SEARCH:      Monitor Keywords |  Custom RSS

Drug, bio-affecting and body treating compositions January recently filed with US Patent Office 01/13

20130028835 - Method for generating active antibodies against a resistance antigen, antibodies obtained by said method and their uses: The present invention relates to the use of a milled homogenate and/or a suspension and/or a cell lysate, stemming from a tumor resistant to at least one anti-tumoral compound in order to immunize and generate in vitro an antibody, or one of its functional fragments, directed against a tumoral antigen... Agent:

20130028836 - Chlorotoxin polypeptides and conjugates and uses thereof: Reduced lysine chlorotoxin polypeptides that may be used to generate single species conjugates of chlorotoxin. Conjugates comprising such chlorotoxin polypeptides and pharmaceutical compositions thereof. Methods of using such compositions and/or conjugates.... Agent: Morphotek, Inc.

20130028837 - Contrast agents for myocardial perfusion imaging: The present disclosure is directed, in part, to compounds and methods for imaging myocardial perfusion, comprising administering to a patient a contrast agent which comprises a compound that binds MC-1, and an imaging moiety, and scanning the patient using diagnostic imaging.... Agent: Lantheus Medical Imaging, Inc.

20130028838 - F18-tyrosine derivatives for imaging bone metastases: This invention relates to radioactive tyrosine derivatives for imaging bone metastases, a method for imaging or diagnosing bone metastases, compositions and kits for imaging bone metastases.... Agent: Piramal Imaging Sa

20130028840 - Fabrication of conducting open nanoshells: A method involving ion milling is demonstrated to fabricate open-nanoshell suspensions and open-nanoshell monolayer structures. Ion milling technology allows the open-nanoshell geometry and upward orientation on substrates to be controlled. Substrates can be fabricated covered with stable and dense open-nanoshell monolayer structures, showing nanoaperture and nanotip geometry with upward orientation,... Agent: Imec

20130028841 - Mixing device, mixing tube, drug solution injecting system, and drug solution mixing method: To provide a mixing device, a mixing tube, a drug solution injecting system, and a drug solution mixing method capable of evenly and efficiently mixing a plurality of kinds of drug solutions. The mixing device according to the present invention includes: a swirling flow generating chamber; a first inflow opening... Agent: Nemoto Kyoridno Co., Ltd.

20130028839 - Polymer coated sers nanotag: An encapsulated surface enhanced Raman scattering (SERS) tag. The tag includes a metal core and an encapsulant, typically a glass encapsulant. The encapsulant is further derivatized with a polymer.... Agent: Becton, Dickinson And Company

20130028843 - Kallikrein 7 modulators: The present invention relates to the crystal structure of the serine protease kallikrein 7 and to the use of this crystal structure in drug discovery. The present invention also relates to compounds binding specifically to this active site of kallikrein 7.... Agent: Novartis Ag

20130028842 - Method of treating binge eating disorder: The invention provides methods of treating binge eating disorders, obesity resulting from binge eating behavior, and depression. The invention includes methods of treating certain co-morbidities in ADHD and ADD patients; for example the invention includes methods of treating generalized anxiety disorder, obsessional and ruminative thought disorders, and obsessive/compulsive behavior in... Agent: Lcs Group, LLC

20130028844 - Preparations for effervescent formulations comprising cephalosporin and uses thereof: The present invention relates to a process for preparing effervescent dosage forms comprising at least one antibiotic of cephalosporin group. The present invention also relates to effervescent formulations and preparations comprising antibiotics of second generation cephalosporin.... Agent:

20130028845 - Levalbuterol salt: Levalbuterol L-tartrate affords crystals possessing properties desirable for use in a metered dose inhaler.... Agent: Sunovion Pharmaceuticals Inc.

20130028846 - Flavour modulating derivative of a carboxylic acid and a purine, pyrimidine, nucleoside, or nucleotide: and edible salts thereof and edible esters thereof, which can advantageously be used for modulating the flavour of foodstuffs, beverages, tobacco products, pharmaceutics and oral care products. These flavour modulating substances can be used to impart desirable taste attributes in a wide variety of applications and products. In addition, the... Agent: Givaudan Nederland Services B.v.

20130028847 - Biofilm treatment: The invention provides a method of preventing, inhibiting or reducing a P. gingivalis biofilm in a subject comprising administering to the subject a pharmaceutical composition comprising an inhibiting agent of a polypeptide that reduces or inhibits biofilm formation and/or biofilm development. Also provided are compositions useful in the prevention, inhibition... Agent: Oral Health Australia Pty Ltd

20130028848 - Method of inhibiting harmful microorganisms and barrier-forming composition therefor: A method for blocking, neutralizing, or killing microorganisms that cause infectious disease in a mammal prior to or during the mammal encountering a contaminated environment or item includes: identifying a contaminated environment or item, wherein the contaminated environment or item is known or expected to be contaminated with harmful viral,... Agent:

20130028849 - Agent for stimulating the expression of loxl: The present invention concerns a novel agent which is capable of stimulating the expression of LOXL and of increasing quality and functionality of collagen fibres and has anti-oxidizing, anti-elastase, anti-MMP properties as well as its use in producing cosmetic or pharmaceutical compositions, especially dermatological compositions, or food compositions.... Agent: Basf Beauty Care Solutions France S.a.s.

20130028852 - Oil-in-water emulsion composition: A oil-in-water emulsion composition which contains a low solubility but oil-soluble ultraviolet absorber. and which exhibits superior stability. The composition contains (a) an aqueous dispersion of an oil-soluble ultraviolet absorber; (b) a compound of a non-ionic surfactant and at least one type of fatty acid soap; (c) a water-swelling clay... Agent:

20130028851 - Sunscreen composition with improved aesthetic properties: Compositions for the protection of an object from UV light are provided. For example, in certain aspects, the compositions can include a plurality of silicone-containing compounds that improve the aesthetic properties.... Agent:

20130028850 - Topical tetracycline compositions: A topical therapeutic hydrophobic breakable composition includes a carrier comprising (a) about 60% to about 99% by weight of at least one hydrophobic oil; (b) at least one viscosity-modifying agents selected from the group consisting of a fatty alcohol, a fatty acid and a wax; and (c) a tetracycline antibiotic,... Agent: Foamix Ltd.

20130028853 - High spf sunscreen compositions: Methods and composition for the protection of an object from UV light are provided. For example, in certain aspects, the composition can include a plurality of photo stabilizers that enhance SPF values of the composition. Furthermore, the invention provides for the use of the compositions.... Agent:

20130028854 - Osmoprotective complexes for prevention of mitochondrial free radical damage related skin aging: The present invention discloses a method to inhibit a free radical, including a mitochondrial free radical, comprising administering to a subject in need thereof an effective amount of a composition comprising a compound of formula (I: a, b), an isomer, or a salt thereof:... Agent: Island Kinetics Inc.

20130028855 - Soft solid antiperspirant compositions including stearyl alcohol and cetyl and/or myristyl alcohol: Soft solid antiperspirant compositions are provided. In accordance with an exemplary embodiment, an antiperspirant composition comprises an active antiperspirant compound, a first fatty alcohol constituent comprising stearyl alcohol, and a second fatty alcohol constituent comprising C14 to C16 fatty alcohol. The exemplary soft solid antiperspirant composition has a first fatty... Agent: The Dial Corporation

20130028856 - Modified hyaluronidases and uses in treating hyaluronan-associated diseases and conditions: Provided are combinations, compositions and kits containing a hyaluronan degrading enzyme, such as a soluble hyaluronidase, for treatment of hyaluronan-associated conditions, diseases and disorders. In one example, the products include an additional agent or treatment. Such products can be used in methods for administering the products to treat the hyaluronan-associated... Agent:

20130028857 - Synthetic nanocarriers comprising polymers comprising multiple immunomodulatory agents: This invention relates to compositions, and related methods, of synthetic nanocarriers that comprise polymers that comprise at least two immunomodulatory agent moieties.... Agent: Selecta Biosciences, Inc.

20130028858 - Composition and method for attraction of emerald ash borer agrilus planipennis fairmaire (coleoptera: buprestidae): The invention disclosed relates to a novel composition and use thereof, for the attraction and detection of emerald ash borer, Agrilus planipennis Fairmaire. The composition comprises (3Z)-dodecen-12-olide and ash foliar or cortical volatiles (green leaf volatiles) associated with a prism trap of a color in the green range of the... Agent:

20130028860 - Antagonists of il-6 to prevent or treat cachexia, weakness, fatigue and/or fever: The present invention is directed to therapeutic methods and compositions, especially subcutaneous and intravenous composition using antibodies and fragments thereof having binding specificity for IL-6 to prevent or treat cachexia, fever, weakness and/or fatigue in a patient in need thereof. In preferred embodiments, the anti-IL-6 antibodies will be humanized and/or... Agent:

20130028861 - Cytokines for the treatment of addictions: The present invention relates to a cytokine for use in the treatment and/or control of dependent and/or addictive behavior, in particular addiction and/or dependency to nicotine, food addiction, alcohol addiction and/or sex addiction. The present invention also relates to treatment and/or control of withdrawal and/or symptoms of withdrawal from an... Agent: Immunservice Gmbh

20130028859 - Hepatitis c virus inhibitors: The present disclosure relates to compounds, compositions and methods for the treatment of hepatitis C virus (HCV) infection. Also disclosed are pharmaceutical compositions containing such compounds and methods for using these compounds in the treatment of HCV infection.... Agent: Bristol-myers Squibb Company

20130028864 - Anti-inflammatory compositions for treating brain inflammation: Compositions with synergistic anti-inflammatory effects in inflammatory diseases resulting from activation and consequent degranulation of mast cells and followed by secretion of inflammatory biochemicals from the activated mast cells, the compositions containing one or more of a flavone or flavonoid glycoside a heavily sulfated, non-bovine proteoglycan, an unrefined olive kernel... Agent: Theta Biomedical Consulting & Development Co., Inc.

20130028865 - Combination of a macrocyclic inhibitor of hcv, a non-nucleoside and a nucleoside: The present invention relates to a combination of a macrocyclic HCV protease inhibitor, a macrocyclic non-nucleoside HCV polymerase inhibitor and a nucleoside HCV polymerase inhibitor.... Agent: Janssen Pharmaceuticals, Inc.

20130028863 - Promyelocytic leukemia protein as a redox sensor: The present invention relates to a method for determining the redox status of a cell or tissue comprising a step consisting of determining the level of PML nuclear bodies in said cell or tissue.... Agent:

20130028862 - Treatment with anti-vegf antibodies: This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents.... Agent: Genentech, Inc.

20130028867 - Long-acting interferon beta formulation using immunoglobulin fragment: The present invention relates to a long-acting interferon beta formulation having improved in vivo duration and stability, comprising an interferon beta conjugate that is prepared by covalently linking interferon beta with an immunoglobulin Fc region via a non-peptidyl polymer, and a preparation method thereof. The long-acting interferon beta formulation of... Agent: Hanmi Science Co., Ltd.

