. The present invention furthermore relates to methods for a diagnosis, prevention and/or treatment of... Agent:

20140205633 - Immunostimulatory oligodeoxynucleotides: The present invention relates to immunostimulatory oligodeoxynucleotides, vectors and vaccines comprising such oligodeoxynucleotides, to their use as a medicament, to their use in preventing or combating infectious disease, to methods for the detection of such oligodeoxynucleotides and to cells to be used in these method.... Agent:

20140205634 - Treatment of streptococcal infections: Methods of treating a Streptococcus pneumoniae infection are described herein.... Agent: Glaxosmithkline Biologicals S.a.

20140205635 - Detection of prame gene expression in cancer: The present invention relates to PRAME specific primers and probes, diagnostic kits and methods. The invention further relates to treatment of specific populations of cancer patients suffering from PRAME expressing tumours.... Agent: Glaxosmithkline Biological Sa

20140205638 - Bab-type tri-block copolymer comprising polylactic acid (a) and polyethylene glycol (b), method for producing same, and drug delivery system using same: Provided are a BAB-type tri-block copolymer including a polylactic acid (A) that is a hydrophobic block and polyethylene glycol (B) that is a hydrophilic block, a method of preparing the BAB-type tri-block copolymer including synthesizing a polylactic acid (A)-polyethylene glycol (B) di-block copolymer by a ring opening polymerization of a... Agent: Chung-ang University Industry- Academy Cooperation Foundation

20140205636 - Fibrin sealant compositions with chemical crosslinking: The invention relates to tissue adhesives or sealants, more specifically to fibrinogen based sealants reinforced with particulate material and chemically cross-linked. More particularly, the present invention is directed to tissue sealant, adhesive, hemostat, or scaffolding material containing thrombin, fibrinogen, a biocompatible particulate material having amine functionality, and a biocompatible polymer... Agent: Ethicon, Inc.

20140205637 - Tissue thickness compensator configured to redistribute compressive forces: A tissue thickness compensator may generally comprise a compressible core comprising a plurality of movable particles, and a wrap surrounding the compressible core. The plurality of movable particles may comprise at least one medicament. A tissue thickness compensator may generally comprise a compressible core comprising a plurality of crushable particles,... Agent: Ethicon Endo-surgery, Inc.

20140205639 - Compositions suitable for the topical treatment of fungal infections of the skin and nails: The present invention relates to pharmaceutical compositions suitable for the topical treatment of fungal infections of the skin and nails, such as tinea pedia and tinea cruris, among others. The active ingredients of the present compositions are low molecular weight organic acids and their salts, many of which are previously... Agent: Biocepta Corporation

20140205640 - Antimicrobial colloidal silver and gold products and method of making same: Gelatinous foam, coated paper, fabric, and polymer materials combined with the Colloidal Silver or Gold additive to formulate products with antimicrobial surfaces. Some embodiments of the present invention can include gelatinous materials selected from a group consisting of thermosetting polymer, Styrene-Ethylene-Butadiene-Styrene polymer (SEBS), Thermoplastic Elastomer (TPE), and Polyurethane (PU) gelatin... Agent: Eco Product Group LLC

20140205641 - Co-crystals of cyprodinil and dithianon: The present invention relates to co-crystals of cyprodinil and dithianon as defined in the description, processes for preparing these co-crystals and also to compositions comprising at least such co-crystals. The invention also relates to the use of such co-crystals or compositions for combating harmful fungi.... Agent: Basf Se

20140205642 - Antimicrobial substrate: A method of preparing antimicrobial-containing polymeric products is provided, the method involving electrospinning a dispersion comprising a dispersible polymer, a fiberizing polymer, and one or more antimicrobial agents. The electrospun material is heated to remove solvent and the fiberizing polymer, giving a nonwoven polymeric material having antimicrobial agent incorporated therein.... Agent: Zeus Industrial Products, Inc.

20140205643 - Use of alginate oligomers in combating biofilms: The invention provides a method for combating biofilm, said method comprising contacting a biofilm with an alginate oligomer. The biofilm may be on an animate or inanimate surface and both medical and non-medical uses and methods are provided. In one aspect the invention provides an alginate oligomer for use in... Agent: Algipharma As

20140205644 - Expandable polymeric beads and their production: The present invention concerns antimicrobial expandable polystyrene (EPS) beads, comprising as main antimicrobial agent metal ions selected from silver and copper and combinations thereof, which antimicrobial agent(s) may be either mixed into the polymer matrix or coated onto the beads. The invention also concerns a method for producing the coated... Agent: Styrochem Finland Oy

20140205645 - Electrospun therapeutic carrier and implant: A biodegradable therapeutic carrier and implant comprises a layer of biodegradable electrospun material and floored wells formed by the layer to contain therapeutic.... Agent:

20140205647 - Method for treating defective dura mater: Disclosed are an artificial dura mater and manufacturing method thereof. The artificial dura mater includes electrospun layers prepared by electrostatic spinning, at least one of which is a hydrophobic electrospun layer. Further, above the hydrophobic electrospun layer, there can be at least one hydrophilic electrospun layer. A transition layer can... Agent: Medprin Regenerative Medical Technologies Co., Ltd

20140205648 - Methods for the in situ treatment of bone cancer: The present invention relates to methods for in situ treatment of malignant cells from a cancer associated with bone. In one method, the treatment is for a primary cancer and entails positioning an implant containing and/or coated with at least one active agent for treating malignant cells directly in/on or... Agent: Depuy Synthes Products, LLC

20140205646 - Tissue grafts modified with a cross-linking agent and method of making and using the same: Described herein are tissue grafts derived from the placenta that possess good adhesion to biological tissues and are useful in would healing applications. In one aspect, the tissue graft includes (1) two or more layers of amnion, wherein at least one layer of amnion is cross-linked, (2) two or more... Agent: Mimedx Group, Inc.

20140205649 - Solvent cast film sustained release latanoprost implant: The present invention provides a sustained release latanoprost implant in the form of a thin film comprising latanoprost incorporated in a biodegradable polymer matrix. Preferably, said implant is an intraocular implant comprising a thin film comprising latanoprost incorporated in a biodegradable polymer matrix wherein said implant is configured as a... Agent: Allergan, Inc.

20140205650 - Coated suppositories: The invention relates to coating of suppositories containing free unsaturated fatty acid, fatty acid ethyl ester and fatty acid monoglyceride that are susceptible to oxidative degradation. The coating retards oxidative degradation of unsaturated fatty acids and gives the suppository a non-oily and smooth surface. The coating will enhance the shelf-life... Agent: Lipid Pharmaceuticals Ehf.

20140205651 - Hygiene tissue: A hygiene tissue includes a composition including one or more lactic acid producing bacterial strains and a lipid phase including at least one lipid, wherein the lipid is selected from the group having olive oil, canola oil, coconut oil, palm kernel oil, peanut oil, soy bean oil, Dimethicone, paraffin oil,... Agent: Sca Hygiene Products Ab

20140205658 - Compositions and methods for treating or preventing radiation- or chemotherapy-induced pulmonary dysfunction: Compositions comprising one or more cytokines and methods for their use in inhibiting and/or alleviating effects of radiation therapy and/or chemotherapy and/or acute radiation syndrome in a subject in need thereof are provided.... Agent: Trifoilium Aps

20140205653 - Compositions comprising cyclic purine dinucleotides having defined stereochemistries and methods for their preparation and use: It is an object of the present invention to provide novel and highly active cyclic-di-nucleotide (CDN) immune stimulators that activates DCs via a recently discovered cytoplasmic receptor known as STING (Stimulator of Interferon Genes). In particular, the CDNs of the present invention are provided in the form of a composition... Agent: Aduro Biotech, Inc.

20140205654 - Liposomal vancomycin for the treatment of mrsa infections: The present invention discloses formulations of liposomal vancomycin that are highly effective in the treatment of bacterial infections, and particularly MRSA infections. The present invention further teaches methods of using the formulations disclosed herein for the treatment of bacterial infections. The inventors determined that certain formulations disclosed herein are likely... Agent: Cedars-sinai Medical Center

20140205657 - Method of producing a cationic liposomal preparation comprising a lipophilic compound: A method for producing a cationic liposomal preparation comprising a lipophilic active compound with physical and chemical stability during manufacturing, storing and reconstituting, and further a cationic liposomal preparation obtainable by this method as well as specific cationic liposomal preparations as well as pharmaceutical compositions are disclosed.... Agent: Medigene Ag

20140205656 - Modified cationic liposome adjuvants: The present invention relates to the use of vaccines with adjuvants comprising cationic liposomes where neutral lipids has been incorporated into the liposomes to change the gel-liquid phase transition and thereby modifying the IgG sub-type response and enhancing the CD8 response of the liposomal adjuvant. This technology can be used... Agent: Statens Serum Institut

20140205652 - Novel method and compositions: The present invention relates to, inter alia, a method of raising an immune response against a pathogen which comprises administering (i) one or more first immunogenic polypeptides derived from said pathogen; (ii) one or more adenoviral vectors comprising one or more heterologous polynucleotides encoding one or more second immunogenic polypeptides... Agent: Glaxosmithkline Biologicals, S.a.

20140205655 - Oligooxopiperazines for p53 reactivation: The present invention relates to oligooxopiperazines for reactivating p53. Methods of using the oligooxopiperazines are also disclosed.... Agent:

20140205659 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140205660 - Abscisic acid against cancer: Abscisic Acid (ABA) a naturally occurring plant hormone has been identified in this invention with potent properties to fight cancer. ABA is able to produce a hyperpolarization condition on plasma membrane through a decrease of intracellular Na+ and K+. Such phenomenon is produced in cancer cells by mediation of ion... Agent:

20140205661 - Formulation for retinoid-containing soft gelatin capsules: A new pharmaceutical formulation for retinoid-containing soft gelatin capsules is disclosed. The new formulation comprises a soft gelatin capsule filled with a fill mass comprising a retinoid as an active ingredient, a natural vegetable oil, a partially hydrogenated natural vegetable oil and medium chain triglycerides. Optionally, the new formulation also... Agent: Glaxo Group Limited

20140205662 - System and method for differentially timed local delivery of a combination pharmaceutical preparation for oral therapy: The present invention is directed to a system and method for treating oral diseases in a subject. This method comprises the following steps; diagnosing the subject, and choosing one or a combination of medications, their dosing and desired time course and then delivering the medications to the desired site in... Agent: The Research Foundation For The State University Of New York

20140205663 - Direct compression formulation and process: Dipeptidylpeptidase IV inhibitor (herein referred to as DPP-IV) that may be 98.5-100% pure is a high-dose drug capable of direct compressed with specific excipients into sold form dosage forms, such as tablets and capsules having desired, hardness, disintegrating ability and acceptable dissolution characteristics. DPP-IV is not inherently compressible and thus... Agent: Novartis Ag

20140205664 - Method for producing finely divided haematite and for producing iron oxide red pigments: The present invention relates to an improved process for the production of finely divided haematite and of iron oxide red pigments made up of the finely divided haematite and the use of the finely divided haematites and iron oxide red pigments produced by this process.... Agent: Lanxess Deutschland Gmbh

20140205665 - Bioresorbable microparticles: Polyurethane microparticles are derived from structural units comprising poly(alkylene oxide) moieties, caprolactone moieties and urethane moieties. The microparticles may include an active agent and have a particle size from 0.1 to 100 microns. Microparticles for injection have a particle size of 15 to 80 microns; for use as a aerosol... Agent: Ferring B.v.