20130028866 - Treatment of multiple sclerosis with combination of laquinimod and interferon-beta: This invention provides a method of treating a patient afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the patient laquinimod as an add-on therapy to or in combination with interferon-β. This invention also provides a package and a pharmaceutical composition comprising laquinimod and interferon-β for... Agent:

20130028868 - Clinical applications of a recombinant human endostatin adenovirus (e10a) injection: The present invention relates to the genetic engineering field of angiogenesis-targeted therapy. Particularly, a recombinant human endostatin adenovirus injection is used along with certain antitumor agents for treating specific tumors. The methods of the invention offer significant improvement of effective response rate, disease control rate, survival and quality of life.... Agent:

20130028875 - Immune effector cells pre-infected with oncolytic virus: Compositions and methods are provided for the treatment of cancer. An immune effector cell population is pre-infected with an oncolytic virus. The combined therapeutic is safe and highly effective, producing an enhanced anti-tumor effect compared to either therapy alone. The methods of the invention thus provide for a synergistic effect... Agent:

20130028876 - Thymidine kinase: A polynucleotide comprising a nucleotide sequence encoding a thymidine kinase wherein at least one of the nucleotides corresponding to the splice donor site nucleotides is replaced by another nucleotide and wherein the nucleotides of the splice acceptor sites are not altered.... Agent: Moimed Spa

20130028869 - Feed supplement comprising oligosaccharides and medium chain fatty acids: The present invention relates to a feed supplement and a feed containing this feed supplement, comprising 1) a homotrimer, heterotrimer, homotetramer and/or heterotetramer of a carbohydrate component selected from the group consisting of a pentose saccharide, a hexose saccharide, glucuronic and galacturonic acid, and 2) a medium-chain fatty acid (MCFA),... Agent: Nutrition Sciences Nv/sa

20130028877 - Lactobacillus johnsonii la1 ncc533 (cncm i-1225) and immune disorders: The present invention generally relates to the field of preventing and/or treating inflammatory and infectious disorders, in particular by boosting the endogenous antimicrobial defences. One embodiment of the present invention is the use of non-replicating L. johnsonii La1 NCC533 (deposit number CNCM I-1225) for use in the treatment or prevention... Agent: Nestec S.a.

20130028879 - Method for controlling particular insect pests by applying anthranilamide compounds: e

20130028878 - S-adenosyl-l-methionine-containing dry yeast composition with excellent storage stability and process for producing same: A dry yeast composition which includes 5-adenosyl-L-methionine and a thickener and has excellent storage stability. A thickener is added to a yeast cell concentrate obtained by culturing yeast which has SAMe-producing ability and collecting the cells, and the resultant mixture is dried. Thus, a dry yeast containing a high concentration... Agent: Mitsubishi Gas Chemical Company, Inc.

20130028872 - Composition and method for differentiation of human embryonic stem cells: Described are methods for inducing differentiation of a human embryonic stem cell or a population of human embryonic stem cells toward a cell or population of cells characteristic of the definitive endoderm, the method comprising incubating the cell or population of cells with a GSK-3 inhibitor. Also described are methods... Agent:

20130028873 - Method for increasing activity in human stem cell: Provided are a method for preparing a highly active human mesenchymal stem cell, which includes forming a spherical cell aggregate by cultivating human mesenchymal stem cells against gravity; a highly active stem cell prepared thereby; a cell therapeutic agent including the stem cell aggregate; and a method for forming a... Agent: Seoul National University Hospital

20130028874 - Methods, pharmaceutical compositions and articles of manufacture for administering therapeutic cells to the animal central nervous system: Methods and compositions for preventing and treating the damaged and/or degenerating CNS experiencing loss or death of CNS cells. Various embodiments of the invention transport a therapeutically effective amount of, inter alia, at least one therapeutic cell to the CNS by intranasal application to the upper-third of the nasal cavity,... Agent:

20130028871 - Placental stem cell populations: The present invention provides placental stem cells and placental stem cell populations, and methods of culturing, proliferating and expanding the same. The invention also provides methods of differentiating the placental stem cells. The invention further provides methods of using the placental stem cells in assays and for transplanting.... Agent:

20130028870 - Pluripotent stem cells and method of stimulating and extracting non-embryonic pluripotent stem cells from mammal blood and using reconstituted pluripotent stem cells to treat diseases including chronic obstructive pulmonary disease: Stimulating tissue resident pluripotent stem cells in a manner that the respective subject (e.g., human) acts as its own sterile bioreactor for in vivo stem cell proliferation thus eliminating the need to isolate, cultivate, maintain, proliferate and release stem cells ex vivo. The stimulation mobilizes excess pluripotent stem cells into... Agent:

20130028880 - Apyrase therapy for bleeding conditions: This invention provides new methods of treating subjects experiencing or at risk of bleeding due to vascular injury, especially to the microvasculature and/or platelet desensitization. Examples of injury usefully treated by apyrase agents are patho-physiological conditions, ischemia reperfusion injury, injury from pharmacologic agents such as anticoagulants, antiplatelet agents, antithrombotics, thrombolytics,... Agent: Apt Therapeutics, Inc.

20130028881 - Diagnosis and treatment of multiple sulfatase deficiency and other sulfatase deficiencies: This invention relates to methods and compositions for the diagnosis and treatment of Multiple Sulfatase Deficiency (MSD) as well as other sulfatase deficiencies. More specifically, the invention relates to isolated molecules that modulate post-translational modifications on sulfatases. Such modifications are essential for proper sulfatase function.... Agent: Shire Human Genetic Therapies, Inc.

20130028882 - Antiviral compositions and methods of their use: Novel compositions comprising carrageenans well as methods of their use are disclosed. Certain novel compositions are useful, inter alia, in the prevention, inhibition and/or treatment of dengue fever (DF), dengue fever shock syndrome (DSS) or dengue hemorrhagic fever (DHF). Other compositions are useful, inter alia, for treatment of viral infections.... Agent: Humanitas Technology, LLC

20130028883 - Treatment of ischemic episodes and cerebroprotection through misoprostol: The present invention provides compositions and methods for treating an ischemic episode using misoprostol alone or in combination with anti-thrombotic agents.... Agent: The Board Of Trustees Of The Leland Stanford Junior University

20130028884 - Composition and method for treatment of bruising: There is provided a skin treatment composition for oral or topical administration and a method for skin treatment. The composition comprises a chelating agent and at least one protease. The composition helps to remove hemosiderin that causes staining of skin on a bruised area and reduces inflammation and pain.... Agent: Scarguard Labs, LLC.

20130028885 - Methods to predict and prevent resistance to taxoid compounds: Embodiments of the invention are directed to methods for predicting the resistance of cancer to members of the taxoid family by measuring the levels of prohibitin. Methods for treating cancer and taxoid family member resistant cancers using inhibitors of prohibitin, as well as therapeutic complexes that target prohibitin are also... Agent: Children's Medical Center Corporation

20130028886 - Protein tyrosine phosphatase, non-receptor type 11 (ptpn11) and tumor initiating cells: The present invention relates to a method for treating cancer in a subject by killing tumor initiating cells, inducing differentiation of tumor initiating cells into differentiated cells or blocking the conversion of differentiated tumor cells into tumor initiating cells, which method comprises the step of administering to said subject a... Agent:

20130028887 - Phenylacetic acid compound: e

20130028889 - Dosing regimens for treating and preventing ocular disorders using c-raf antisense: The present invention provides methods and dosing regimens for treating and preventing ocular disorders using c-raf antisense oligonucleotides, alone or in combination with other agents.... Agent: Ico Therapeutics Inc.

20130028888 - Humanized anti-cd22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease: The present invention provides chimeric and humanized versions of anti-CD22 mouse monoclonal antibody, HB22.7. The anti-CD22 antibodies of the invention comprise four human or humanized framework regions of the immunoglobulin heavy chain variable region (“VH”) and four human or humanized framework regions of the immunoglobulin light chain variable region (“VK”).... Agent:

20130028890 - Method for detecting regulatory t cells using expression of folate receptor 4 as indicator, method for treating diseases using the detection method, pharmaceutical composition for immunostimulation, and method for treating diseases using the composition: In the method of the present invention, Treg cells are detected from test cells containing (i) regulatory T cells and (ii) at least one type of cell selected from the group consisting of naive T cells and activated T cells, wherein expressions of folate receptor 4 on the surfaces of... Agent: Kyoto University

20130028892 - Method of treating osteoarthritis with an antibody to ngf: Methods are disclosed for treating osteoarthritis in a human subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-human NGF antibody, or antigen-binding fragment thereof, wherein at least one symptom associated with osteoarthritis is prevented, ameliorated or improved.... Agent: Regeneron Pharmaceuticals, Inc.

20130028891 - Unconjugated anti-tfr antibodies and compositions thereof for the treatment of cancer: Disclosed herein are methods and compositions for treating cancer. In particular, the in vivo efficacy of unconjugated anti-TfR antibodies, such as ch128.1, are disclosed herein.... Agent: The Regents Of The University Of California

20130028894 - Methods of treating il-tif associated inflammatory or immune diseases using antibodies against soluble zcytor 11 cytokine receptors: Novel polypeptide combinations, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed for soluble zcytor11 receptors that may be used as novel cytokine antagonists, and within methods for detecting ligands that stimulate the proliferation and/or development of hematopoietic, lymphoid and myeloid cells in vitro and in vivo. Ligand-binding... Agent: Zymogenetics, Inc.

20130028893 - Therapeutic antibodies with reduced side effect: A therapeutic protein, such as a therapeutic antibody, that is modified with a compound that inhibits binding of the protein to its therapeutic target, thereby reducing side effects caused by the protein.... Agent:

20130028898 - Combination therapy with cd4 lymphocyte depletion and mtor inhibitors: The invention provides methods for treating a malignant neoplastic cell proliferative disorder or disease, comprising administering to a subject in need thereof an effective amount of an mTOR inhibitor and an effective amount of a CD4 lymphocyte depleting agent. Such methods find utility in the treatment of certain subsets of... Agent: Cedars-sinai Medical Center

20130028895 - Exosome inhibiting agents and uses thereof: The invention relates to methods and compositions for reducing exosome mediated tumor resistance against a therapeutic binding molecule and for increasing the efficacy of a therapeutic binding molecule suitable in the treatment of a disease. The methods include administering an effective amount of at least one agent inhibiting exosome formation... Agent:

20130028897 - Methods for reducing the level of alloantibodies in a subject: The invention provides a method for reducing the level of alloantibodies in a sensitized patient awaiting kidney transplantation by administering Belimumab or an antibody that specifically binds a B-lymphocyte stimulator protein (BLyS). The invention further provides a method for reducing the risk of an allograft rejection in an allograft recipient... Agent:

20130028896 - Semaphorin 3c (sema3c) inhibitor therapeutics, methods, and uses: Provided are methods, uses and pharmaceutical compositions for treatment of prostate cancer with a SEMA3C inhibitor in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The prostate cancer may be an androgen receptor (AR) positive... Agent: The University Of British Columbia

20130028899 - Treatment of cancer by inhibiting activity or expression of late sv-40 factor: Inhibitors of Late SV-40 Factor (LSF) are used to treat cancers such as hepatocellular carcinoma (HCC). In particular, small molecule chemical LSF inhibitors are employed. In addition, the activity and/or pattern of expression of LSF may is used to diagnose cancer, to characterize the cancer (e.g. stage, grade, prognosis, etc.)... Agent:

20130028900 - Methods and compositions for the generation and use of conformation-specific antibodies: The present invention features methods and compositions for the generation and use of conformation-specific anti-bodies or fragments thereof.... Agent: Beth Israel Deaconess Medical Center Inc.

20130028901 - Novel receptor trem (triggering receptor expressed on myeloid cells) and uses thereof: Novel activating receptors of the Ig super-family expressed on human myeloid cells, called TREM(s) (triggering receptor expressed on myeloid cells) are provided. Specifically, two (2) members of TREMs, TREM-1 and TREM-2 are disclosed. TREM-1 is a transmembrane glycoprotein expressed selectively on blood neutrophils and a subset of monocytes but not... Agent: Novo Nordisk A/s

20130028902 - Osteocalcin as a treatment for male reproductive disorders: Methods and compositions for treating, preventing, or diagnosing disorders related to reproduction in male mammals, preferably humans, are provided. The methods generally involve modulation of the OST-PTP signaling pathway or the PTP-IB signaling pathway involving gamma-carboxylase and osteocalcin. Disorders amenable to treatment by the methods include, but are not limited... Agent: The Trustees Of Columbia University In The City Of New York

20130028904 - Human antibodies that bind mesothelin, and uses thereof: The present disclosure provides isolated monoclonal antibodies that specifically bind to mesothelin with high affinity, particularly human monoclonal antibodies. Preferably, the antibodies bind human mesothelin. In certain embodiments, the antibodies are capable of internalizing into mesothelin-expressing cells or are capable of mediating antigen dependent cellular cytotoxicity. The invention further provides... Agent: Bristol-myers Squibb Company

20130028905 - Human antibodies that bind mesothelin, and uses thereof: The present disclosure provides isolated monoclonal antibodies that specifically bind to mesothelin with high affinity, particularly human monoclonal antibodies. Preferably, the antibodies bind human mesothelin. In certain embodiments, the antibodies are capable of internalizing into mesothelin-expressing cells or are capable of mediating antigen dependent cellular cytotoxicity. The invention further provides... Agent: Bristol-myers Squibb Company

20130028906 - Human antibodies that bind mesothelin, and uses thereof: The present disclosure provides isolated monoclonal antibodies that specifically bind to mesothelin with high affinity, particularly human monoclonal antibodies. Preferably, the antibodies bind human mesothelin. In certain embodiments, the antibodies are capable of internalizing into mesothelin-expressing cells or are capable of mediating antigen dependent cellular cytotoxicity. The invention further provides... Agent: Bristol-myers Squibb Company

20130028903 - Purified antibody composition: The invention provides a method for producing a host cell protein-(HCP) reduced antibody preparation from a mixture comprising an antibody and at least one HCP, comprising an ion exchange separation step wherein the mixture is subjected to a first ion exchange material, such that the HCP-reduced antibody preparation is obtained.... Agent:

20130028907 - Stable antibody containing compositions: The invention relates to stable and low viscous (<50 cP) protein containing compositions, in particular, but not exclusively stable antibody containing compositions and to the use of said stable proteins in therapy, in particular for the subcutaneous delivery of said stable protein.... Agent: Novo Nordisk A/s

20130028908 - Monoclonal antibodies directed against hiv p17 protein: Anti-HIV p17 monoclonal antibodies are described, which are capable of neutralizing the binding between multiple HIV-1 p17 protein variants and the p17R receptor are provided. Pharmaceutical compositions and methods of treatment utilizing these antibodies are also provided.... Agent: Medestea Research & Production S.p.a.

20130028909 - Depletion of teratoma-forming pluripotent stem cells: Compositions and methods are provided for depletion of pluripotent cells. In one embodiment of the invention, methods are provided for depletion of pluripotent cells from a mixed population of differentiated cells and stem cells, to provide a population of cells substantially free of pluripotent stem cells. Monoclonal antibodies useful in... Agent: The Board Of Trustees Of The Leland Stanford Junior University

20130028910 - Hmg1 antibody for treating inflammatory conditions: There is disclosed a pharmaceutical composition and method for treating sepsis, including septic shock and ARDS (acute respiratory distress syndrome), comprising administering an effective amount of a HMG1 antagonist. There is further disclosed a diagnostic method for monitoring the severity or potential lethality of sepsis or septic shock, comprising measuring... Agent: The Feinstein Institute For Medical Research

20130028912 - Tweak/fn14 system regulates skeletal muscle atrophy and regeneration: The invention provides methods for preventing loss and augmenting regeneration of skeletal muscle by decreasing the activity of the TWEAK/Fn14 system.... Agent: University Of Louisville Research Foundation, Inc.

20130028911 - Vascular endothelial cell growth factor antagonists: The present invention provides human vascular endothelial cell growth factor (hVEGF) antagonists, including monoclonal antibodies, hVEGF receptors, and hVEGF variants that are useful for the treatment of age-related macular degeneration, and other diseases and disorders characterized by undesirable or excessive neovascularization.... Agent: Genentech, Inc.

20130028913 - Antibody that binds to h-1 parvovirus: Described is an antibody or an antigen binding fragment thereof specifically binding to a full or empty H-1 parvovirus capsid. Such an antibody is useful for various diagnostic and therapeutic methods, e.g., for the detection/therapy of an H-1 parvovirus infection during pregnancy since parvovirus affects about 1 in 400 pregnancies... Agent:

20130028916 - Antagonist anti-il-7 receptor antibodies and methods: The present invention provides antagonizing antibodies that bind to interleukin-7 receptor (IL-7R). The invention further provides a method of obtaining such antibodies and antibody-encoding nucleic acids. The invention further relates to therapeutic methods for use of these antibodies and antigen-binding portions thereof for the treatment and/or prevention of type 2... Agent: Rinat Neuroscience Corp.

20130028914 - Antibodies that bind tau oligomers: Embodiments of the invention are directed to compositions and methods related to Tau oligomers and Tau oligomer specific antibodies.... Agent: The Board Of Regents Of The University Of Texas System

20130028915 - Dendritic cell (dc)-vaccine therapy for pancreatic cancer: Compositions and methods for eliciting therapeutic immunity and improving clinical outcomes in patients with pancreatic cancer are disclosed herein. The present invention describes a dendritic cell (DC)-vaccine comprising DCs pulsed with peptides derived from pancreatic cancer antigens for the therapy against pancreatic cancer. The vaccine described herein is safe, and... Agent: Baylor Research Institute

20130028917 - Pyrrolobenzodiazepines and conjugates thereof: Conjugates and compounds for making conjugates which are PBD molecules linked via the N10 position are disclosed, along with the use of the conjugates for treating proliferative diseases, including cancer.... Agent: Spirogen Developments S&#xc0 Rl

20130028918 - Insulin conjugate using an immunoglobulin fragment: The present invention relates to an insulin conjugate having improved in vivo duration and stability, which is prepared by covalently linking insulin with an immunoglobulin Fc region via a non-peptidyl polymer, a long-acting formulation comprising the same, and a preparation method thereof. The insulin conjugate of the present invention maintains... Agent: Hanmi Science Co., Ltd.

20130028919 - Targeted pyrrolobenzodiazapine conjugates: Provided are Conjugate comprising PBDs conjugated to a targeting agent and methods of using such PBDs.... Agent: Seattle Genetics, Inc.

20130028920 - Stabilized antibody preparations and uses thereof: The present invention is directed to stabilized intact antibody formulations, related methods and uses thereof. In particular, the invention relates to a method of stabilizing an intact antibody in a liquid carrier.... Agent: Universite De Geneve

20130028921 - Composition comprising coumestrol or a bean extract containing coumestrol: The present invention relates to a composition which comprises as an active ingredient coumestrol or a bean extract containing coumestrol, whereby adipocyte differentiation is inhibited, the immune system of the body is improved, toxic substances are purged, and neurodegenerative disorders are prevented or improved.... Agent: Amorepacific Corporation

20130028922 - Citrulline peptides derived from fibrin and recognized by rheumatoid arthritis specific autoantibodies, and the use thereof: The invention relates to novel citrulline peptides derived from fibrin α and β chains which are recognizable by specific citrulline antiprotein autoantibodies (AAPC) of a rheumatoid arthritis (PR) and to the use thereof for detecting the presence of said specific PR AAPC in a biological sample.... Agent: Biomerieux

20130028923 - Kdr peptides and vaccines comprising the same: The present invention provides nonapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:2, 3, 5, 8, 11, or 12; nonapeptides or decapeptides selected from peptides comprising the amino acid sequence of SEQ ID NO:29, 30, 33, 34, 40, or 46; and peptides with cytotoxic T cell... Agent: Oncotherapy Science, Inc.

20130028924 - Constructs for enhancing immune responses: Chimeric protein constructs including a herpesvirus glycoprotein D (gD) and a heterologous polypeptide that interact with herpes virus entry mediator (HVEM) and enhance and enhance an immune response against the heterologous polypeptide and methods for their use are provided.... Agent: The Wistar Institute Of Anatomy And Biology

20130028925 - Herpes simplex virus combined subunit vaccines and methods of use thereof: This invention provides immunogenic compositions comprising two or three recombinant Herpes Simplex Virus (HSV) proteins selected from a gD protein, a gC protein and a gE protein; and methods of impeding immune evasion by HSV, inducing an anti-HSV immune response, and treating, suppressing, inhibiting, and/or reducing an incidence of an... Agent:

20130028926 - Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells: The invention is directed to bioconjugate vaccines comprising N-glycosylated proteins. Further, the present invention is directed to a recombinant prokaryotic biosynthetic system comprising nucleic acids encoding an epimerase that synthesizes an oligo- or polysaccharide having N-acetylgalactosamine at the reducing terminus. The invention is further directed to N-glycosylated proteins containing an... Agent: Glycovaxyn Ag

20130028927 - Method of diagnosing and treating melioidosis: Non-invasive methods are provided herein for the diagnosis of melioidosis with specific antibodies capable of detecting molecules associated with melioidosis in a biological fluid, such as urine or serum. These molecules can be identified using proteomic methods, including but not limited to antibody based methods, such as an enzyme-linked immunosorbant... Agent:

20130028928 - Methods to increase antigenicity of membrane bound polypeptides produced in plants: Increased antigenicity of a membrane bound polypeptide produced from plants is provided by reducing fat content of the plant, plant part, or plant tissue producing the polypeptide. Methods and means of producing such plant material are provided. Methods to produce a protective immune response in animals are provided by administering... Agent: Applied Biotechnology Institute

20130028929 - Functional beverage composition comprising chlorella and deep sea water: The present invention relates to a functional beverage composition comprising chlorella and deep sea water. The composition comprises 0.1-5 wt % of chlorella powder, 90-99 wt % of deep sea water, 0.001-0.5 wt % of a grapefruit extract, 0.01-5 wt % of honey, 0.01-5 wt of polydextrose, 0.001-1 wt %... Agent: Ecophyco Tech Co., Ltd.

20130028930 - Albumin derivatives and variants: The application discloses albumin derivatives comprising or consisting of domain III and at least one further domain wherein the derivative or variant is not a naturally occurring albumin derivative or variant. The derivatives may be used in conjugates and fusion polypeptides.... Agent: Novozymes Biopharma Dk A/s

20130028932 - Compositions comprising polyglutamic acid nanoparticles and polypeptides such as cd40 agonists: The present invention provides pharmaceutical compositions comprising an immunostimulatory polypeptide and polyglutamic acid (PGA) nanoparticles, formulated in a pharmaceutically acceptable diluent, carrier or excipient. Such compositions have utility in stimulating the immune system in subjects, with the components capable of interacting synergistically. The invention further provides uses of the compositions... Agent: Alligator Bioscience Ab

20130028931 - Novel prrs virus inducing type i interferon in susceptible cells: The present invention relates to the field of attenuated live viruses useful as vaccine or medicament for preventing or treating Porcine Reproductive and Respiratory Syndrome (PRRS) in swine, and is based on the surprising finding of a PRRS virus which is able to induce the interferon type I response of... Agent: Boehringer Ingelheim Vetmedica Gmbh

20130028933 - Methods for stabilizing influenza antigen enveloped virus-based virus-like particle solutions: Methods of stabilizing solutions with enveloped vims-based virus-like particles containing an influenza antigen and such stabilized solutions are described.... Agent: Ligocyte Pharmaceuticals, Inc.

20130028934 - Stabilizer and vaccine composition comprising one or more live attenuated flaviviruses: The present invention relates to stabilizers for compositions, including immunogenic compositions, such as vaccine compositions, comprising one or more live attenuated flaviviruses, to bulk vaccine compositions stabilized with these stabilizers, particularly dry vaccine compositions prepared from these bulk vaccine compositions, and to methods for stabilizing one or more live attenuated... Agent: Sanofi Pasteur

20130028935 - Composition containing hcmv particles: The present invention is related to a composition comprising an agent selected from the group comprising HCMV virions, HCMV dense bodies and HCMV NIEP, whereby the composition is capable of elucidating an immune response while the virions, the NIEP and/or the dense bodies being non-fusiogenic.... Agent: Vakzine Projekt Management Gmbh

20130028936 - Tlr 4 and 9 receptors agonists for preventing septic complications of post-traumatic immunodepression in patients hospitalized for severe traumatic injuries: The present invention concerns a pharmaceutical composition comprising at least one agonist of at least one Toll Like receptor (TLR) chosen from TLR 4 and 9, for use in the prophylactic treatment of septic complications of post-traumatic systemic immunodepression in a patient who has suffered one or more severe traumatic... Agent: Chu Nantes

20130028942 - Aerosolized nitrite and nitric oxide-donating compounds and uses thereof: Disclosed herein are formulations of nitrite, nitrite salt, or nitrite- or nitric oxide-producing compounds suitable for aerosolization and use of such formulations for aerosol administration of nitrite, nitrite salt, or nitrite- or nitric oxide-donating compounds for the treatment of pulmonary arterial hypertension, intra-nasal or pulmonary bacterial infections, or to treat... Agent: Aires Pharmaceuticals, Inc.