20140205666 - Iminosugar in crystalline form: Iminosugar, which possesses known activity as a glycosyltransferase inhibitor, and is used, for example, in the treatment of Gaucher's disease, in crystalline form, a process for its preparation and a pharmaceutical composition thereof.... Agent: Dipharma Francis S.r.i.

20140205667 - Method: There is provided a method of producing a mixed metal compound comprising at least Mg2+ and at least Fe3 + having an aluminium content of less than 10000 ppm, having an average crystal size of less than 20 nm (200 A) comprising the steps of: (a) combining a Mg2+ salt... Agent: Cytochroma Development Inc.

20140205668 - Surface modified proteinaceous spherical particles and uses thereof: An aspect of embodiments of the invention relates to surface modified proteinaceous spherical particles (SMOP). SMOPs according to an embodiment of the invention may comprise a protein layer and an amyloid-binding moiety bound to the protein. In an embodiment, the protein layer is spherical in shape and comprises proteins linked... Agent: Bar-ilan University

20140205669 - Dhs1p and use of same as an anticancer therapeutic and immunomodulator: Use of dhS1P and/or PhotoImmunoNanoTherapy as a therapeutic agent is described. Administration of therapeutically effective amounts of dhS1P decrease the number of Myeloid Derived Suppressor Cells and immune suppression in cancer patients. Administration of therapeutically effective amounts of dhS1P can be used as an adjuvant to conventional cancer therapies including... Agent: The Penn State Research Foundation

20140205670 - Stable solid preparations: It is intended to provide a process for producing unstable amorphous benzimidazole compounds having a proton pump inhibitor function, and stable solid preparations for medicinal use containing these compounds which are produced by blending such an amorphous benzimidazole compound with a nontoxic base such as a basic inorganic salt, forming... Agent: Takeda Pharmaceutical Company Limited

20140205671 - Synthesis and use of polyhydroxyalkanoate (pha) nanocapsules as a protein carrier: A method of synthesizing PHA nanocapsules as a protein carrier, particularly, the synthesis of PHA nanocapsules synthesized by a modified precipitation/solvent evaporation technique with neutralization. Specifically, the method comprises the steps of sonicating a first solution comprising a triblock PHA copolymer, stirring the first solution into a second solution to... Agent: Nano And Advanced Materials Institute Limited

20140205672 - Release control compositions: m

20140205673 - Product for parenteral nutrition of obese intensive-care patients: The invention relates to a high-amino-acid, low-lipid and low-carbohydrate parenteral nutrition solution for administration to obese intensive-care patients, and to a three-chamber pouch which comprises the amino acid component, the carbohydrate component and the lipid component of the parenteral nutrition solution separately in three different chambers.... Agent: Fresenius Kabi Deutschland Gmbh

20140205674 - Method of preparing bone material having enhanced osteoinductivity: Methods for increasing osteoinductivity and/or surface area of bone material are provided. The methods include providing bone material and dehydrating the bone material with a solvent at its critical point. A useful solvent for critical point dehydrating is carbon dioxide. Critical point dehydration resulting in increased osteoinductivity and/or surface area... Agent: Warsaw Orthopedic, Inc.

20140205675 - Horse feed dietary supplement composition derived from chia seed composition: A horse feed dietary supplement composition increases the energy and improves the health and coat of a horse and is formed as a partially defatted seed meal composition that may be supplemented to a horse feed. The composition includes a shelf stable, partially defatted supercritical CO2 fluid solvent extracted whole... Agent: U.s. Nutraceuticals, LLC D/b/a Valensa International

20140205676 - Method of tissue repair using a composite material: A composite biocompatible hydrogel material includes a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa. A calcium comprising salt is disposed in at least some of the pores. The porous polymer matrix can comprise cellulose, including bacterial... Agent: Ut-battelle, LLC

20140205677 - Methods of treating gastrointestinal spasms in a subject having colorectal cancer: Methods of treating gastrointestinal spasms are provided. For example, methods of treating gastrointestinal spasms are provided, such methods not requiring the use of systemic drugs that have shown to (i) provide slow relief, (ii) cause adverse side effects, (iii) limit activities, (iv) worsen existing gastrointestinal conditions, (v) be unrecommended in... Agent: Liveleaf, Inc.

20140205678 - Tannin formulation for treating gastrointestinal spasms in a subject having colorectal cancer: Methods of treating gastrointestinal spasms are provided. For example, methods of treating gastrointestinal spasms are provided, such methods not requiring the use of systemic drugs that have shown to (i) provide slow relief, (ii) cause adverse side effects, (iii) limit activities, (iv) worsen existing gastrointestinal conditions, (v) be unrecommended in... Agent: Liveleaf, Inc.

20140205681 - Hydrogen-bond surrogate peptides and peptidomimetics for p53 reactivation: The present invention relates to peptidomimetics for reactivating p53. Methods of using the peptidomimetics are also disclosed.... Agent:

20140205680 - Methods of using (+)-1,4-dihydro-7-[(3s,4s)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid for treatment of cancer: Methods of treating, preventing or managing cancer, including certain leukemias are disclosed. The methods encompass the administration of enantiomerically pure (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid. Also provided are methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for... Agent: Sunesis Pharmaceuticals, Inc.

20140205679 - Methods of using (+)-1,4-dihydro-7-[(3s,4s)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid in combination therapy: Methods of treating, preventing or managing cancers are disclosed. The methods encompass the administration of SNS-595 in combination with a second active agent. In certain embodiments, the method of treatment comprise administering SNS-595 in combination with cisplatin, carboplatin, gemcitabine or a combination thereof.... Agent: Sunesis Pharmaceuticals, Inc.

20140205682 - Method based on bismuth ion for the treatment and prevention of a disease caused by a shiga toxin: The present invention relates to the a bismuth-based composition, particularly involving the use of bismuth ions, particularly the Bi+3 ion, for prevention and/or treatment of the haemolytic uremic syndrome, with the invention also relating to the use of a bismuth ion in the manufacture of a medicament for the prevention... Agent: Soubeiran Chobet S.r.l.

20140205683 - Method for preventing nasolacrimal duct obstruction: The invention is directed to a method for preventing nasolacrimal duct obstruction (NLDO) in a patient receiving high dose radioactive iodine for treatment of cancer. The method includes administering an effective amount of perchlorate anion to the eyes of the patient.... Agent:

20140205684 - Macrophage inhibitory cytokine-1 (mic-1) as a prognostic marker in chronic kidney disease: The present invention relates to methods of prognosing the survival of a diseased subject, particularly a subject with chronic kidney disease (CKD), as well as selecting an end-stage renal disease subject for a kidney transplant. The methods involve detecting an elevated amount of macrophage inhibitory cytokine-1 (MIC-1) in a test... Agent: St Vincent's Hospital Sydney Limited

20140205685 - Herbal combinations for treatment of a skin condition: A method and medicine for treating melanoma, BCC (basal cell carcinoma) or psoriasis or other inflammatory skin disease, or a combination thereof, comprising applying or injecting to an infected skin area of a patient diagnosed with melanoma, BCC (basal cell carcinoma) or psoriasis or other inflammatory skin disease, or a... Agent: Sirbal, Ltd.

20140205686 - Inhibitors of extracellular proteases: Provided is a plant derived extract including inhibitory activity against one or more extracellular proteases which degrade human tissue matrix. Moreover, the amount of inhibitory activity in an extract can be increased by stressing the plant prior to forming an extract. These extracts are each prepared by a process and... Agent:

20140205687 - Tribulus terrestris, avena sativa and panax ginseng extract combination: The present invention, is related to a herbal pharmaceutical product, obtained from the defined parts of the tribulus terrestris, avena sativa and panax ginseng plants, in order to be used as a supplement and support to increase muscle strength, body stamina and physical performance and in order to treat cardiovascular... Agent:

20140205688 - Stimulating agent and stimulating composition: The present invention relates to a stimulating agent comprising a pungent component having astringency, a stimulating composition including the agent, as well as a flavor or fragrance composition, a food, a drink, an oral care product and an external skin preparation containing the agent or the composition, and also relates... Agent: Takasago International Corporation

20140205689 - Method for prolonging the life of animals: A method for increasing the longevity of an old animal comprising administering to the animal a composition comprising one or more antioxidants in a total antioxidant amount sufficient to increase the longevity of the animal.... Agent: Hill's Pet Nutrition, Inc.

20140205690 - Vegetable extract and method of use as an active principle in the production of a pharmacologically active product for the treatment of tissue lesions, and method for obtaining the extract: A method for treatment of acute and/or chronic tissue lesions disorder is disclosed. A resin extract from Ficus pertusa L. f and/or Ficus eximia Schott is administered to a patient in need thereof as an active principle for producing a pharmacologically active product for the treatment of acute and/or chronic... Agent:

20140205691 - Medical composition containing stauntonia hexaphylla extract: Disclosed is an antipyretic drug comprising a Stauntonia Hexaphylla leaf extract as an active ingredient. The antipyretic drug is developed based on the finding that the Stauntonia Hexaphylla leaf extract has no cytotoxicity and exhibits superior antipyretic effects, as compared to conventional antipyretic drugs having antipyretic effects. An antipyretic composition... Agent: Jeonnam Bioindustry Foundation

20140205692 - Methods and pomegranate extract composition for treating diabetes related atherosclerotic complications in humans: One or more embodiments of the invention are directed to methods of using pomegranate extracts for treating diabetes related atherosclerotic complications in humans. The methods comprise the step of administering to the patients a composition comprising a therapeutically effective amount of an extract from pomegranate.... Agent: Pom Wonderful, LLC

20140205693 - Bacterial extract for respiratory disorders and process for its preparation: The present invention relates to an extract from bacterial strains, such as Staphylococcus, Moraxella, Klebsiella, Streptococcus, and Haemophilus. The extract is useful as a treatment for indications such as respiratory disorders, compositions comprising the extract, and processes of making the extract from media that do not pose a risk of... Agent: Om Pharma Sa

  
07/17/2014 > 190 patent applications in 94 patent subcategories.