20130028940 - Caspofungin formulations: The present invention relates to pharmaceutical compositions comprising a pharmaceutically acceptable salt of caspofungin as active ingredient being useful for the prevention and/or treatment of fungal infections. Said compositions additionally comprise specific bulking agents and small amounts or no amounts of an additional pH modifier and may be in a... Agent: Sandoz Ag

20130028939 - Chimeric human beta defensins: The invention relates to a nucleic acid molecule selected from the group comprising a) a nucleic acid molecule having one of the nucleotide sequences presented in SEQ ID:NO 4 to SEQ ID:NO 8, b) a nucleic acid molecule that codes for a peptide having one of the amino acid sequences... Agent: Christian-albrechts-universitat Zu Kiel

20130028937 - Co-crystals of venlafaxine and celecoxib: The present invention relates to a co-crystal of celecoxib and venlafaxine, processes for preparation of the same and its use as medicaments or in pharmaceutical formulations, more particularly for the treatment of pain, including chronic pain; or of depression in patients which suffer from chronic pain and/or chronic inflammation or... Agent: Laboratorios Del Dr. Esteve, S.a.

20130028943 - Melatonin tablet and methods of preparation and use: The present invention provides a pharmaceutical composition for sublingual or buccal administration of actives with low to poor aqueous solubility, e.g. the indole hormone melatonin, which contains a solution of the active in a pharmaceutically acceptable solvent adsorbed or absorbed onto particles of a pharmaceutically acceptable carrier and methods of... Agent:

20130028945 - Novel composition for treatment of essential thrombocythemia: The present invention relates to a novel pharmaceutical composition free of gastric coating comprising anagrelide hydrochloride in combination with a non-pH dependent polymer and a pharmaceutically acceptable watersoluble acid and its use for the treatment of essential thrombocythemia.... Agent: Aop Orphan Pharmaceuticals Ag

20130028944 - Novel methods for targeting cancer stem cells: The invention provides naphthofuran compounds, polymorphs of naphthofuran compounds, naphthofuran compounds in particle form, purified compositions that contain one or more naphthofuran compounds, purified compositions that contain one or more naphthofuran compounds in particle form, methods of producing these naphthofuran compounds, polymorphs, purified compositions and/or particle forms, and methods of... Agent: Boston Biomedical, Inc.

20130028946 - Relating to antiviral compositions: The present invention provides a composition and an antiviral drug preparation, each comprising at least one water-insoluble antiviral drug and at least one water-soluble carrier material, wherein the water-insoluble antiviral drug is dispersed through the water-soluble carrier material in nano-disperse form. The present invention further provides processes for preparing the... Agent: Iota Nanosolutions Limited

20130028938 - Solid pharmaceutical dosage form: The present invention relates to a solid pharmaceutical dosage form comprising ticagrelor as pharmaceutically active ingredient, to certain particles of ticagrelor and to processes of preparing the same.... Agent: Ratiopharm Gmbh

20130028941 - Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses: Disclosed are methods for generating humoral and cytotoxic T lymphocyte (CTL) immune responses in a subject and related compositions.... Agent: Selecta Biosciences, Inc.

20130028948 - Composite particles and method for production thereof: Disclosed are titanium dioxide-containing composite particles which can maintain whiteness of natural titanium dioxide even after calcination step, and can provide titanium dioxide-containing composite particles having excellent weather resistance. In each of the composite particles, at least one oxide layer containing silicon oxide and zirconium oxide is provided as coating... Agent: Sakai Chemical Industry Co., Ltd.

20130028949 - Cosmetic sponge and method for providing a cosmetic sponge: This invention relates to a cosmetic sponge and a method of providing a cosmetic sponge incorporating a non-denatured collagen and other additives for skin care, cleaning, and cosmetic application.... Agent: Diversified Glogal Technologies, LLC

20130028952 - Filler pigments: Filler pigments based on platelet-shaped substrates, which are coated with barium sulfate and at least two metal oxides and/or metal hydroxides are highly suitable as filler pigments especially for cosmetic formulations.... Agent: Merck Patent Gesellschaft Mit Beschrankter Haftung

20130028947 - Pharmaceutical composition for topical application: A topical pharmaceutical composition which has a hydrophilic outer phase, at least one pharmaceutical active ingredient and at least one carrier substance. The carrier substance has at least two lamellar double membrane layers arranged one over another in the manner of a sandwich, wherein between adjacent double membrane layers, aligned... Agent: Kuhs Gmbh

20130028951 - Polymer-liposome nanocomposite composition for percutaneous absorption, and method for preparing same: Provided are a polymer/liposome nanocomposite composition comprising lipids and poly(amino acids), and a method for preparing same. The polymer/liposome nanocomposite composition has excellent formation stability with respect to surfactants and salts, and can be used in various ways as a drug delivery system in the fields of medicine and cosmetics.... Agent: Amorepacific Corporation

20130028950 - Vesicle-containing composition: wherein the (A) silicone-based surfactant forms vesicles; the (B) anionic surfactant(s) attaches to a surface of the vesicles; and the (C) polar oil and/or silicone oil is present within a bilayer membrane of the vesicles.... Agent: Shiseido Company, Ltd.

20130028953 - Transdermal delivery systems for sufentanil: Transdermal delivery systems for administering sufentanil through the skin are provided. The systems contain a sufficient amount of sufentanil to induce and maintain a constant state of analgesia when applied to a subject. The systems are characterized as having one or more features including a high degree of dosage form... Agent:

20130028954 - Hemostatic dressing: The present invention relates to a hemostatic dressing which comprises a plurality of layers that contain resorbable materials and/or coagulation proteins. In particular, the invention includes dressings in which a layer of thrombin is sandwiched between a first and second layer of fibrinogen and wherein the layer of thrombin is... Agent: American National Red Cross

20130028958 - Beta-carbolines for use in the treatment of hearing loss and vertigo: The present invention is directed at β-carbolines, preferred 9-alkyl-β-carbolines (9-alkyl-β-BC), their manufacture as well as their use in prophylaxis and treatment of hearing damages, tinnitus, acute acoustic trauma, vertigo and vestibular disorder as well as pharmaceutical compositions containing theses β-carbolines.... Agent:

20130028966 - Broad spectrum antiviral and antiparasitic agents: The invention provides compounds represented by the formulae: (I) and (II) where the compounds are useful in treating, for example, viral and/or parasitic infections. Also provided are pharmaceutical compositions comprising the compounds and methods of treatment using the compounds.... Agent: The Regents Of The University Of California

20130028963 - Forming an artificial cell with controlled membrane composition, asymmetry, and contents: The present invention provides a vesicle having a unilamellar bilayer including a lipid and a second bilayer component selected from a membrane protein or a functionalized lipid. The vesicle also includes a component encapsulated by the unilamellar bilayer, wherein the encapsulated component includes a protein, a peptide, an enzyme, an... Agent: The Regents Of The University Of California

20130028960 - Lipid-based compositions of antiinfectives for treating pulmonary infections and methods of use thereof: A system for treating or providing prophylaxus against a pulmonary infection is disclosed comprising: a) a pharmaceutical formulation comprising a mixture of free antiinfective and antiinfective encapsulated in a lipid-based composition, and b) an inhalation delivery device. A method for providing prophylaxis against a pulmonary infection in a patient and... Agent: Insmed Incorporated

20130028959 - Liposomes for preventing the spread of hiv: Formulations for preventing the sexual transmission of the HIV virus are provided. In one embodiment, the formulations contain un-conjugated liposomes whose physicochemical properties allow binding to the HIV virus. The liposomes are made up of natural or synthetic lipids, alone or in combination. Preferably, the liposomes are made entirely of... Agent: Children's Medical Center Corporation

20130028956 - Method for preventing or treating memory impairment and pharmaceutical compositions useful therefore: Moreover, the present invention relates to a method of inducing memory loss in an individual comprising administering to said individual an effective amount of one or more compounds having the functionality of miR-34, in particular of miR-34c or any precursor thereof. In addition, a method for diagnosing or predicting memory... Agent:

20130028964 - Novel rnai therapeutic for treatment of hepatitis c infection: Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that target human cyclophilin A (CyPA) to inhibit Hepatitis C (HCV) infection. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding to a specific region of... Agent: Florida State University Research Foundation

20130028965 - Novel rnai therapeutic for treatment of hepatitis c infection: Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that specifically target human cyclophilin A (CyPA) to effectively inhibit Hepatitis C (HCV) infection in a cell. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding... Agent: Florida State University Research Foundation

20130028957 - Pharmaceutical composition for treating cancer: The present invention provides a pharmaceutical composition for treating cancer, comprising at least one selected from deoxyribonucleic acids (DNA) for encoding small interfering RNA (siRNA) which complementarily binds to the base sequence of the transcript (mRNA transcript) of the FLJ25416 gene, represented by sequence number 3, sequence number 5, and... Agent:

20130028961 - Pharmaceutical compositions, comprising a combination of select carriers, vitamins, tannins and flavonoids as antigen-specific immuno-modulators: The present invention provides adjuvant compositions that are capable of modulating the immune response in a subject, including enhancing or suppressing the immune response. These adjuvant compositions may also be used to enhance or suppress the immunogenicity of antigens by enhancing or suppressing antigen-presentation activity, enhancing or suppressing innate immune... Agent: Epitogenesis, Inc.

20130028955 - Sustained release oral matrix and methods of making thereof: A solid dosage form suitable for forming a tablet for the containment and delivery of medicament is provided wherein the matrix forming material is a pressure sensitive adhesive, present in the amount from about 0.1 to about 40 weight %, based on the total weight of the composition. The dosage... Agent:

20130028967 - Therapeutic agent for pulmonary fibrosis: Disclosed are: a substance transfer carrier to an extracellular matrix-producing cell in the lung, which comprises a retinoid; a therapeutic agent for pulmonary fibrosis, which utilized the carrier; and a preparation kit of the therapeutic agent.... Agent: Nitto Denko Corporation

20130028962 - Triggered cargo release from nanoparticle stabilized liposomes: Control of the fusion activity of liposomes by adsorbing biocompatible nanoparticles to the outer surface of phospholipid liposomes is disclosed. The biocompatible nanoparticles effectively prevent liposomes from fusing with one another. Release of cargo from the liposome is accomplished via trigger mechanisms that include pH triggers, pore forming toxing triggers... Agent: The Regents Of The University Of California

20130028968 - Compositions and methods to relieve chronic diseases symptoms: Compounds having unique properties are prepared from the herbal compositions described herein and comprise extracts derived from plants and fungi of the genera Panax, Ganoderma, and Saussurea. The compositions are useful in preventing, treating, relieving, and improving the quality-of-life of patients suffering from chronic diseases, such as liver diseases, cancer,... Agent:

20130028969 - Method for stable and controlled delivery of (-)-hydroxycitric acid: The present invention provides stable encapsulated (−)-hydroxycitric acid (“HCA”)-containing compositions and methods of making the same. A method is provided by which the hygroscopic salts of HCA in their relatively pure and active forms, including especially the potassium salt, but also including the sodium salt, are rendered non-hygroscopic and stable... Agent: Glykon Technologies Group, LLC

20130028970 - Tamper-resistant tablet providing immediate drug release: e

20130028973 - Particulate comprising a calcium-containing compound and a sugar alcohol: The present invention relates to a particulate material and a solid dosage form notably tablets comprising a regularly shaped calcium-containing compound such as a calcium salt as a therapeutically and/or prophylactically active substance and a pharmaceutically acceptable sugar alcohol such as, e.g., sorbitol and/or isomalt that has a micro structure... Agent: Nycomed Pharma As

20130028971 - Pharmaceutical compositions comprising rifaximin, processes for their preparation and their use in the treatment of vaginal infections: The invention relates generally to pharmaceutical compositions comprising rifaximin effective at treating vaginal infections, and in particular bacterial vaginosis. The pharmaceutical compositions comprising rifaximin granules are characterized in that they release rifaximin in the vagina in a controlled way. The present invention also relates to processes for preparation of the... Agent: Alfa Wassermann S.p.a.

20130028974 - Pharmaceutical formulation in the form of bilayered tablets comprising hmg-coa reductase inhibitor and irbesartan: Provided is a pharmaceutical formulation in the form of a bilayered tablet consisting of a first layer containing irbesartan or a pharmaceutically acceptable salt thereof and a second layer containing an HMG-CoA reductase inhibitor and a basic additive, which can improve the dissolution rate and stability of irbesartan and an... Agent: Hanmi Science Co., Ltd

20130028972 - Tamper-resistant tablet providing immediate drug release: o

20130028975 - Hemostatic sponge: The present invention provides a hemostatic porous composite sponge comprising i) a matrix of a biomaterial and ii) one hydrophilic polymeric component comprising reactive groups wherein i) and ii) are associated with each other so that the reactivity of the polymeric component is retained, wherein associated means that—said polymeric component... Agent: Baxter International, Inc.

20130028977 - Pharmaceutical powder composition for inhalation: The present invention relates to a pharmaceutical powder composition for inhalation comprising an active ingredient and a pharmaceutically acceptable carrier, process for preparing such composition, and its use for the treatment of respiratory disorder in a subject.... Agent: Glenmark Pharmaceuticals Limited

20130028976 - Spray-dried crystalline active ingredient: A process for preparing a spray-dried product for improving the rate of dissolution of the active ingredient. The process includes mixing a crystalline active ingredient, which has a dissolution rate in unstirred water at 25° C. of greater than 15 minutes at a concentration of 14 ppm of the active... Agent:

20130028978 - Compositions and methods for wound treatment: Provided herein are compositions, methods, systems, and kits for wound healing. As shown herein, CCN2/CTGF stimulated mesenchymal progenitor cells can form αSMA− fibroblasts. Further, TGFβ was shown to stimulate further differentiation of αSMA− fibroblasts to myofibroblasts associated with fibrosis. One aspect provides a composition including CCN2/CTGF and a TGFβ inhibitor,... Agent: The Trustees Of Columbia University In The City Of New York

20130028979 - Stretch marks cream: A topical composition and method for making, including the steps of placing cow's tallow in water and heating; allowing the heating tallow to float to the top of the water; filtering the floating portion of the tallow from the rest of the water; placing the floating portion of tallow obtained... Agent:

20130028980 - Cell-polymer fiber compositions and uses thereof: The present invention relates to compositions comprising complexes of human cells and polymer fibers and methods of their use for therapeutic purposes. Methods of making such compositions are also provided. The present invention encompasses compositions comprising poly-β-1→4-N-acetylglucosamine polymers and stored platelets and their use for promoting wound healing and achieving... Agent: Marine Polymer Technologies, Inc.

20130028981 - Methods for tissue decellularization: A method for producing sterile, decellurized bioprosthetic tissue comprising: (a) contacting a human tissue with a hypotonic solution to produce a lysed tissue, (b) contacting the lysed tissue with a first surfactant to produce a surfactant-treated tissue, (c) contacting the surfactant-treated tissue with a nuclease enzyme solution to produce an... Agent: Decell Technologies Inc.

20130028982 - Ameliorating or therapeutic agent for chronic prostatitis, interstitial cystitis and/or urination disorders: The purpose of the present invention is to provide a medicinal agent which is useful for amelioration or treatment of chronic prostatitis, interstitial cystitis and/or urination disorders. The present invention relates to a novel medical use of an extract from inflamed tissues inoculated with vaccinia virus, and more particularly, it... Agent: Nippon Zoki Pharmaceutical Co., Ltd.

20130028983 - Indicator for oxygen generation: There is provided on-demand, oxygen generating topical compositions having a built-in indicator specifically to indicate a color change upon the complete mixing of the oxygen precursor and catalyst. The first part of the composition contains a carrier and manganese dioxide (MnO2) nanoparticles. The second part of the composition comprises the... Agent:

20130028984 - Natural tissue scaffolds as tissue fillers: Tissue fillers derived from decellularized tissues are provided. The tissue fillers can include acellular tissue matrices that have reduced inflammatory responses when implanted in a body. Also provided are methods of making and therapeutic uses for the tissue fillers.... Agent: Lifecell Corporation

20130028985 - Composition and method for treating migraines: Disclosed are compositions for treating or preventing migraine headaches and related headaches.... Agent:

20130028986 - Pharmaceutical compositions: A composition comprising a pharmaceutically acceptable group (2, 4, 12, 13 or 14) metal compound for the treatment of a dermatological condition involving an abnormal decrease in the cell-to-cell adhesion between epithelial cells in the epidermal barrier.... Agent: Sabarep Limited

20130028988 - Composition for obesity treatment: This invention relates to a composition of a unique combination of three novel dietary supplements for use in a weight loss program. The composition includes a mood enhancer, an insulin sparing agent, and a peripheral energy blocker. Also provided is a method of treatment in a weight loss program.... Agent:

20130028987 - Method of treating psoriasis: A method treating psoriasis and more specifically toward a protocol that involves the use of a specialized curcumin gel composition, the use of topical steroid cream, the avoidance of contact with allergens, and lactose-free diet and treatment of bacterial superinfection with antibiotics and bleach/chlorox baths.... Agent:

20130028989 - Materials and method for inhibiting replication protein a and uses thereof: Targeting uncontrolled cell proliferation and resistance to DNA damaging chemotherapeutics with at least one reagent has significant potential in cancer treatment. Replication Protein A, the eukaryotic single-strand (ss) DNA binding protein, is essential for genomic maintenance and stability via roles in both DNA replication and repair. Reported herein are small... Agent: Indiana University Research And Technology Corporation

20130028990 - Method of using solid-layered bleach compositions: The present invention provides a method of using a solid-layered composition having at least two parts. The first past comprises a) calcium hypochlorite, magnesium hypochlorite and mixtures thereof, b) a builder, c) a water-soluble polymer, d) an acid, and e) wherein the first part does not contain sodium hypochlorite, lithium... Agent: The Clorox Company

20130028993 - Composition and manufacturing processes of a toxicity free botanical drug for curative treatment of chronic diseases: This invention discloses composition and manufacturing processes of a toxicity free botanical drug formulation for curative treatment of chronic diseases. It is manufactured from plants Crinum asiaticum and Crocus sativus. This drug was administered to human volunteers by oral and intranasal routes in effective amount for an effective time period.... Agent: Ashok Kumar

20130028991 - Dietary supplement for use in a weight loss program: This invention relates to a dietary supplement for use in a weight loss program, which alleviates insulin resistance in the presence of the metabolic syndrome. The dietary supplement includes, in combination, berberine, banaba leaf extract, and inositol. Also provided is a method of treatment in a weight loss program.... Agent:

20130028992 - Herbal-based solution for treating symptoms of nasal conditions: An herbal-based solution includes a first amount of wasabi comprising at least an allyl isothiocyanate component, and a second amount of saline solution. The saline solution and the organic material are combined to substantially dilute the wasabi in the saline solution to produce the herbal-based solution. The herbal-based solution further... Agent:

20130028994 - Pomegranate extract having a high ellagic acid content, and use of the pomegranate extract: A pomegranate pulp extract is disclosed. The pomegranate pulp extract is effective in relieving women's menopausal symptoms, anxiety disorders, depression or attention deficit disorders due to the presence of a large amount of ellagic acid. Further disclosed is a method for further improving the relieving effect of the pomegranate extract... Agent: Health-love Co., Ltd.

20130028995 - New synergistic compositions for the treatment of topical viral infections: A synergistic composition comprising plant extracts rich in tannins for the treatment of topical viral infections. The plant extracts contain at least one protease inhibitor and/or at least one viral glycoprotein inhibitor.... Agent: Vitro Bio Sarl

20130028996 - Bioactive botanical cosmetic compositions and processes for their production: The present invention is directed to bioactive botanical cosmetic compositions derived from membrane and cell serum fractions of plant cell juice. The present invention also relates to the methods for preparing these bioactive botanical cosmetic compositions and the uses of these compositions in various cosmetic formulations and as topical skin... Agent: Akzo Nobel Surface Chemistry LLC

20130028997 - Compositions, products, therapeutic uses and procedures for the production and/or crystallization of extracts of encelia canescens lam (coronilla de fraile): The present invention relates to a composition containing extracts of Encelia canescens Lam and to aqueous or ethanolic extracts obtained therefrom, the procedure for the obtainment and crystallization thereof, and the uses thereof for the prevention and treatment of cancer, for example cancer of the pancreas, gastric tract, prostate, breast,... Agent:

20130022538 - Aptamer-mrna conjugates for targeted protein or peptide expression and methods for their use: An aptamer-mRNA conjugate is provided. The aptamer-mRNA conjugate may include an aptamer component that binds a membrane associated protein on a target cell and an mRNA component that is expressed by the target cell.... Agent:

20130022540 - Methods to facilitate transmission of large molecules across the blood-brain, blood-eye, and blood-nerve barriers: A method for delivering a biologic to a human, comprising administering said biologic parenterally into the perispina! space of said human without direct intrathecal injection and positioning said human in a Trendelenburg position.... Agent: TactIPLLC

20130022539 - Ovr115 antibody compositions and methods of use: The invention provides isolated anti-ovarian, pancreatic, lung or breast cancer antigen (Ovr115) antibodies that bind to Ovr115 on a mammalian cell in vivo. The invention also encompasses compositions comprising an anti-Ovr115 antibody and a carrier. These compositions can be provided in an article of manufacture or a kit. Another aspect... Agent: Diadexus, Inc.

20130022541 - Fty720 increases cd74 expression and sensitizes cancer cells to anti-cd74 antibody-mediated cell death: Disclosed herein are methods and compositions comprising fingolimod and anti-CD74 antibodies or fragments thereof. In preferred embodiments, the fingolimod increases the expression of CD74 in target cells and increases the sensitivity of the cells to the cytotoxic effects of the anti-CD74 antibodies. The compositions and methods are of use to... Agent: The Ohio State University

20130022542 - Radiolabelled rotenone derivatives and their use in spect imaging: wherein X is gamma-emitting radionuclide. Also disclosed is a pharmaceutical composition comprising the compound of formula (I), the compound of formula (II), or a mixture thereof, and a physiologically acceptable vehicle and a method of imaging a region in a patient, which includes administering to the patient a diagnostically effective... Agent: Nordion (canada) Inc.