20140199234 - Bcl-2/bcl-xl inhibitors and therapeutic methods using the same: Inhibitors of Bcl-2/Bcl-xL and compositions containing the same are disclosed. Methods of using the Bcl-2/Bcl-xL inhibitors in the treatment of diseases and conditions wherein inhibition of Bcl-2/Bcl-xL provides a benefit, like cancers, also are disclosed.... Agent: The Regents Of The University Of Michigan

20140199233 - Enhanced growth inhibition of osteosarcoma by cytotoxic polymerized liposomal nanoparticles targeting the alcam cell surface receptor: The present invention relates to the fabrication and uses of liposomal nanoparticles.... Agent: Nanovalent Pharmaceuticals, Inc.

20140199232 - Targeted therapeutic nanoparticles: Disclosure of methods and compositions related to chemical conjugations to nanoparticles of polysaccharides cross-linked to poloxamers as well as nano-sized colloids comprised of polysaccharides and poloxamers. The nanoparticles may be produced by various methods including inverse miniemulsion polymerization processes which create nanogels of desired size, shape, and stability for controlled... Agent: Nanoderm Sciences, Inc.

20140199235 - Nanoparticle coated with ligand introduced with long hydrophobic chain and method for preparing same: The present invention relates to a nanoparticle having a linker connected to a long alkane or alkene chain, and a method for preparing the nanoparticle. The alkyl chain of C10-30 introduced with a ligand of the present invention can be coated on a hydrophobic nanoparticle through a noncovalent bond, enabling... Agent: Snu R&db Foundation

20140199236 - Androgen receptor modulator and uses thereof: e

20140199237 - Methods and compositions for modulation of olfml3 mediated angiogenesis: The present invention relates to antibodies against specific domains of Olfml3 and the use of such in angiogenesis. In particular aspects, angiogenesis-related conditions, such as cancer, can be treated by the composition comprising the Olfml3 antagonists.... Agent: Research Development Foundation

20140199238 - Targeting of bone marrow neovasculature: Antibodies which bind an antigen of the bone marrow neovasculature in leukaemia patients, for use in treatment and diagnosis of leukaemia, in particular the treatment and diagnosis of acute myeloid leukaemia (AML).... Agent:

20140199239 - Compositions and methods for in vivo imaging: The present disclosure provides lipid-probe compounds, and compositions comprising the compounds. A subject lipid-probe compound is useful for various imaging applications, which are also provided.... Agent: The Regents Of The University Of California

20140199240 - Anticancer agent: The invention relates to a method for preparing a bisphosphonate covalently bonded to a nanostructure. This invention also relates to a bisphosphonate having incorporated therein a radioisotope selected from 32p or 33P, preferably 33p, wherein the bisphosphonate is covalently bonded to a nanostructure directly or by way of a linker,... Agent: The South African Nuclear Energy Corporation Limited

20140199243 - Bifunctional phosphonate chelating agents: A represents either a nitrogen atom, or a ring having 3 to 6 carbon atoms, or an aromatic ring having 5 to 10 members, the ring and the aromatic ring optionally include one or more heteroatoms selected from N, O and S, and W represents a grafting function and X... Agent: Centre National De La Recherche Scientifique

20140199242 - Compositions and methods for detection and treatment of cancer: Novel antibodies for the detection and/or treatment of a cancer (e.g., a pancreatic cancer or an ovarian cancer) are provided. In certain embodiments the antibodies bind a region of the MUC4 protein that does not comprise the central tandem repeat (TR) domain of MUC4. Certain antibodies bind to the MUC4... Agent: Board Of Regents Of The University Of Nebraska

20140199244 - Controlled release system: The present invention relates to controlled release systems that may be administered other than intravenously. The controlled release system is directed to active ingredients, entrapped in or otherwise incorporated in or coupled to polymer carriers or polymeric devices, such as micelles, nanoparticles, microspheres and other types of polymer devices for... Agent: Cristal Delivery B.v.

20140199241 - Liposomes comprising polymer-conjugated lipids and related uses: The present invention provides liposomes comprising a lipid bilayer and a polymer-conjugated lipid, wherein said polymer-conjugated lipid is incorporated into said lipid bilayer. The present invention also provides methods of producing the liposomes as well as a method of delivering a nucleic acid to a subject comprising the step of... Agent: Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.

20140199245 - Oligonucleotide-based probes for detection of bacterial nucleases: The present invention relates to a rapid detection of microbial-associated nuclease activity with chemically modified nuclease (e.g., ribonuclease) substrates, and probes and compositions useful in detection assays. Accordingly, in certain embodiments, the present invention provides a probe for detecting a microbial endonuclease comprising a substrate oligonucleotide of 2-30 nucleotides in... Agent: University Of Iowa Research Foundation

20140199247 - Brine and method for the manufacture thereof: The present invention relates to a method for manufacturing a brine with improved features for use in food as a condiment and for the preservation and treatment of fish and shellfish, improving the organoleptic and nutritional properties of the foods treated and/or cooked with it. The brine with improved features... Agent:

20140199246 - Stevia composition: Stevia compositions are prepared from steviol glycosides of Stevia Rebaudiana Bertoni. The compositions are able to provide a superior taste profile and can be used as sweetness enhancers, flavor enhancers and sweeteners in foods, beverages, cosmetics and pharmaceuticals.... Agent: Purecircle Usa Inc.

20140199249 - Compositions for depositing agents using highly volatile silicone solvents: The invention relates to the field of depositing agents on surfaces using highly volatile silicone solvents. Particularly, the invention relates to novel compositions useful for depositing agents on skin and other surfaces.... Agent: Thompson Cooper Laboratories, LLC

20140199251 - Dispersion: An object of the present invention is to obtain a dispersion in which a water-repellent inorganic powder is dispersed in water. The dispersion can be handled easily because the dispersion medium is water. In the case of using the dispersion for cosmetics, the dispersion can be suitably used when an... Agent: Sakai Chemical Industry Co. Ltd.

20140199250 - Personal care composition and methods containing hydrophobically-modified hydroxyethylcellulose: Described are personal care compositions, comprising water, nonionic cellulose ethers having hydroxyethyl groups and being further substituted with one or more hydrophobic substituents, and at least one hair fixative polymer, moisturizer, conditioner, humectant, cationic conditioning polymer, antioxidant, anti-aging active, or sun care active.... Agent: Rohm And Haas Company

20140199248 - Spray tanning delivery device: An apparatus for delivering liquid includes a wand with a nozzle, a toggle switch, and a supply canister for delivering self-tanning and sun-tanning solutions to a human body. The wand may pivotably attach to a cap attached to the supply canister containing the chosen liquid to be delivered without the... Agent:

20140199252 - Silicone-free antiperspirant compositions and methods for manufacturing silicone-free antiperspirant compositions: Silicone-free antiperspirant compositions and methods for fabricating silicone-free antiperspirant compositions are provided. In accordance with an exemplary embodiment, an antiperspirant composition includes an active antiperspirant compound, stearyl alcohol, a C14-C16 fatty alcohol, and a carrier fluid. The carrier fluid is composed of a first volatile hydrocarbon component selected from a... Agent: The Dial Corporation

20140199253 - Personal care compositions: A personal care formulation comprising an active compound is operable to reduce the surface friction of hair fibres and promoting inter-fibre movement. The active compound is the reaction product of a fatty acid and a polyamine. The use of the active compound in a personal care formulation works as a... Agent: Croda International PLC

20140199256 - Cosmetic compositions including natural or naturally derived polyesters: A hair styling composition comprising at least one naturally derived poly(lactic acid) film-forming polymer and a carrier.... Agent:

20140199254 - Multifunctional hair color protector: This invention relates to the synthesis of a multifunctional hair color protector, p-methoxy cinnamidoproyl dimethyl behenyl ammonium chloride of Formula I and the compositions containing the same for hair care.... Agent: Galaxy Surfactants Ltd.

20140199255 - Use of natural or naturally derived polyesters as hair fixatives: The invention relates to a use of a composition comprising at least one naturally derived poly(lactic acid) film-forming polymer and a carrier for styling mammalian hair.... Agent:

20140199257 - Composition for reducing toilet odor containing polypropylene glycol as a reactive gas barrier: A method and composition is provided that aids in the reduction of objectionable volatile odors when a few drops are placed in the toilet prior to use. In one embodiment, the composition contains a high molecular weight polypropylene glycol (PPG) together with a dispersing agent to create an instantaneous multifunctional... Agent: Kendall Moulding & Frames, Inc.

20140199258 - Listeria-based adjuvants: This invention provides methods and compositions for using Listeria monocytogenes as an adjuvant for enhancing immune responses in a subject.... Agent:

20140199260 - Compositions and methods for the treatment of hiv: Compositions and methods for the treatment of HIV are provided.... Agent:

20140199259 - Stabilized liquid formulation: The present invention relates to a liquid formulation comprising an active substance and protamine, wherein the liquid formulation differs from a suspension.... Agent:

20140199263 - Heterocyclic-substituted benzofuran derivatives and methods of use thereof for the treatment of viral diseases: The present invention relates to compounds of formula (I) that are useful as hepatitis C virus (HCV) NS5B polymerase inhibitors, the synthesis of such compounds, and the use of such compounds for inhibiting HCV NS5B polymerase activity, for treating or preventing HCV infections and for inhibiting HCV viral replication and/or... Agent:

20140199262 - Method for manufacturing protein drug: The present invention provides a method for manufacturing a virus-free protein drug, comprising (a) a filtration step of filtering a virus-containing protein solution through a small-pore size virus removal membrane to obtain a virus-free protein solution, the filtration step (a) comprising (q) a low-pressure filtration step of filtering the solution... Agent: Asahi Kasei Medical Co., Ltd.

20140199261 - Method of reducing multi-drug resistance using inositol tripyrophosphate: Inositol trisphosphate (ITPP) causes normalization of tumor vasculature and is a particularly effective cancer therapy when a second chemotherapeutic agent is administered following partial vascularization. ITPP also treats, alone or in combination, multi-drug resistant cancers. ITPP can also be used to reduce the amount of a second chemotherapeutic drug required... Agent: Normoxys, Inc.