20130022545 - Drug delivery system for treatment of liver cancer based on interventional injection of temperature and ph-sensitive hydrogel: A drug delivery system for the treatment of liver cancer that is based on interventional injection of a temperature and pH-sensitive hydrogel is provided. The drug delivery system is composed of a block copolymer applicable to hepatic arterial catheterization and a therapeutic agent is loaded inside the drug delivery system,... Agent: Research & Business Foundation Sungkyunkwan University

20130022544 - Immunotherapeutic modulation of amyloidogenic disease using non-fibrillogenic, non-amyloidogenic polymerized proteins and peptides: The present invention is directed to polymerized products and compositions useful for the treatment and prevention of amyloid disease in a subject. The invention further relates to isolated antibodies that recognize a common conformational epitope of amyloidogenic proteins or peptides that are useful for the diagnosis, treatment, and prevention of... Agent: New York University

20130022543 - Method for treating and confirming diagnosis of exertional compartment syndrome: Described is a method of treating chronic compartment syndrome in a muscle of a mammal, particularly exertional compartment syndrome. The method includes introducing an effective amount of a nerve-blocking toxin, such as human botulinum toxin into the muscle. In addition to treating chronic or exertional compartment syndrome, a method is... Agent:

20130022546 - Peptides that specifically target amyloid deposits: The present invention provides a novel method of detecting amyloids in a subject. The present invention provides peptides that bind selectively to amyloids and are useful for detecting amyloids and diagnosing and/or monitoring the progression of amyloid mediated conditions.... Agent: University Of Tennessee Research Foundation

20130022547 - Attenuated mycoplasma gallisepticum strains: The present invention provides live, attenuated Mycoplasma gallisepticum bacteria that exhibit reduced expression of a protein identified as MGA_0621. In certain embodiments, the attenuated bacteria may additionally exhibit reduced expression of one or more proteins selected from the group consisting of pyruvate dehydrogenase, phosphopyruvate hydratase, 2-deoxyribose-5-phosphate aldolase, and ribosomal protein... Agent: Wyeth LLC

20130022548 - Methods and compositions relating to reporter gels for use in mri techniques: The present invention describes methods and compositions for non-invasively assessing the molecular structure of biocompatible hydrogels using MRI analysis. It is shown that biocompatible hydrogels prepared from polymerizing macromolecules that are attached to a paramagnetic, superparamagnetic or ferromagnetic contrast agents form reporter gels wherein monitoring of the changes in the... Agent:

20130022549 - Halogenated phenols for diagnostics, antioxidant protection and drug delivery: The present invention relates to a composition and method for the detection of a detectable product formed from a compound of the present invention in the body of an individual. The detectable product may include a halide or a benzenetriol-based or benzenetetrol-based product of a dehalogenation reaction in the presence... Agent:

20130022551 - Despr antagonists and agonists as therapeutics: Provided herein are novel compositions comprising DEspR-specific antagonists and agonists, and methods of their use in a variety of therapeutic applications. The compositions comprising the DEspR-specific anatgonists and agonists described herein are useful in therapeutic, diagnostic and imaging methods, such as DEspR-targeted molecular imaging of angiogenesis, and for companion diagnostic... Agent: Trustees Of Boston University

20130022550 - Microbubble compositions, method of making same, and method using same: A method of forming a plurality of microbubbles, wherein the method disposes in a sealed container comprising a first volume at ambient pressure, a second volume of a mixture comprising one or more microbubble stabilizing materials. The first volume is greater than said second volume. The method further comprises sealing... Agent:

20130022552 - Blood clotting composition and method of use: The composition is a blood clotting composition including at least one hemostatic agent and an indicator agent that adheres to the skin on or around the wound, the indicator agent being specifically identifiable to the hemostatic composition. The composition can be adapted to be applied to a wound as an... Agent:

20130022553 - Novel polyamino polyketide antibiotics and uses thereof: The present invention relates to novel polyamino polyketide antibiotics, methods of their production as well as methods of using these antibiotics, for example, for inhibition or removal of biofilm formation or for treating bacterial infection with these antibiotics.... Agent: Agency For Science, Technology And Research

20130022554 - Oral care formulations: A formulation for an oral care application comprises a linear polyphosphate or a polyphosphate blend having a short average effective chain length. The polyphosphate blend may further comprise a cyclic phosphate and a linear polyphosphate. The formulation provides whitening effects, decreased tooth sensitivity, strengthened tooth enamel, and remineralization. The present... Agent:

20130022556 - Liquid cleaning composition and/or cleansing composition: The present invention relates to a liquid, cleaning and/or cleansing composition comprising abrasive cleaning particles.... Agent:

20130022555 - Methods and materials for providing teeth with a white appearance: This document provides methods and materials for providing teeth with a white appearance. For example, methods and materials for contacting teeth with one or more fluorescence emitting polypeptides (e.g., a blue fluorescent protein (BFP)) to provide the teeth with a whiter appearance are provided.... Agent:

20130022561 - Cosmetic composition comprising a supramolecular compound capable of establishing hydrogen bonds, and a particular oil: The present invention relates to a cosmetic composition comprising, in a cosmetically acceptable medium, (i) a supramolecular compound that may be obtained by reaction between: at least one oil bearing at least one nucleophilic reactive function chosen from OH and NH2, and at least one junction group capable of establishing... Agent: L'oreal

20130022557 - Methods for improving the appearance of hyperpigmented spot(s) using an extract of laminaria saccharina: A method of improving the appearance of a hyperpigmented spot may comprise the step of applying a composition comprising a safe and effective amount of an Laminaria Saccharina extract to a hyperpigmented spot on a skin surface, wherein the composition is applied for a period of time sufficient for the... Agent:

20130022558 - Methods for imrproving the appearance of hyperpigmented spot(s) and skin tone: A method of improving the appearance of a hyperpigmented spot and improving skin tone may comprise the steps of applying a safe and effective amount of a Laminaria Saccharina extract to a hyperpigmented spot on a skin surface, wherein the Laminaria Saccharina extract is applied for a period of time... Agent:

20130022559 - Methods for inhibiting tyrosinase using an extract of laminaria saccharina: A method of inhibiting tyrosinase activity may involve the step of applying a composition comprising a Laminaria Saccharina extract to a substrate in need of tyrosinase inhibition. The method may further comprise a step of identifying a substrate in need of tyrosinase inhibition. The composition may be left on the... Agent:

20130022562 - Novel cereal products, production and use thereof, and cosmetic formulations containing them: This invention relates to novel cereal products, especially natural cereal products of colloidal nature. The invention also relates production and uses of colloidal cereal products. Further the invention relates to cosmetic formulations containing cereal products.... Agent: Oat Services Ltd.

20130022560 - Novel compounds: The invention relates to novel polyglycerol based UV-filters as well as to topical compositions comprising such novel polyglycerol based UV-filters. Furthermore, the invention relates to the use of such novel polyglycerol based UV-filters to enhance the solubility of butyl methoxydibenzoylmethane or bis-ethylhexyloxyphenol methoxyphenyl triazine in cosmetic oils.... Agent:

20130022563 - Water-in-oil emulsion composition: A water-in-oil emulsion composition which contains a low water-solubility but oil-soluble ultraviolet absorber, and which exhibits excellent ultraviolet light protection and stability. The composition contains (a) an aqueous dispersion of an oil-soluble ultraviolet absorber; (b) a polyoxyalkylene-modified polysiloxane having a molecular mass of at least 2000; and (c) at most... Agent:

20130022564 - Compositions and methods for dermally treating infections: The present invention is drawn to solidifying adhesive formulations, methods of drug delivery, and solidified layers for dermal delivery of a drug for treating various skin infections, such as fungal, bacterial, and/or viral skin infections. The formulation can include anti-infective drug, solvent vehicle, and solidifying agent. The solvent vehicle can... Agent:

20130022565 - Bleaching composition comprising a peroxygenated salt in a base very rich in fatty substances: The present invention relates to a composition for lightening keratin fibres, comprising, in a cosmetically acceptable medium:—at least 30% by weight, relative to the total weight of the composition, of one or more fatty substances free of carboxylic acid groups;—one or more peroxygenated salts;—one or more basifying agents; and—hydrogen peroxide;... Agent: L'oreal

20130022566 - Method of making antiperspirant active compositions having sec chromatogram exhibiting high sec peak 4 intensity: A method of making an antiperspirant active composition comprising: heating an aqueous solution containing an aluminum salt having an aluminum to chloride molar ratio of about 0.3:1 to about 3:1, optionally with a buffer agent, at a temperature of about 50° C. to about 95° C. to reflux for a... Agent: Colgate-palmolive Company

20130022567 - Hair care composition comprising alkyl-modified siloxane: m

20130022568 - Single phase depilatory composition: A depilatory composition, and a method of using a depilatory composition, where the present invention is a depilatory composition comprising: (1) a film-forming polymer; (2) depilatory active ingredients; and (3) a solvent system, wherein the depilation composition forms a peelable film after drying. The depilation composition of the present invention... Agent: Church & Dwight Co., Inc.

20130022569 - Hydrogels: The invention provides hydrogels comprising bioactive-based poly(anhydride-ester)s (PAEs) and methods for use thereof.... Agent:

20130022570 - Crosslinked polyvinylamine, polyallylamine, and polyethyleneimine for use as bile acid sequestrants: The present invention provides a crosslinked amine and amide polymers effective for binding and removing bile salts from the gastrointestinal tract. These bile acid binding polymers or pharmaceutical compositions thereof can be administered to subjects to treat various conditions, including hypercholesteremia, diabetes, pruritis, irritable bowel syndrome-diarrhea (IBS-D), bile acid malabsorption,... Agent: Relypsa, Inc.

20130022571 - Methods for treating viral infection using il-28 and il-29 cysteine mutants: IL-28A, IL-28B, IL-29, and certain mutants thereof have been shown to have antiviral activity on a spectrum of viral species. Of particular interest is the antiviral activity demonstrated on viruses that infect liver, such as hepatitis B virus and hepatitis C virus. In addition, IL-28A, IL-28B, IL-29, and mutants thereof... Agent: Zymogenetics

20130022572 - Organic compounds and their uses: The present application describes organic compounds that are useful for the treatment, prevention and/or amelioration of human diseases.... Agent:

20130022573 - Macrocyclic inhibitors of flaviviridae viruses: e

20130022574 - Avirulent salmonella gallinarum variants and pharmaceutical composition using the same: The present invention relates to avirulent Salmonella Gallinarum variants by inactivating virulence gene clusters of Salmonella Gallinarum (SG), a main pathogen of avian salmonellosis, and various uses thereof notably in the production of Salmonella-specific lytic bacteriophages, pharmaceutical compositions and feed additives.... Agent: Cj Cheiljedang Corporation

20130022585 - Regeneration and repair of neural tissue using postpartum-derived cells: Cells derived from postpartum umbilicus and placenta are disclosed. Pharmaceutical compositions, devices and methods for the regeneration or repair of neural tissue using the postpartum-derived cells are also disclosed.... Agent: Advanced Technologies And Regenerative Medicine, LLC

20130022576 - Compositions and methods for reducing the incidence of equine digestive disorders: The present invention encompasses compositions and methods of reducing the incidence of equine digestive disorders.... Agent: Novus International Inc.

20130022577 - Probiotic compositions useful for treatment of bipolar disorder: Compositions and methods for treatment or prophylaxis of a bipolar disorder disease state, in which the compositions include the bacilli (1) Bacillus subtilis, (2) Bacillus coagulans, and (3) Enterococcus faecium. The compositions may be embodied in suitable dose forms such as capsules containing the microbial species in combination with a... Agent: Cobb & Associates

20130022575 - Systems and methods of replacing intestinal flora: The invention relates to one or more systems and methods for creating a mixture of cultures used to replace intestinal flora. Specifically, the invention relates to methods and systems of treating diseases including Clostridium difficile and Crohn's disease by introducing a mixture of pure cultures of viable bacteria into the... Agent: Microbial Rx

20130022578 - Methods and system for interfering with viability of bacteria and related compounds and compositions: Provided herein are methods and systems for interfering with viability of bacteria and related compounds and compositions.... Agent:

20130022586 - Production and use of bacterial histamine: A method is provided of selecting specific probiotic lactic acid bacteria producing histamine and the use of such strains for beneficial effects for mammals. The method includes selecting a lactic acid bacterial strain for use in the local production of histamine in a mammal, and further comprises screening bacteria for... Agent:

20130022579 - Bacteriophage and antibacterial composition comprising the same: The present invention relates to a novel bacteriophage, more particularly, a bacteriophage that has a specific bactericidal activity against Salmonella typhimurium, Salmonella gallinarum, or Salmonella pullorum, a composition for the prevention or treatment of infectious diseases including salmonellosis and Salmonella food poisoning caused by Salmonella typhimurium, Fowl typhoid caused by... Agent: Cj Cheiljedang Corporation

20130022583 - Direct conversion of cells to cells of other lineages: Methods, compositions and kits for producing functional neurons, astroctyes, oligodendrocytes and progenitor cells thereof are provided. These methods, compositions and kits find use in producing neurons, astrocytes, oligodendrocytes, and progenitor cells thereof for transplantation, for experimental evaluation, as a source of lineage- and cell-specific products, and the like, for example... Agent:

20130022584 - Methods and compositions for the repair and/or regeneration of damaged myocardium using cytokines and variants thereof: Methods, compositions, and kits for repairing damaged myocardium and/or myocardial cells including the administration of cytokines, variants of cytokines, cardiac stem cells, or combinations thereof are disclosed and claimed. In addition, methods, compositions, and kits for forming coronary vasculature including the administration of cytokines, variants of cytokines, cardiac stem cells,... Agent:

20130022582 - Multipotent nestin-positive cells: The present invention relates to the use of at least one isolated multipotent stem cell for maintaining haematopoiesis in vitro, in which said multipotent stem cell is preferably a mesenchymal stem cell or, more preferably, said mesenchymal stem cell is a mesenchymal stem cell capable of expressing the nestin protein.... Agent: Hospital Clinic De Barcelona

20130022581 - Placental stem cell populations: The present invention provides placental stem cells and placental stem cell populations, and methods of culturing, proliferating and expanding the same. The invention also provides methods of differentiating the placental stem cells. The invention further provides methods of using the placental stem cells in assays and for transplanting.... Agent:

20130022580 - Preparation and use of meristematic cells belonging to the dendrobium phalaenopsis, anisellia, polyrrhiza, vanilla, cattleya and vanda genera with high content of phenylpropanoids, hydrosoluble polysaccharides and extensins: The present invention relates to the preparation of plant cell cultures belonging to the Dendrobium Phalaenopsis, Anisellia, Polyrrhiza, Vanilla, Cattleya and Vanda genera and their use in cosmetic, nutritional and pharmaceutical fields. In particular, the present invention regards a selected cell culture of meristematic cells of plants belonging to the... Agent:

20130022587 - Cycloalkyl-substituted imidazole derivative: A compound represented by the following general formula (I) or a pharmacologically acceptable salt thereof, wherein A represents a C3 to C12 cycloalkyl group which may be substituted by one to three selected from a fluoro group, a hydroxy group, a C1 to C6 alkyl group, etc; R1, R2, and... Agent: Daiichi Sankyo Company, Limited

20130022588 - Stable formulations of a hyaluronan-degrading enzyme related applications: Provided are compositions that are stable formulations of a hyaluronan-degrading enzyme or are stable co-formulations of a fast-acting insulin and a hyaluronan degrading enzyme, including a recombinant human PH20 (rHuPH20).... Agent:

20130022590 - Compositions comprising zinc finger domains and uses therefor: The present invention relates to compositions of matter comprising zinc finger domains that bind to single-stranded RNA and are useful for modifying gene expression such as by regulating processing of messenger RNA (mRNA) or non-coding RNA (ncRNA). The invention also relates to screening, diagnostic and therapeutic methods employing such compositions... Agent:

20130022591 - Methods of reducing or inhibiting toxic effects associated with a bacterial infection using alkaline phosphatase: This invention relates generally to a therapeutic use of alkaline phosphatase to reduce or inhibit toxic effects associated with a bacterial infection in a subject.... Agent: The General Hospital Corporation

20130022589 - Methods of treating human papillomavirus: Two RNases (ranpirnase and the second embodiment disclosed in U.S. Pat. No. 5,728,805) are tested against human papillomavirus infections. QRT-PCR assays indicate that the RNases have anti-viral activity against type 11 HPV.... Agent: Tamir Biotechnology, Inc.

20130022592 - Continuous subcutaneous insulin infusion methods with a hyaluronan-degrading enzyme: Provided are methods for continuous subcutaneous insulin infusion (CSII) that employ a hyaluronan-degrading enzyme, including a recombinant human PH20 (rHuPH20). The methods can be used to more consistently control blood glucose during the course of CSII. The methods can be used to treat subjects having diabetes or other insulin-associated disease... Agent:

20130022593 - Methods of diagnosing endometriosis: The present invention provides biomarkers for the diagnosis and prognosis of endometriosis. Generally, the methods of this invention find use in diagnosing or for providing a prognosis for endometriosis by detecting the expression levels of biomarkers, which are differentially expressed (up- or down-regulated) in endometrial cells from a patient with... Agent: The Regents Of The University Of California

20130022596 - Methods and compositions for diagnostic use in cancer patients: Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer.... Agent: F. Hoffmann-la Roche Ag

20130022594 - Selective fak inhibitors: s

20130022595 - Variants of humanized immunomodulatory monoclonal antibodies: The present invention relates to humanized monoclonal antibodies, pharmaceutical compositions that include the same, and use thereof for the treatment of a variety of indications, particularly cancer and immunodeficiency disorders. In particular, the present invention provides modified antibodies or fragments thereof having specific amino acid modifications compared to the humanized... Agent: Curetech Ltd.

20130022597 - Antibodies directed to gpnmb and uses thereof: The present invention provides fully human monoclonal antibodies that specifically bind to GPNMB, and uses thereof. Nucleotide sequences encoding, and amino acid sequences comprising, heavy and light chain immunoglobulin molecules, particularly sequences corresponding to contiguous heavy and light chain sequences spanning the framework regions and/or complementarity determining regions (CDRs) are... Agent:

20130022598 - Dual specific immunotoxin for brain tumor therapy: We tested the in vitro and in vivo efficacy of a recombinant bispecific immunotoxin that recognizes both EGFRwt and tumor-specific EGFRvIII receptors. A single chain antibody was cloned from a hybridoma and fused to toxin, carrying a C-terminal peptide which increases retention within cells. The binding affinity and specificity of... Agent: Duke University

20130022599 - Method of treating fibroproliferative disorders: Materials and methods for reducing cell proliferation or extracellular matrix production in a mammal are disclosed. The methods comprise administering to a mammal a composition comprising a therapeutically effective amount of a zvegf4 antagonist in combination with a pharmaceutically acceptable delivery vehicle. Exemplary zvegf4 antagonists include anti-zvegf4 antibodies, inhibitory polynucleotides,... Agent: Zymogenetics, Inc.

20130022600 - Pd-1 antibodies in combination with a cytokine-secreting cell and methods of use thereof: The present invention relates to a method of enhancing the anti-tumor response in a mammal. More particularly, the invention is concerned with combinations comprising a cytokine-secreting cell and an anti-PD-1 antibody, and methods of administering the combination for enhanced immune response to tumor cells in a patient with a cancer.... Agent: Biosante Pharmaceuticals, Inc.

20130022601 - Trivalent, bispecific antibodies: The present invention relates to trivalent, bispecific antibodies, methods for their production, pharmaceutical compositions containing the antibodies, and uses thereof.... Agent:

20130022604 - Antibody against serotype b lipopolysaccharide of pseudomonas aeruginosa: Provided is a novel antibody having an excellent antibacterial activity against P. aeruginosa. By using plasmablasts obtained from cystic fibrosis patients with chronic P. aeruginosa pulmonary infection as starting materials, antibodies which bind to LPS of a P. aeruginosa strain of serotype B and which have excellent antibacterial activities in... Agent: Meiji Seika Pharma Co., Ltd.

20130022603 - Antibody against serotype i lipopolysaccharide of pseudomonas aeruginosa: Provided is a novel antibody having an excellent antibacterial activity against P. aeruginosa. By using plasmablasts obtained from cystic fibrosis patients with chronic P. aeruginosa pulmonary infection as starting materials, antibodies which bind to LPS of a P. aeruginosa strain of serotype I and which have excellent antibacterial activities in... Agent: Meiji Seika Kaisha, Ltd.

20130022602 - Methods and compositions to modulate antiviral and immune activity responses: The invention is directed to an improved method to manufacture virus for use in vaccine by culturing infected cells that have been modified to overexpress miR-144. The invention is also directed to manipulating the activity or level of miR-144 in subjects in order to modulate the antiviral and immune response... Agent:

20130022605 - Antagonists against tnfr1 and methods of use therefor: The invention provides methods for treating inflammatory diseases (e.g., chronic inflammatory diseases) comprising administering an antagonist of Tumor Necrosis Factor Receptor 1. The invention also provides ligands that contain an immunoglobulin single variable domain (domain antibody, dAb) monomer that binds Tumor Necrosis Factor Receptor 1, and methods of using the... Agent:

20130022608 - Full-length igg immunoglobulins capable of recognizing a heterosubtype neutralizing epitope on the hemagglutinin stem region and uses thereof: Monoclonal antibodies that are full-length IgG-isotype immunoglobulins and that are characterized by a high broad-range neutralizing activity against the influenza A virus and capable of recognizing a specific hemagglutinin epitope that is highly conserved among different influenza A virus subtypes are provided. Also provided are therapeutic, prophylactic and diagnostic uses... Agent: Pomona Ricerca S.r.l.

20130022607 - Mucosal vascular addressins and uses thereof: The present invention relates to isolated antibodies and antigen-binding fragments that selectively bind human MAdCAM.... Agent: Millennium Pharmaceuticals, Inc.

20130022606 - Neutralizing prolactin receptor antibodies and their therapeutic use: The present invention is directed to the neutralizing prolactin receptor antibody 006-H07, and antigen binding fragments, pharmaceutical compositions containing them and their use in the treatment or prevention of benign disorders and indications mediated by the prolactin receptor such as endometriosis, adenomyosis, non-hormonal female contraception, benign breast disease and mastalgia,... Agent: Bayer Intellectual Property Gmbh

20130022609 - Method of treating androgen independent prostate cancer: The present invention is directed to a method treating prostate cancer. The method comprises administering to a patient in need thereof at least one compound selected from N-methyl-Δ3,3′-dihydroindole-2,2′ diketone; N-1-(β-D-O-triacetyl-xylopranosyl)-Δ3,3′-dihydroindole-2,2′ diketone; and N-1-(β-D-O-triacetyl-xylopranosyl)-N′-methyl-Δ3,3′-dihydroindole-2,2′ diketone. Preferably the compound is in an amount sufficient to inhibit growth, invasion, and/or metastasis of prostate... Agent: Natrogen Therapeutics International, Inc.

20130022610 - Methods of decreasing glycosylated hemoglobin in patients with dyslipidemia: Methods for treating abnormal glycosylated hemoglobin (HbA1c) levels in a patient in need thereof, wherein the provided methods comprise administering to a patient in need a therapeutically effective amount of an Interleukin-1β modulator. Also, the invention provides compositions comprising at least one lipid modifying agent and an IL-1β modulator.... Agent:

20130022611 - Methods and compositions for modulating hepsin activation of urokinase-type plasminogen activator: The invention provides methods and compositions for modulating hepsin activity and the uPA/plasmin pathway, in particular by regulating pro-uPA activation by hepsin.... Agent: Genentech, Inc.

20130022612 - Methods and compositions for malaria prophylaxis: A composition for preventing malaria infection including a steric inhibitor of circumsporozoite protein cleavage. A pharmaceutical composition for preventing malaria infection including a steric inhibitor and a pharmaceutical carrier. A method of malaria infection prophylaxis including the step of administering an effective amount of the composition of the present invention.... Agent: New York University

20130022613 - Wise/sost nucleic acid sequences and amino acid sequences: The present invention relates to nucleic acid sequences and amino acid sequences which influence bone deposition, the Wnt pathway, ocular development, tooth development, and may bind to LRP. The nucleic acid sequence and polypeptides include Wise and Sost as well as a family of molecules which express a cysteine knot... Agent:

20130022614 - Ige antibodies for the treatment of cancer: The present invention provides monoclonal IgE antibodies comprising Fc epsilon (ε) constant regions and variable regions comprising at least one antigen binding region specific for binding a single epitope of a circulating, tumor-associated antigen (TAA) that is not a cell surface antigen wherein the epitope of the targeted antigen is... Agent: Advanced Immune Therapeutics, Inc.