20140199264 - Tetracyclic xanthene derivatives and methods of use thereof for the treatment of viral diseases: The present invention relates to novel Tetracyclic Xanthene Derivatives of Formula (I) and pharmaceutically acceptable salts thereof, wherein A, Y1, Y2, Z, Ra, Rb, R1a, R1b and R2 are as defined herein. The present invention also relates to compositions comprising at least one Tetracyclic Xanthene Derivative, and methods of using... Agent:

20140199266 - Honey nasal rinse: Novel nasal rinse compositions are disclosed. The nasal rinse comprises a dried particulate composed of honey and a carrier. The composition may be a co-processed composition wherein the honey and carrier are combined while the honey is in liquid form and processed together to produce the dried particulate. Methods for... Agent: Lost Creek Consulting, LLC

20140199267 - Methods for ameliorating symptoms or conditions caused by stress: The invention provides methods for using fatty acid alkanolamides for ameliorating one or more symptoms or conditions caused by stress, e.g., loss of appetite, or for maintaining and enhancing nutrient and caloric intake by an animal under stress or that has experienced stress. Generally, the fatty acid alkanolamides in amounts... Agent: Nestec Sa

20140199265 - Nutritional compositions containing a neurologic component and uses thereof: The present disclosure relates to nutritional compositions comprising a neurologic component, wherein, the neurologic component may promote brain and nervous system development and further provide neurological protection and repair. The neurologic component may include phosphatidylethanolamine, sphingomyelin, cytidine diphosphate-choline, ceramide, uridine, at least one ganglioside, and mixtures thereof. The disclosure further... Agent: Mead Johnson Nutrition Company

20140199268 - Variants of hepatitis b virus with resistance to anti-viral nucleoside agents and applications thereof: The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance to nucleoside or nucleotide analogs and/or reduced interactivity with antibodies to viral... Agent: Abl Sa

20140199278 - Brown adipocyte modification: Methods and therapeutics are provided for treating metabolic disorders by increasing activation of brown adipose tissue. Generally, the methods and therapeutics can increase activation of brown adipose tissue to increase energy expenditure and induce weight loss. In one embodiment, a method for increasing activation of brown adipose tissue includes modifying... Agent: Ethicon Endo-surgery, Inc.

20140199279 - Methods for enhancing the delivery of gene-transduced cells: The present invention provides novel methods for enhancing the delivery of transduced cells to a subject, which include both methods of selecting for transduced cells and methods of enhancing the reconstitution by transduced cells in a transplant recipient. The present invention further provides transfer vectors, including lentiviral vectors, useful in... Agent: Bluebird Bio, Inc.

20140199280 - Modulation of bio-electrical rhythms via a novel engineering approach: The present invention relates to novel compositions and methods to induce, and/of modulate bio-electrical rhythms (e.g. in cardiac, neuronal and pancreatic cells) by fine-tuning the activity of HCN-encoded pacemaker channels via a novel protein- and genetic-engineering approach to augment or attenuate the associated physiological responses (e.g. heart beat, neuronal firing,... Agent: The Johns Hopkins University

20140199269 - Chromobacterium bioactive compositions and metabolites: Provided are bioactive compounds and metabolites derived from Chromobacterium species culture responsible for controlling pests, compositions containing these compounds, methods for obtaining these compounds and methods of using these compounds and compositions for controlling pests.... Agent: Marrone Bio Innovations, Inc.

20140199270 - Methods and compositions to reduce fat gain, promote weight loss in mammals: The present disclosure relates to compositions and related methods to reduce body weight, body fat, waist and hip size, plasma total cholesterol, LDL, triglycerides, blood glucose, leptin and C-reactive protein levels and increase in HDL and serotonin levels in an mammal. The LeptiCore® formulation disclosed, at both the low and... Agent:

20140199281 - Synergistic bacterial compositions and methods of production and use thereof: Provided are therapeutic compositions containing Ecobiotic™ populations for prevention, treatment and reduction of symptoms associated with a dysbiosis of a mammalian subject such as a human.... Agent: Seres Health, Inc.

20140199272 - Aav mediated exendin-4 gene transfer to salivary glands to protect subjects from diabetes or obesity: The invention relates to a gene transfer-based method to protect a subject from diabetes or obesity. The method comprises administering to a salivary gland of the subject an AAV virion comprising an AAV vector that encodes an exendin-4 protein. Also provided are exendin-4 proteins and nucleic acid molecules that encode... Agent: Health And Human Services

20140199271 - Method for control of deleterious microbes in oil and gas and other industrial fluids: A method of controlling a deleterious bacteria in oil and gas production, oil and gas completion fluids or other industrial fluids is described which includes identifying a phage capable of infecting the deleterious bacteria, identifying a biocide compatible with the phage and effective against the deleterious bacteria and injecting the... Agent: Multi-chem Group, LLC

20140199276 - Inkjet printing of tissues and cells: Provided herein is an apparatus for printing cells which includes an electrospinning device and an inkjet printing device operatively associated therewith. Methods of making a biodegradable scaffold having cells seeded therein are also provided. Methods of forming microparticles containing one or more cells encapsulated by a substrate are also provided,... Agent: Wake Forest University Health Sciences

20140199273 - Methods for diagnosis, prognosis and methods of treatment: The present invention provides an approach for the determination of the activation states of a plurality of proteins in single cells. This approach permits the rapid detection of heterogeneity in a complex cell population based on activation states, expression markers and other criteria, and the identification of cellular subsets that... Agent:

20140199277 - Methods of treatment of retinal degeneration diseases: The methods comprise administering cells having properties of stem cells or progenitor cells, to the retina and reprogramming of retinal cells mediated by cell fusion of said cells with said retinal cells, said reprogramming being mediated by activation of the Wnt/β-catenin signalling pathway.... Agent:

20140199274 - Neuronal progenitor cells and uses: Provided are methods of isolating a novel cell population of midbrain dopaminergic neuronal progenitor cells derived from stem cells using a novel combination markers. The cell population may be used for cell therapies for the treatment of Parkinson's disease and as substrates in pharmacological assays.... Agent: The Mclean Hospital Corporation

20140199275 - Treating tear film disorders with mesenchymal stem cells: This invention provides methods of preventing, reducing or inhibiting one or more symptoms of a tear film disorder by administration to a subject mesenchymal stem cells.... Agent: The Regents Of The University Of California

20140199283 - Formulations of albu-bche, preparation and uses thereof: The present invention provides an aqueous pharmaceutical composition comprising the fusion protein whose amino acid sequence is set forth as SEQ ID No:1 and an aqueous solution comprising 40 to 60 mM sodium phosphate. The present invention further provides a lyophilized pharmaceutical composition, an reconstituted solution, a sealed package comprising... Agent: Teva Pharmaceutical Industries, Ltd.

20140199282 - Soluble hyaluronidase glycoprotein (shasegp), process for preparing the same, uses and pharmaceutical compositions comprising thereof: Provided are soluble neutral active Hyaluronidase Glycoproteins (sHASEGP's), methods of manufacture, and their use to facilitate administration of other molecules or to alleviate glycosaminoglycan associated pathologies. Minimally active polypeptide domains of the soluble, neutral active sHASEGP domains are described that include asparagine-linked sugar moieties required for a functional neutral active... Agent:

20140199285 - Purine nucleoside phosphorylase as enzymatic activator of nucleoside prodrugs: A process for inhibiting a mammalian cancerous cell or virally infected cell includes providing a Trichomonas vaginalis purine nucleoside phosphorylase enzyme or a tail mutant purine nucleoside phosphorylase enzyme in proximity to the mammalian cancerous cell or the virally infected cell and exposing the enzyme to a purine nucleoside phosphorylase... Agent: The Uab Research Foundation

20140199284 - Structural mutations in titin cause dilated cardiomyopathy: Provided herein are diagnostic markers and methods for identifying a subject having an increased susceptibility for developing or having dilated cardiomyopathy. The method comprises determining if the subject has a mutation in the TTN nucleic as acid or titin polypeptide. Further provided herein are methods of treating subjects having or... Agent: The Brigham And Women's Hospital, Inc.

20140199286 - Lyophilization process: The present invention provides a process for producing a lyophilized pharmaceutical composition containing a protein. The present invention further provides a product produced by the process. The present invention further provides a process for producing an injectable pharmaceutical composition. The present invention further provides a method of treating a patient... Agent: Teva Pharmaceutical Industries, Ltd.

20140199287 - Non-neurotoxic plasminogen activating factors for treating of stroke: The invention concerns the use and the production of non-neurotoxic plasminogen activating factors, derived, for example, from the common vampire Desmodus rotundus (DSPA), for therapeutic treatment of stroke in humans. The invention provides a novel therapeutic base for treating stroke in humans.... Agent: H. Lundbeck A/s

20140199288 - Pharmaceutical compositions containing botulinum neurotoxin: This invention relates to the use of a composition comprising a polysaccharide and a botulinum toxin for reducing a skin wrinkle. In some embodiments, the polysaccharide comprises disaccharides. In some embodiments, the average molecular weight of a disaccharide unit of the polysaccharide is between about 345 D and about 1,000... Agent: Allergan, Inc.

20140199290 - Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof: The present invention is based on the discovery of genetic polymorphisms that are associated with Alzheimer's disease. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods... Agent: Celera Corporation

20140199289 - Use of matrix metalloproteinase inhibitors to treat tuberculosis: The present invention provides a method for treating a subject suffering from tuberculosis which comprises administering to the subject a composition comprising an amount of an inhibitor of a matrix metalloproteinase (MMP) in an amount effective to treat the subject, such that the therapeutic effect of said composition is different... Agent:

20140199296 - Cancer drug and uses: A pharmaceutical composition comprising a cancer therapeutic that is capable of inhibiting and/or reducing the ability of a cancer cell to take up and utilize glucose or other energy source, a lipid or other building block of a cell membrane or organelle, and/or cholesterol. The pharmaceutical composition can comprise one... Agent: Biocopea Limited

20140199299 - Combination therapies and methods using anti-cd3 modulating agents and anti-il-6 antagonists: This invention relates generally to compositions that contain multiple modulating agents, e.g., multiple modulating agents that target CD3 on T cells and neutralize one or more biological activities of interleukin-6 (IL-6), such as CD3 modulators including anti-CD3 antibodies and anti-IL-6 antagonists including anti-IL-6 antibodies, anti-IL-6R antagonists including anti-IL-6R antibodies, and/or... Agent:

20140199300 - Combination therapy for the treatment of cd19+ b-cell malignancies symptoms comprising an anti-cd1 maytansinoid immunoconjugate and rituzimab: A combination of an anti-CD19 maytansinoid immunoconjugate and rituximab is used for treating CD19+CD20+ B-cell malignancies symptom, in particular Non-Hodgkin's lymphoma.... Agent: Sanofi

20140199298 - Combination treatment of cancer comprising egfr/her2 inhibitors: c

20140199292 - Compositions and methods for inhibiting tumor development caused by chemotherapy induced senescence: The present invention relates to products and compositions containing (i) a chemotherapeutic agent and (ii) at least an active compound chosen from CCL2 inhibitors, CCR2 inhibitors, NF-κB inhibitors, PARP-1 inhibitors and ATM inhibitors, as a combined preparation for simultaneous, separate or sequential use for inhibiting tumor development caused by tumor... Agent: Inserm (institut National De La Sante Et De La Recherche Medicale)

20140199291 - Compositions and methods for the treatment of progressive multifocal leukoencephalopathy (pml): The invention relates to compositions, methods, and kits for treating subjects infected by or at risk of infection with a DNA virus (e.g., a JC Virus or a BK virus). Aspects of the invention are useful to prevent or treat DNA virus associated conditions (e.g., PML) in subjects that are... Agent: Biogen Idec Ma Inc

20140199294 - Heterodimerized polypeptide: The present inventors produced a heterodimerized polypeptide having an Fc region formed from two polypeptides with different amino acid sequences (a first polypeptide and a second polypeptide), and succeeded in producing a heterodimerized polypeptide containing an Fc region with improved Fc region function compared to that of a homodimer in... Agent: Chugai Seiyaku Kabushiki Kaisha

20140199293 - Humanized antibody compositions and methods for binding lysophosphatidic acid: Compositions and methods for making and using humanized anti-LPA monoclonal antibodies, and fragments and derivatives thereof, are described.... Agent:

20140199295 - Techniques for predicting, detecting and reducing aspecific protein interference in assays involving immunoglobulin single variable domains: This invention provides, and in certain specific but non-limiting aspects relates to: assays that can be used to predict whether a given ISV will be subject to protein interference as described herein and/or give rise to an (aspecific) signal in such an assay (such as for example in an ADA... Agent: Ablynx N.v.

20140199297 - Triterpene glycoside and triterpene compositions and methods of using same: In the present invention, different strategies are used to improve the bioavailability of triterpene glycosides and triterpenes including, for example, (a) a covalent approach involving modification with polyethylene glycol and (b) a formulation approach involving non-covalent encapsulation in antibody targeted pol(DL-lactic acid) nanoparticles.... Agent: Research Foundation Of The City University Of New York

20140199302 - Compositions for regulating iron homeostasis and methods of using same: The present disclosure relates to hemojuvelin-IgG Fc domain fusion proteins, variants, derivatives, fragments and peptide mimetics derived therefrom and methods of using these fusion proteins for the regulation of iron homeostasis and the treatment of diseases related to iron homeostasis.... Agent: Ferrumax Pharmaceuticals, Inc.

20140199304 - Methods for repairing tissue damage using protease-resistant mutants of stromal cell derived factor-1: The present invention features methods for treating or ameliorating tissue damage using intravenous administration of compositions that include stromal cell derived factor-1 (SDF-1) peptides or mutant SDF-1 peptides that have been mutated to make them resistant to protease digestion, but which retain chemoattractant activity. Systemic delivery, and specifically intravenous (“IV”)... Agent: Provasculon, Inc.

20140199305 - Protein comprising truncated form of extracellular region protein of frizzled2, and pharmaceutical composition for treating bone diseases which comprises said protein: The present invention provides a protein comprising a truncated form of an extracellular region protein of Frizzled 2, which has higher secretion activity than that of a known protein comprising an extralellular cysteine-rich domain of Frizzled 2 in a production cell and bone mass-increasing activity higher than or equal to... Agent: Kyowa Hakko Kirin Co., Ltd

20140199301 - Recombinant antibody structures binding to and blocking the activity of vascular endothelial growth factor 2 (vegfr- 2/kdr): Phage displayed recombinant antibody library was developed and the library was screened against VEGFR-2. After screening and ELISA experiments two recombinant antibodies showing binding properties to VEGFR-2 was obtained. The difference of the two recombinant antibodies to the recombinant antibodies already developed was demonstrated by DNA sequence analysis. The inhibition... Agent: Tubitak

20140199303 - Stable liquid formulation of etanercept: The present invention relates to a stable liquid formulation of etanercept (recombinant p75 sTNFR:Fc fusion protein), and more particularly, to a liquid formulation comprising one or more stabilizers selected from the group consisting of methionine, lysine, histidine, and pharmaceutically acceptable salts thereof in an amount sufficient to reduce by-product formation... Agent: Lg Life Sciences Ltd.

20140199306 - Compositions and methods for antibodies targeting epo: The present invention relates to compositions and methods for the inhibition of EPO. The invention provides antibodies and antigen binding fragments thereof that bind to EPO and are able to inhibit EPO-dependent cell proliferation and/or EPO-dependent cell signaling.... Agent: Novartis Ag

20140199308 - Compositions and methods to enhance the immune system: The invention relates to the field of molecular medicine. In particular, it relates to compositions and methods to enhance the clearance of aberrant cells, e.g. cancer cells or virus-infected cells, by the host's immune system. Provided is a composition comprising (i) a therapeutic compound that can trigger a host's immune... Agent: Stichting Sanquin Bloedvoorziening

20140199310 - Compositions comprising agents that inhibit neuropilin and tolloid like 2: We disclose agents that inhibit the expression of NETO-2 which has elevated expression in cancer stem cells; the use of NETO-2 as a diagnostic or prognostic marker of tumour initiation; the use NETO-2 polypeptides in the identification of agents that inhibit activity; and including antibodies that bind NETO-2 and vaccines... Agent: University Of York

20140199307 - Dosage regimen for administering a cd19xcd3 bispecific antibody to patients at risk for potential adverse effects: The present invention relates to a method for assessing (analyzing) the risk of potential adverse effects for a human patient mediated by the administration of a CD19xCD3 bispecific antibody to said patient comprising determining the ratio of B cells to T cells of said patient, wherein a ratio of about... Agent: Amgen Research (munich) Gmbh

20140199309 - Fragment of secreted heat shock protein-90alpha (hsp90alpha) as vaccines or epitope for monoclonal antibody drugs or target for small molecule drugs against a range of solid human tumors: The invention provides methods for treating HIF-1α-overexpressing human tumors, inhibiting HIF-1α-overexpressing tumor invasion and preventing tumor metastasis, and/or promoting tumor prophylaxis, using various types of inhibitors against the Hsp90α from the tumors.... Agent: University Of Southern California

20140199311 - Pharmaceutical composition for treatment and/or prophylaxis of cancer: This invention provides an antibody targeting a cancer antigenic protein specifically expressed on the surface of cancer cells and use thereof as a therapeutic and/or preventive agent for cancer. More specifically, the present invention provides an antibody, or a fragment thereof which has immunological reactivity with a CAPRIN-1 protein, the... Agent: Toray Industries, Inc.

20140199312 - Ddr1-binding agents and methods of use thereof: The present invention relates to DDR1 binding agents and methods of using the agents for treating diseases such as cancer. The present invention provides antibodies that specifically bind to an extracellular domain of DDR1 and modulate DDR1 activity. The present invention further provides methods of using agents that modulate the... Agent: Oncomed Pharmaceuticals, Inc.

20140199317 - Actriia binding agents and uses thereof: The disclosure provides, among other aspects, neutralizing antibodies and portions thereof that bind to ActRIIA and uses for same.... Agent: Acceleron Pharma, Inc.

20140199318 - Agonistic autoantibodies to the alpha1-adrenergic receptor and the beta2-adrenergic receptor in alzheimer's and vascular dementia: The invention relates to means for detecting, binding, removing and/or neutralising agonistic antibodies associated with dementia, preferably Alzheimer's disease or vascular dementia.... Agent: E.r.d.e.-aak-diagnostik Gmbh

20140199314 - Methods and compositions for regulating iron homeostasis by modulation of bmp-6: Modulation of iron homeostasis by regulating BMP-6 activity is provided. Methods of using BMP-6 and BMP-6 protein-specific reagents, such as antibodies, for altering serum iron levels in humans are provided. Such antibodies are useful in pharmaceutical compositions for the prevention and treatment of anemia and anemia of inflammation.... Agent: The General Hospital Corporation

20140199316 - Methods of treating complications and disorders associated with g-csf administration: The present embodiments relate to novel uses of MPO inhibitors and inhibitors of MPO and E-selectin binding. In some embodiments, methods are provided for treating G-CSF-induced vascular complications and associate tissue injury comprising administering to a subject in need thereof a compound that inhibits E-selectin receptor/ligand interaction or inhibits MPO... Agent:

20140199313 - Process for the production of fine chemicals: The present invention relates to a process for the production of the fine chemical in a microorganism, a plant cell, a plant, a plant tissue or in one or more parts thereof, preferably in plastids. The invention furthermore relates to nucleic acid molecules, polypeptides, nucleic acid constructs, vectors, antibodies, host... Agent: Metanomics Gmbh

20140199315 - Sp35 antibodies and uses thereof: Endogenous Sp35 is a negative regulator for neuronal survival, axon regeneration, oligodendrocyte differentiation and myelination (Negative Regulator). Molecules that block endogenous Sp35 function, such anti-Sp35 antibodies can be used as therapeutics for the treatment of neuron and oligodendrocyte dysfunction. The present invention provides antibodies specific for Sp35, and methods of... Agent: Biogen Idec Ma Inc.

20140199319 - Methods for increasing the efficiency of hybridoma generation: Disclosed herein are methods for improving the efficiency of the production of hybridomas, e.g., through enrichment of IgG expressing B cells. Also disclosed are hybridoma compositions produced using these methods as well as methods for producing antibodies with the hybridomas.... Agent: Abbvie, Inc.

20140199320 - Modulators of the nlrp3 inflammasome il-1beta pathway for the prevention and treatment of acne: The invention provides inhibitors capable of binding to a member of the inflammasome group comprised of IL-1β, IL-1 receptor type 1, NLRP3, ASC, Caspase-1 and cathepsin B with a dissociation constant of 10-8 mol/l or smaller for the prevention and treatment of acne, specifically an antibody, an antibody fragment, an... Agent: Universitat Zurich

20140199321 - Stabilizing polypeptides which have been exposed to urea: Methods for stabilizing polypeptides, such as anti-HER2 antibodies, which have been exposed to urea.... Agent: Genentech, Inc.

20140199322 - Transdiscal administration of specific inhibitors of pro-inflammatory cytokines: The present invention relates to injecting a high specificity cytokine antagonist into a diseased intervertebral disc.... Agent: Depuy Synthes Products, LLC

20140199323 - Monoclonal antibody: The present invention is related to methods and compositions for the therapeutic and diagnostic use in the treatment of diseases and disorders which are caused by or associated with amyloid or amyloid-like proteins including amyloidosis, a group of disorders and abnormalities associated with amyloid protein such as Alzheimer's disease. The... Agent: Ac Immune S.a.

20140199324 - Evaluating protein expression in patient stratification and other therapeutic, diagnostic and prognostic methods for cancer: Provided are compositions, methods and kits for quantifying the expression and/or activity of MMP-14 and other biomarkers of cancer, which may be used diagnostically and prognostically, e.g., in patient stratification and evaluation of appropriate therapeutic regimens.... Agent:

20140199326 - Inhibitors of cathepsin s for prevention or treatment of obesity-associated disorders: The present invention relates to methods (and pharmaceutical compositions) for treating and/or preventing for obesity associated disorders, particularly related to a deregulation of glucose homeostasis, by administrating Cathepsin S inhibitors. The invention also relates to methods for diagnosing insulin resistance and glucose tolerance by measuring Cathepsin S levels in a... Agent: Institut National De La Sante Et De La Recherche Medicale (inserm)

20140199328 - Interferon alpha antibodies and their uses: The present invention provides isolated anti-interferon alpha monoclonal antibodies, particularly human monoclonal antibodies, that inhibit the biological activity of multiple interferon (IFN) alpha subtypes but do not substantially inhibit the biological activity of IFN alpha 21 or the biological activity of either IFN beta or IFN omega. Immunoconjugates, bispecific molecules... Agent: Medarex, LLC

20140199327 - Methods of promoting differentiation: Provided herein are methods of promoting cell fate change, particularly differentiation of tumor cells, by inhibition of USP1, UAF1, and/or ID (e.g., ID1, ID2, and/or ID3).... Agent: Genentech, Inc.

20140199325 - Novel polypeptides and use thereof: The present invention provides a polypeptides capable of modulating tissue transglutarmnase-induced cell behaviour wherein the polypeptide comprises or consists of either (a) the amino acid sequence of a heparin-binding site of a tissue transglutaminase, or a functional fragment, variant, fusion or derivative thereof, or a fusion of said fragment, variant... Agent: Astonuniversity

20140199329 - Methods for treating and preventing neutrophil-derived net toxicity and thrombosis: Embodiments of the technology described herein are based upon the discoveries that neturophil extracellular traps (NETs) provide a stimulus for thrombus formation and that NETs are present in stored blood products. Accordingly, some embodiments relate to methods of treating and preventing toxicity of NETs and thrombosis caused by NETs. Additional... Agent: Children's Medical Center Corporation

20140199330 - Protein involved in detection of cancer metastasis and a treatment thereof: Using phosphoproteomics, we profiled the phosphorylation levels of hundreds of proteins concurrently across an isogenic model of breast cancer metastasis. Among them is TRPV4, a calcium channel that we found to be overexpressed in invasive breast tumors compared to ductal carcinoma in situ, a pre-neoplastic lesion and normal tissues. TRPV4... Agent: National University Of Singapore

20140199331 - Bio-orthogonal drug activation: The invention relates to a Prodrug activation method, for therapeutics, wherein use is made of abiotic reactive chemical groups that exhibit bio-orthogonal reactivity towards each other. The invention also relates to a Prodrug kit comprising at least one Prodrug and at least one Activator, wherein the Prodrug comprises a Drug... Agent: Koninklijke Philips N.v.

20140199332 - Method of treating cancer with an hla-a*3303-restricted wt1 peptide and pharmaceutical composition comprising the same: Disclosed are: a peptide comprising an amino acid sequence composed of contiguous nine amino acid residues derived from a WT1 protein, wherein an amino acid residue at position 2 in the amino acid sequence is selected from the group consisting of Ala, Ile, Leu, Val, Phe, Tyr, Ser and Asp... Agent: International Institute Of Cancer Immunology, Inc.

20140199333 - Aquaporin-4 peptides, compositions and methods of use: The present disclosure provides human Aquaporin 4 (AQP4) peptides and peptides having homology to human Aquaporin 4 (AQP4) peptides. Also provided herein are methods for using human AQP4 peptides and peptides homologous to human AQP4 peptides for diagnosing and/or treating Neuromyelitis Optica.... Agent: The Regents Of The University Of California

20140199335 - C1orf59 peptides and vaccines including the same: The present invention provides isolated peptides having the amino acid sequence of SEQ ID NO: 43 or immunologically active fragments thereof, which bind to HLA antigen and have cytotoxic T lymphocyte (CTL) inducibility. The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or... Agent: Oncotherapy Science, Inc.

20140199334 - Therapeutic compounds for immunomodulation: The present invention provides Immunosuppressive compounds capable of inhibiting the programmed cell death 1 (PD1) signalling pathway. The present invention further provides peptide based compositions for treatment of cancer or treatment of infections via immunopotentiation caused by inhibition of immunosuppressive signalling induced by PD-1, PD-L1, or PD-L2 and therapies using... Agent: Aurigene Discovery Technologies Limited

20140199336 - Tmem22 peptides and vaccines including the same: Isolated peptides composed of the amino acid sequence of SEQ ID NO: 33 or fragments thereof that bind to HLA antigens and have cytotoxic T lymphocyte (CTL) inducibility and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. The present invention... Agent:

20140199337 - Influenza h5 vaccines: The present invention is based on the surprising finding that H5 protein of clade 1 H5N1 induces, in particular by a single-shot vaccination, a cross-clade protective immune response to influenza viruses with H5N1 HA. In one aspect, the invention is thus directed to H5 protein of clade 1 H5N1 virus... Agent: Boehringer Ingelheim Vetmedica Gmbh

20140199338 - Vaccines for protection from and treatment of alzheimer's disease: Disclosed herein are DNA-based vaccines against amyloid β peptide for use in treating and alleviating Alzheimer's Disease and related conditions. A DNA construct comprising DNA encoding one or more amyloid β peptides, such as amino acids 1-11 of Aβ, and DNA encoding a hepatitis B antigens, is administered with an... Agent: Cyvax, Inc.

20140199339 - Compositions and methods for inducing immune responses against bacteria in the genus staphylococcus: This disclosure features compositions that include two or more staphylococcal toxoids and are useful for inducing protective immune responses against staphylococcal diseases.... Agent:

20140199340 - Tolerogenic synthetic nanocarriers for inducing regulatory b cells: Disclosed are synthetic nanocarrier methods, and related compositions, comprising B cell and/or MHC Class II-restricted epitopes and immunosuppressants in order to generate tolerogenic immune responses, such as the generation of antigen-specific regulatory B cells.... Agent: Selecta Biosciences, Inc.

20140199341 - Use of antrodia camphorata for treating diseases: The present invention relates to the use of antrodia camphorata in the treatment of skin conditions, such as acne vulgaris, urticaria and eczema, allergic rhinitis, diabetes mellitus and its complications, cancer cachexia, hypercholesterolemia, gout in a subject in need of such treatment. The present invention is also directed to the... Agent:

20140199342 - Composition and method to alleviate joint pain using algae based oils: A dietary supplement composition is formulated in a therapeutic amount to treat and alleviate symptoms of joint pain in a patient. The composition includes an algae based oil having glycolipids and phospholipids and Eicosapentaenoic (EPA) fatty acids in combination with astaxanthin and low molecular weight hyaluronic acid or sodium hyaluronate... Agent: U.s. Nutraceuticals, LLC D/b/a Valensa International

20140199343 - Recombinant vaccine against prrs in a viral vector: A live or inactivated recombinant vaccine is described, comprising a viral vector and a pharmaceutically acceptable vehicle, adjuvant and/or excipient, wherein the viral vector is capable of generating a cell immune response due to an increased alpha and/or gamma interferon production, and is capable of a quick replication, and it... Agent: Laboratorio Avi-mex, S.a. De C.v.

20140199344 - Anti-measles cancer immunotherapy: The present invention provides methods for treating specific populations of cancer patients by immunotherapy. The methods comprise administering an immunogenic composition eliciting an immune response to measles virus to patients having measles virus-immunoreactive cancer cells.... Agent: Mor Research Applications Ltd.

20140199345 - Immunostimulatory oligodeoxynucleotides: The present invention relates to immunostimulatory oligodeoxynucleotides, vectors and vaccines comprising such oligodeoxynucleotides, to their use as a medicament, to their use in preventing or combating infectious disease, to methods for the detection of such oligodeoxynucleotides and to cells to be used in these methods.... Agent:

20140199346 - Therapeutic agent for influenza virus infection diseases: Provided is a therapeutic agent for an influenza virus infectious disease, which utilizes an active ingredient derived from a natural product and has an excellent effect. The therapeutic agent for an influenza virus infectious disease includes, as an active ingredient, a β-glucan-containing composition obtained from a culture of a microorganism... Agent: Aureo Co., Ltd.

20140199347 - Adjuvant compositions with 4-1bbl: Streptavidin(SA)-4-1BBL and TLR agonists such as monophosphoryl lipid A (MPL) exhibit surprising synergy as adjuvants, inducing immune responses against weak antigens. Accordingly, there are provided adjuvant compositions comprising 4-1BBL and a toll-like receptor (TLR) agonist, such as MPL, methods of inducing an immune response against an antigen in a subject,... Agent: University Of Louisville Research Foundation, Inc.

20140199348 - Anti-viral compounds: Disclosed herein are compounds and related compositions for the treatment of viral infection, including RNA viral infection, and compounds that can modulate the RIG-I pathway in vertebrate cells, including compounds that can activate the RIG-I pathway.... Agent: Kineta, Inc.

20140199350 - Chimeric topical vaccine for haemophilus influenzae-induced disease: Provided are delivery systems for topically administering a chimeric protein including the NTHi twitching pilus major subunit protein (PilA) presenting a portion of the NTHi OMP P5 protein. Also provided are methods for eliciting a response by administrating the delivery systems to a subject.... Agent: Research Institute At Nationwide Children's Hospital

20140199349 - Ph-sensitive hyaluronic acid derivative and uses thereof: Disclosed is a pH-sensitive hyaluronic acid derivative, comprising at least one repeat unit as shown in the following formula (I), wherein HA represents a unit comprising N-acetyl-D-glucosamine and D-glucuronic acid, q represents an integer of 2 to 10,000; A represents a biocleavable linkage comprising at least one of hydrazone, acetal,... Agent: Industrial Technology Research Institute

20140199355 - Composition for oral cavity: An oral composition includes high stain removal efficiency relative to its abrasive ability. The oral composition contains fused silica and a dental abrasive. The oral composition has a high stain removal ability relative to the abrasive ability thereof. In other words, the ratio (stain removal ability/abrasive ability) of the oral... Agent: Sunstar, Inc.

20140199351 - Personal care solid granules that sustain essential oils and or plant herbal extracts that emulsify in hot water creating therapeutic solution: A Personal care 100% plant derived, biodegradable solid granules that sustain beneficial essential oils, and or plant/herbal extracts and emulsify in hot water to create an emulsified therapeutic solution is disclosed. This invention improves over existing liquids in that it's solid granule form is completely plant derived and biodegradable and... Agent:

20140199352 - Porous nanoparticles produced by solvent-free emulsification: The process for manufacturing porous nanoparticles disclosed herein includes feeding a dry-blended mixture of at least one resin and a neutralizing agent into a feed section of a screw extruder, injecting a surfactant solution downstream of the hopper, and adding an aqueous composition both directly after the surfactant solution as... Agent: Xerox Corporation

20140199353 - Three-layered hair conditioning composition and consumer product: Personal care compositions comprising three liquid layers, particular useful for treating hair. The compositions are visually three separate layers. One layer comprises an oil phase, one layer comprises a polyol phase, and one layer comprises a silicone phase. The compositions can be mixed homogenously upon shaking, and remain homogenous for... Agent:

20140199354 - Visually patterned and oriented compositions: Structured personal care compositions comprising a particle having an aspect ratio of greater than 1.5 are contemplated, as well as methods for using such compositions. The compositions provide a visually distinguishable, oriented pattern that is aesthetically pleasant to provide consumer appeal and product identification.... Agent: Colgate-palmolive Company

20140199357 - Antimicrobial and antiviral composition, and method of producing the same: An antimicrobial and antiviral composition, a method of producing the same, and the like are provided, which are capable of exhibiting an excellent antimicrobial and antiviral properties over a long time in the application for various uses. The antimicrobial and antiviral composition contains cuprous oxide particles having a BET specific... Agent: Showa Denko K.k.

20140199356 - Antimicrobial polymer systems using multifunctional organometallic additives for polyurethane hosts: Described are antimicrobial polymer products made from mixtures of antimicrobial organometallic additives dispersed throughout a polymer host matrix.... Agent:

20140199358 - Antimicrobial polymer systems using multifunctional organometallic additives for thermoset hosts: Described are antimicrobial polymer products made from mixtures of antimicrobial organometallic additives dispersed throughout a polymer host matrix.... Agent: Dmr International, Inc.

20140199359 - Antimicrobial polymer systems using multifunctional organometallic additives for wax hosts: Described are antimicrobial polymer products made from mixtures of antimicrobial organometallic additives dispersed throughout a polymer host matrix.... Agent: Dmr International, Inc.

20140199360 - Controlled covalent attachment of bioactive bacteriophage for regulating biofilm development: Medical devices that are resistant to biofilm development and methods of the manufacture of biofilm resistant medical devices are provided. One or more bacteriophages are tethered to the surface of a medical device or a hydrogen-type coating on the surface of the device by covalent bonding while maintaining bacteriophage infective... Agent: Cdc/the Govt. Of The U.s.a. Being Rep. By Sec. Of The Dept. Of Hlth. And Human Svcs., Ctrs. For Dis

20140199361 - Inhibitory anti-factor xii/xiia monoclonal antibodies and their uses: The invention relates to inhibitory anti-factor XII/FXIIa antibodies and methods of their use.... Agent:

20140199363 - Bone-regeneration material: The invention relates to a process for producing a bone-regeneration material. According to the method, a bio-compatible, open-pored body is exposed to a vacuum and osteoinductive and/or osteogenic substances are absorbed into the pores of the body, for example by means of a vacuum generated therein. It is thus possible... Agent: Depuy Synthes Products, LLC

20140199362 - Clonidine compounds in a biodegradable fiber: Effective treatments of pain for extended periods of time are provided. Through the administration of an effective amount of clonidine in a fiber at or near a target site, one can relieve pain caused by diverse sources, including but not limited to spinal disc herniation (i.e. sciatica), spondilothesis, stenosis, discogenic... Agent: Warsaw Orthopedic, Inc.

20140199364 - Drug loaded fibers: Implants and methods for the delivery of a therapeutic agent to a target location within a patient's body are disclosed. The implants include a fiber comprising a polymeric material and having a diameter of up to about twenty microns, and a first therapeutic agent within the fiber. The therapeutic agent... Agent:

20140199365 - Resorbable stents which contain a magnesium alloy: The present invention is directed to stents made of a magnesium alloy degradable under physiological conditions and an outer polymeric coating. Herein, the stents according to the invention can be additionally coated with at least one anti-inflammatory, antiproliferative, antiangiogenic, antirestenotic and/or antithrombogenic active agent.... Agent: Meko Laserstrahl-materialbearbeitungen E.k

20140199366 - Sustained release intraocular implants and methods for treating ocular neuropathies: Biocompatible intraocular implants include a beta adrenergic receptor antagonist and a polymer associated with the beta adrenergic receptor antagonist to facilitate release of the beta adrenergic receptor antagonist into an eye for an extended period of time. The beta adrenergic receptor antagonist may be associated with a biodegradable polymer matrix,... Agent: Allergan, Inc.

20140199367 - Topical transdermal method for delivering nutrients through the skin for expeditied wound healing and skin rejuvenation: o

20140199375 - Combination therapy for skin disorders: The present invention provides a novel therapeutic combination comprising one or more anti-androgen agents and one or more antibiotic/anti-inflammatory agents or pharmaceutically acceptable salts or hydrates thereof, useful for the treatment of a dermatological disorder.... Agent: M. Alphabet 1, LLC

20140199379 - Compositions having means for targeting at least one antigen to dendritic cells: A composition that can be used as a vaccine containing means for targeting at least one antigen to dendritic cells and as adjuvants a granulocyte macrophage colony stimulating factor and a CpG oligodeoxynucleotide and/or a CpG-like oligodeoxynucleotide. This composition can used to treat cancers, infectious diseases caused by bacterial, viral,... Agent: Institut National De La Sante Et De La Recherche Medicale

20140199370 - Cyclodextrin-based materials compositions and uses related thereto: This application discloses cyclodextrin-modified materials for carrying drugs and other active agents, such as nucleic acids. Compositions are also disclosed of cyclodextrin-modified materials that release such active agents under controlled conditions. The invention also discloses compositions of cyclodextrin-modified polymer carriers that are coupled to biorecognition molecules for assisting the delivery... Agent: Cerulean Pharma Inc.

20140199368 - Intraesophageal administration of targeted nitroxide agents for protection against ionizing irradiation-induced esophagitis: Provided herein are compositions and related methods useful for prevention or mitigation of ionizing radiation-induced esophagitis. The compositions comprise compounds comprising a nitroxide-containing group attached to a mitochondria-targeting group. The compounds can be cross-linked into dimers without loss of activity. The method comprises delivering a compound, as described herein, to... Agent: University Of Pittsburg-of The Commonwealth System Of Higher Education-office Of Technolology Manage

20140199374 - Methods for preparation of lipid-encapsulated therapeutic agents: Fully lipid-encapsulated therapeutic agent particles of a charged therapeutic agent are prepared by combining a lipid composition containing preformed lipid vesicles, a charged therapeutic agent, and a destabilizing agent to form a mixture of preformed vesicles and therapeutic agent in a destabilizing solvent. The destabilizing solvent is effective to destabilize... Agent:

20140199372 - Microbial growth factors: Disclosed are methods of cultivating or isolating a microorganism using one or more quinones as growth factors. Also disclosed are methods of treating a mammalian species with deficiency in symbionts using such compounds.... Agent: Northeastern University

20140199371 - Modified polynucleotides encoding basic helix-loop-helix family, member e41: The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmRNA molecules.... Agent: Moderna Therapeutics, Inc.

20140199377 - Multiple growth factor compositions, methods of fabrication, and methods of treatment: Disclosed are compositions with sustained-release carriers associated with at least two different types of growth factors and methods of fabrication and treatments thereof. In some embodiments, simultaneous release of the growth factors may be preferred while in other embodiments, sequential release of the growth factors may be preferred. Application of... Agent: Abbott Cardiovascular Systems Inc.

20140199376 - Nanoparticle and polymer formulations for thyroid hormone analogs, antagonists, and formulations thereof: Disclosed are methods of treating subjects having conditions related to angiogenesis including administering an effective amount of a polymeric Nanoparticle form of thyroid hormone agonist, partial agonist or an antagonist thereof, to promote or inhibit angiogenesis in the subject. Compositions of the polymeric forms of thyroid hormone, or thyroid hormone... Agent: Nanopharmaceuticals LLC

20140199378 - New natural and synthetic compounds for treating cancer and other diseases: This invention provides a method of synthesizing new active compounds for pharmaceutical uses including cancer treatment, wherein the cancers comprise breast, leukocytic, liver, ovarian, bladder, prostatic, skin, bone, brain, leukemia, lung, colon, CNS, melanoma, renal, cervical, esophageal, testicular, spleenic, kidney, lymphatic, pancreatic, stomach and thyroid cancers. This invention is an... Agent: Pacific Arrow Limited

20140199373 - Novel formulations and methods for treating dermatological disorders or diseases: The present invention provide compositions and methods for treating a dermatological disorder or disease.... Agent: Vapogenix, Inc.

20140199369 - Pharmaceutical composition: The disclosure provides a pharmaceutical composition. The pharmaceutical composition includes a chitosan with palmitoyl groups and an active agent. According to another embodiment, the pharmaceutical composition can further include a gelling accelerating agent. According to an embodiment of the disclosure, the active agent of the disclosure can be administered in... Agent:

20140199383 - Abuse resistant opioid containing transdermal systems: The present invention relates to transdermal dosage form (FIGS. 1-3) comprising at least one activating agent and at least one inactivating agent. The dosage form (FIGS. 1-3) releases the inactivating agent upon disruption of the dosage form (FIGS. 1-3) thereby preventing or hindering misuse of the active agent contained in... Agent: Purdue Pharma L.p.

20140199385 - Biodegradable, semi-crystalline, phase separated, thermoplastic multi block copolymers for controlled release of biologically active compounds: e

20140199381 - Core-shell microspheres: The specification describes a substance comprising a plurality of microparticles. The microparticles comprise a core comprising a first polymer and a shell surrounding said core and comprising the first polymer and a second polymer, wherein the second polymer is less rapidly degradable than the first polymer. A process for making... Agent: Agency For Science, Technology And Research

20140199384 - Facile route to the synthesis of resorcinarene nanocapsules: Described is a direct method for the fabrication of resorcinarene nanocapsules by photopolymerization of compounds of formula (I), such as resorcinarene tetraalkene tetrathiol (RTATT), in the absence of any template or preorganization. Further, by varying the polymerization media, a variety of other polymeric architectures like lattices, fibrous networks, and nanoparticles... Agent: Old Dominion University Research Foundation

20140199380 - Pharmaceutical composition comprising an algae adapted to increase the efficacy of an enzymatic inhibitor: A pharmaceutical composition comprising at least one algae, wherein said algae is adapted to increase the efficacy of an enzymatic inhibitor.... Agent:

20140199382 - Stable pharmaceutical compositions of an s1p receptor agonist: The present invention relates to a stable pharmaceutical composition comprising an S1P receptor agonist and one or more pharmaceutically acceptable excipients, wherein the composition is free of a sugar alcohol. It also relates to method of preparing such compositions and using those compositions in the treatment of multiple sclerosis.... Agent: Cadila Healthcare Limited

20140199386 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199387 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199388 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199390 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199389 - Enteric active substance delivery: An oral enteric delivery system includes an outer shell assembled from multiple solid shell segments joined together by a binder. The binder does not dissolve upon exposure to the gastric environment, but it dissolves in the upper small intestine, causing the shell to disintegrate and causing the payload contained within... Agent:

20140199391 - Methods of increasing solubility of poorly soluble compounds and methods of making and using formulations of such compound: The subject invention relates to novel soluble forms of planar ring structured organic compounds including flavonoids, and their production. The invention also includes the use of these novel formulations of planar ring structured organic compounds in the preparation of formulations and products. The invention also relates to a wide variety... Agent: Api Genesis, LLC

20140199392 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199393 - Controlled release pharmaceutical compositions comprising a fumaric acid ester: The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that... Agent: Forward Pharma A/s

20140199394 - Controlled release hydrocodone: A solid oral controlled-release dosage form of hydrocodone is disclosed, the dosage form comprising an analgesically effective amount of hydrocodone or a pharmaceutically acceptable salt thereof, and controlled release material.... Agent: Purdue Pharma L.p.

20140199397 - Benzoyl peroxide microparticle process: The present invention relates to the manufacture of microparticle benzoyl peroxide. The process of the invention provides for an aqueous slurry of USP benzoyl peroxide, optionally containing additives, being processed via microfluidization technology. The process comprises forcing a slurry of benzoyl peroxide at high pressure through a narrow channel designed... Agent:

20140199398 - High capacity diektopiperazine microparticles and methods: Disclosed herein are diketopiperazine microparticles having high capacity for adsorbing a drug or active agent. In particular, the diketopiperazine microparticle are formed using fumaryl diketopiperazine and can comprise a drug in large doses for the treatment of disease or disorders by pulmonary delivery via oral inhalation.... Agent: Mannkind Corporation

20140199395 - Novel formulation of meloxicam: The present invention relates to methods for producing particles of meloxicam using dry milling processes as well as compositions comprising meloxicam, medicaments produced using meloxicam in particulate form and/or compositions, and to methods of treatment of an animal, including man, using a therapeutically effective amount of meloxicam administered by way... Agent: Iceutica Pty Ltd.

20140199396 - Process for the manufacture of a powder containing lutein: Process for the manufacture of a powder containing lutein, powder obtainable by said process and food composition containing said powder.... Agent: DsmIPAssets B.v.

20140199399 - Use of tgf-beta antagonists to treat infants at risk of developing bronchopulmonary dysplasia: The disclosure relates to methods of treating an infant at risk of developing bronchopulmonary dysplasia, including premature infants, by administering a TGF-β antagonist during the perinatal period, including the prenatal period and/or the postnatal period. For administration during the prenatal period, the TGF-β antagonist can be administered either directly to... Agent: Genzyme Corporation

20140199400 - Active agent loaded uniform, rigid, spherical, nanoporous calcium phosphate particles and methods of making and using the same: Uniform, rigid, spherical nanoporous calcium phosphate particles that define an internal space and an amount of active agent present in the internal space are provided. Also provided are topical delivery compositions that include the active agent loaded particles, as well as methods of making the particles and topical compositions. The... Agent: Laboratory Skin Care, Inc.

20140199401 - Extended release pharmaceutical compositions of fesoterodine: A stable extend release pharmaceutical composition is disclosed. The composition comprises particles of fesoterodine or salts thereof, one or more rate controlling polymers and one or more pharmaceutically acceptable excipients wherein at least 90% of the total amount of particles of fesoterodine or salts thereof by volume (D90) are having... Agent: Cadila Healthcare Limited

20140199402 - Novel compounds for the treatment of inflammatory bowel disease: The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the... Agent:

20140199404 - Method for treating cancer based on level of a nucleoside transporter: The present invention provides methods and compositions for treating cancer by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and b) a nucleoside analog (e.g., gemcitabine) based upon levels of a nucleoside transporter (e.g., hENT1).... Agent: Abraxis Bioscience, LLC

20140199405 - Method for treating cancer based on mutation status of k-ras: The present invention provides methods and compositions for treating cancer by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and/or b) a therapeutic agent (e.g., gemcitabine) based upon K-ras mutation status.... Agent:

20140199403 - Methods of treating pancreatic cancer: Provided herein are methods for the treatment of metastatic pancreatic cancer comprising administration of a composition comprising nanoparticles comprising a taxane (such as paclitaxel) and a carrier protein in combination with gemcitabine.... Agent: Abraxis Bioscience, LLC

20140199406 - Coating composition, drug-containing particle, solid preparation and method for preparing drug-containing particle: Provided are a drug-containing particle capable of suppressing dissolution of a drug in the oral cavity to suppress an unpleasant taste thereof and having excellent dissolution of the drug in the digestive tract after passing through the oral cavity; a method for preparing the drug-containing particle; a coating composition used... Agent: Shin-etsu Chemical Co., Ltd.

20140199407 - Palladium-ruthenium-zinc-organo complexes and methods for their use in the treatment of inflammatory diseases: The described invention provides organometallic complexes capable of spin transfer, comprising at least three different metals and the use of pharmaceutical compositions comprising such complexes in detoxification of reactive oxygen species in inflammatory conditions.... Agent:

20140199408 - Therapeutic stem cell nutrient composition and uses thereof: The present invention relates to a composition and uses thereof for treatment of damaged tissue comprising at least one essential amino acid in L form and at least one essential lipid; wherein the composition is administered to a mammal suffering from severe tissue damage. The invention further relates to a... Agent: Immunopath Profile, Inc.

20140199409 - Oxygenated demineralized bone matrix for bone growth: An improved composition for inducing bone growth is provided that is a mixture of DBM and a perfluorocarbon oxygen carrier. Injection/implantation of a composition of DBM and a perfluorocarbon results in enhancement of bone formation.... Agent: Theracell, Inc.

20140199410 - Edible brown algae extract with a low iodine content: The invention relates to a brown algae extract containing less than 50 ppm of iodine and between 5 and 15%, and preferably between 8 and 10%, of polyphenols, said percentage of polyphenols being expressed as a chlorogenic acid equivalent in relation to the dry weight of the extract, the invention... Agent: Algues Et Mer

20140199411 - Therapeutic agent for emphysema and copd: The invention described herein relates to methods of treating emphysema and COPD with a GHK tripeptide. The invention further relates to methods of determining the state of the lungs using biomarkers described herein.... Agent: Trustees Of Boston University

20140199412 - Treating inflammation with a binding system: The teachings provided herein generally relate to site-activated binding systems that selectively increase the bioactivity of phenolic compounds at target sites. More particularly, the systems taught here include a phenolic compound bound to a reactive oxygen species, wherein the phenolic compound and the reactive oxygen species react at a target... Agent: Liveleaf, Inc.

20140199413 - Melatonin and an antimicrobial or antibacterial agent for the treatment of acne: The invention relates to formulations for topical use comprising an antiseborrheic agent and an antimicrobial and/or antibacterial agent for the treatment of inflammatory dermatoses. In particular said formulations comprise melatonin and an antimicrobial or antibacterial agent, can be used in the pharmaceutical, cosmetic/cosmeceutical or dermatological field and are particularly suitable... Agent: Novaera S.r.l.

20140199414 - Krill and/or marine extracts for prevention and/or treatment of cardiovascular diseases, arthritis, skin cancer, diabetes, premenstrual syndrome and transdermal transport: The present invention relates to a method of treatment and/or prevention of cardiovascular disease, rheumatoid arthritis, skin cancer, premenstrual syndrome, diabetes and transdermal transport enhancement. The method comprises the administration of a therapeutically effective amount of krill and/or marine oil to a patient. The present invention also relates to a... Agent: Neptune Technologies & Bioressources Inc.

20140199415 - Pharmaceutical combination comprising a cip2a silencing agent for use in the treatment of a hyperproliferative disorder, preferably one with impaired p53 function: The invention is based on a finding that silencing CIP2A (KI-AA1524) gene sensitizes cancer cells for apoptosis-inducing activity of certain small molecule chemotherapeutic agents. Thus, the invention is directed to a respective combination therapy, sensitization method and pharmaceutical compositions. The invention further relates to a method of selecting cancer therapy... Agent: Turun Yliopisto

20140199416 - Mold and mildew stain removing solution: A solution having improved mold and mildew stain removing properties on hard surfaces, that is easier to handle (less corrosive and less malodorous) and that is environmentally friendly. The mold and mildew stain removing solution includes the following components: a surfactant selected from the group consisting of alcohol ethoxylates, alkyl... Agent: Jelmar, LLC.

20140199417 - Antihistamines combined with dietary supplements for improved health: The present invention provides combinations comprising a sedating antihistamine and selected indole-based natural products such as L-tryptophan, 5-hydroxytryptophan and melatonin, along with pharmaceutically acceptable calcium and magnesium salts and selected B vitamins. These combinations are useful in providing a medicament for improving sleep in mammals, especially humans.... Agent: Requis Pharmaceuticals Inc.

20140199418 - Herpes treatment: Herpes infections in hum an patients can be treated with injections of garlic juice. The garlic juice is produced by cutting, crushing, or otherwise damaging garlic cloves, and collecting the juice. This garlic juice is dissolved in a carrier solution, such as water or saline, and then injected into the... Agent:

20140199419 - Composition comprising banyan tree, lotus, and clover serum fractions (hyperpigmentation): The present invention relates to compositions comprising banyan tree, lotus, and clover serum fractions. A method of improving the appearance of a hyperpigmented spot may comprise the step of applying a composition comprising an effective amount of banyan tree serum fraction, lotus serum fraction, and clover serum fraction to a... Agent: Akzo Nobel Chemicals International B.v.

20140199420 - Uses of toona sinensis extract: The present invention is related to a Toona sinensis extract for antibacterial. The Toona sinensis extract has the ability to inhibit growth or reproduction of bacteria and also to prevent corruption, color change and acidification of foods. So that, it can replace commercial ingredients and be applied to antibacterial, pharmaceutical... Agent: National Chung Hsing University

20140199421 - Botanical composition and methods of manufacture and use: A botanical composition and combinations thereof that include a leaf extract of Hylotelephium spectabile (Boreau) H. Ohba and is useful for treating and/or preventing histamine-mediated conditions or disorders are described. Methods of manufacture and use thereof are also described.... Agent: Marvphyt Development LLC

  
  
Previous industry: Chemistry of inorganic compounds
Next industry: Plastic article or earthenware shaping or treating: apparatus


######

RSS FEED for 20140724: xml
Integrate FreshPatents.com into your RSS reader/aggregator or website to track weekly updates.
For more info, read this article.

######

Thank you for viewing Drug, bio-affecting and body treating compositions patents on the FreshPatents.com website. These are patent applications which have been filed in the United States. There are a variety ways to browse Drug, bio-affecting and body treating compositions patent applications on our website including browsing by date, agent, inventor, and industry. If you are interested in receiving occasional emails regarding Drug, bio-affecting and body treating compositions patents we recommend signing up for free keyword monitoring by email.



Results in 1.70777 seconds

PATENT INFO