20130022615 - Compositions and methods for antibodies targeting complement protein c5: The present invention relates to antibodies targeting complement protein C5 and compositions and methods of use thereof.... Agent: Novartis Ag

20130022617 - Compositions and methods for treating tumors, fibrosis, and pulmonary alveolar proteinosis: The present disclosure provides pharmaceutical compositions and methods useful for modulating angiogenesis and for inhibiting metastasis, tumors, pulmonary alveolar proteinosis, and fibrosis in a mammalian tissue. Pharmaceutical compositions and methods include inhibitors of LOXL2 expression and activity, such as shRNA targeting LOXL2.... Agent: Technion Research & Development Foundation Ltd.

20130022616 - Interleukin-31 monoclonal antibody: An isolated antibody that specifically binds to at least one of canine Interleukin-31 (IL-31) or feline IL-31 is provided. Such antibodies can be in the form of diagnostic and/or veterinary compositions useful for treating a pruritic and/or allergic condition in dogs or cats.... Agent: Pfizer Inc.

20130022618 - Human cytomegalovirus neutralizing antibodies and use thereof: The invention relates to neutralizing antibodies, and antibody fragments thereof, having high potency in neutralizing hCMV, wherein said antibodies and antibody fragments are specific for one, or a combination of two or more, hCMV gene UL products. The invention also relates to immortalized B cells that produce, and to epitopes... Agent: Institute For Research In Biomedicine

20130022619 - Methods and compositions for inhibiting hiv transmission: The present invention provides methods and compositions useful in the field of medicine, and particularly in the treatment of viral infections. More particularly, the invention relates to the use of methods and compositions for the inhibition of human immunodeficiency virus (HIV) transmission.... Agent:

20130022621 - Antibody formulation and therapeutic regimens: The present disclosure relates to AM-14 pharmaceutical formulations and therapeutic dosing regimens for the treatment of disease.... Agent: Amgen Inc

20130022620 - Assays and methods pertaining to pre-amyloid intermediates: The present invention relates to amyloidogenic peptides, polypeptides and proteins; and methods for screening to identify modulators of polypeptide self-aggregation into amyloids. The invention further relates to assays and methods using islet amyloid polypeptide (IAPP) as a component of a model system with which to screen for modulators of islet... Agent:

20130022622 - Compounds for the treatment of autism: A compound which inhibits the importation of chloride into neurons and a compound which improve the outflow of chloride from neurons for the use in treatment of autism, a pharmaceutical composition for use in the treatment of autism including such compound and a pharmaceutically acceptable carrier are described.... Agent: Universite D'aix Marseille

20130022623 - Antibodies that specifically bind to tim3: Provided herein are antibodies specific for TIM3 that can be used to detect cancer cells, in particular, cancer stem cells. The antibodies can also be used in therapeutic compositions for treating cancer and reducing inflammation.... Agent: Cellerant Therapeutics, Inc.

20130022624 - Anti-epidermal growth factor receptor antibodies and uses thereof: The present invention discloses humanized anti-epidermal growth factor receptor antibodies, which have favorable binding activity (the binding affinity being 5.09×10−10 mol/L) and are able to inhibit the growth and migration of tumor cells. The present invention also discloses the preparation methods and uses of the antibodies.... Agent: Guangzhou Recomgen Biotech Co., Ltd.

20130022625 - Stabilized antibody-containing liquid formulations: The present inventors discovered that a significant stabilization effect was achieved by using an acidic amino acid, aspartic acid or glutamic acid as a counter ion species in histidine buffer or tris(hydroxymethyl)aminomethane, specifically by using histidine-aspartate buffer or histidine-glutamate buffer, or tris(hydroxymethyl)aminomethane-aspartate or tris(hydroxymethyl)aminomethane-glutamate as a buffer. The present inventors... Agent: Chugai Seiyaku Kabushiki Kaisha

20130022626 - Long-acting human follicle-stimulating hormone formulation using immunoglobulin fragment: The present invention relates to a long-acting human follicle-stimulating hormone formulation having improved in vivo duration and stability, comprising a human follicle-stimulating hormone conjugate that is prepared by covalently linking human follicle-stimulating hormone with an immunoglobulin Fc region via a non-peptidyl polymer, and a preparation method thereof. The long-acting human... Agent: Hanmi Science Co., Ltd.

20130022627 - Combination therapy with antibody-drug conjugates: Methods for the treatment of Hodgkin's lymphoma comprising administering both a chemotherapeutic regimen and an antibody-drug conjugate compound to a subject in need thereof are provided.... Agent: Seattle Genetics, Inc.

20130022628 - Acyl pseudopeptides which carry a functionalized auxiliary arm: Compounds of the present invention have immunomodulating properties like adjuvants. In addition, compounds of the invention can be grafted on a given antigen in order to modulate or tune the immune response or can be equally grafted on a pharmaceutical carrier to enhance the therapeutic effect or targeting thereof. Accordingly,... Agent: Om Pharma

20130022629 - Modulators of immunoinhibitory receptor pd-1, and methods of use thereof: Disclosed are an assay to identify modulators of the PD-1:PD-L pathway and PD-1:PD-L pathway modulators, e.g., compounds and pharmaceutical compositions thereof. Methods for treating diseases influenced by modulation of the PD-1:PD-L pathway such as, for example, autoimmune diseases, inflammatory disorders, allergies, transplant rejection, cancer, immune deficiency, and other immune system-related... Agent:

20130022630 - Method for treating amyloid disease: The invention relates to methods for treating human amyloid disease by administration of modified Aβ peptide immunogens.... Agent:

20130022632 - Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene: The present invention provides vectors that contain and express in vivo or in vitro FeLV antigens that elicit an immune response in animal or human against FeLV, compositions comprising said vectors and/or FeLV polypeptides, methods of vaccination against FeLV, and kits for use with such methods and compositions.... Agent:

20130022631 - Vaccine for chikungunya virus infection: The present invention relates to vaccine formulation capable of eliciting protective immune response against Chikun-gunya virus infection in humans and other mammalian hosts. The immunogenic formulation comprises purified inactivated Chikun-gunya virus in a stable formulation. Methods of propagation and purification of the virus are discussed. The inactivated virus formulation is... Agent:

20130022633 - Meningococcal fhbp polypeptides: The factor H binding activity of meningococcal fHBP can be uncoupled from its bactericidal sensitivity. NMR studies have identified various amino acid residues involved in the fHBP/fH interaction and one or more of these residues is modified in a fHBP to reduce or eliminate its ability to bind to fH.... Agent: Novartis Ag

20130022634 - New composition and methods for treatment of autoimmune and allergic diseases: The present invention provides improved methods and compositions for treating and preventing autoimmune and allergic diseases. More specifically, the invention relates to new immunomodulating complexes that are fusion proteins comprising a mutant subunit of the A1-subunit of the cholera toxin (CTA1), a peptide capable of binding to a specific cellular... Agent: Toleranzia Ab

20130022635 - Expression modulator for clock gene bmal: The present invention provides a substance which can modulate expression of a Bmal gene effectively and with a wide range of application. Provided is an expression modulator for the Bmal gene comprising, as an active ingredient, one or more selected from the group consisting of hinoki cypress extract, chlorella extract,... Agent: Shiseido Company, Ltd.

20130022636 - Physical mode of action pesticide: A physical mode of action pesticide for application on plants and in soils, and methods of manufacture and application, comprising an active ingredient in the form of a polymer in a concentration of less than 0.1% wt., a surfactant, a co-solvent and a diluent in a hydrocolloid suspension. The suspension... Agent: Cai Patent Holding, LLC

20130022637 - Recombinant baculovirus vaccine: The present invention provides a novel transfer vector and a recombinant baculovirus; methods for the production thereof; pharmaceuticals containing the recombinant baculovirus as an active ingredient, which are useful as preventive or therapeutic drugs for infectious diseases such as malaria and influenza; and methods for preventing and treating infectious diseases... Agent: Educational Foundation Jichi Medical University

20130022638 - Tuberculosis vaccine: The present invention relates to an isolated microorganism belonging to the genus Mycobacterium, characterized in that it comprises inactivating the gene Rv0757 that confers a PhoP− phenotype and inactivating a second gene that prevents the production of DIM (DIM-phenotype). Additionally, the present invention comprises the use of said microorganism for... Agent: Universidad De Zaragoza

20130022639 - Expression of meningococcal fhbp polypeptides: The meningococcal fhbp gene (encoding factor H binding protein) is naturally expressed from two independent transcripts by two differentially regulated promoters. In one transcript it is co-expressed with the neighbouring upstream gene from the Pnmb1869 promoter. The other transcript is monocistronic and is expressed from its own dedicated promoter, Pfhbp,... Agent: Novartis Ag

20130022640 - Immune modulators relating to foxo3a: The invention provides methods of enhancing an immune response to a cancer antigen in a mammal comprising inhibiting the activity of the foxo3a gene or gene product in dendritic cells in the mammal. The invention also provides methods of suppressing an immune response to an autoimmune disease antigen in a... Agent: The United States Of America, As Represented By The

20130022641 - Anti-tumor agent and immunostimulating agent: To provide a pharmaceutical composition comprising a ceramide-related substance having little adverse side effects as an active ingredient by using a raw material that is highly safe to a human body and is inexpensive. A pharmaceutical composition comprising at least one sphingoglycolipid derivative that is produced from a beer waste... Agent: University Of The Ryukyus

20130022642 - Dual antagonist for tnf-a and il-21 for preventing and treating autoimmune diseases: The present invention relates to TNFR2-IL21R fusion protein acting as a double-antagonist to TNF-alpha (α) and IL-21. The composition containing the double antagonist to TNF-α and Il-21 (TNFR2-IL21R fusion protein), known as major causes of autoimmune rheumatoid arthritis, one of autoimmune diseases, can reduce the secretion of inflammatory cytokine, increase... Agent: Korea Research Institute Of Bioscience And Biotechnology

20130022643 - Antimicrobial anti-chafing chelated silver oxide compound: Described herewithin is a composition comprising an anti-chafing balm with C18-36 acid triglycerides, capric/carprylic triglycerides, and tribehinin together with a chelated silver oxide complex comprising a barrier film when applied to the skin. The film is a dual purpose antibacterial and anti-chafing barrier topically applied to human skin, providing a... Agent: Bodyglide

20130022653 - Biomimetic hydroxyapatite synthesis: A method for preparing nanoscale hydroxyapatite particles by combining an amount of a calcium ion source, which includes calcium acetate, and an amount of a phosphate ion source, wherein the amounts are sufficient to produce nanoscale hydroxyapatite particles and the amounts are combined under ambient conditions to produce the hydroxyapatite... Agent: Rutgers, The State University Of New Jersey

20130022650 - Compositions containing salmeterol, fluticasone and cromoglicic acid: The present invention relates to the use of cromoglicic acid and/or nedocromil salts in pharmaceutically effective amounts in a pharmaceutical composition containing salmeterol or a pharmaceutically acceptable salt thereof as a 32-agonisti combined with fluticasone or a pharmaceutically acceptable salt thereof as a corticosteroid for the treatment of the respiratory... Agent:

20130022646 - Controlled release formulations of opioids: Pharmaceutical formulations containing opioid components that each has a release profile. The components may provide immediate or controlled release of the opioid. The invention is also directed to methods of controlling release of one or more opioid compounds and methods of treating pain.... Agent:

20130022654 - Controlled release pharmaceutical compositions of tapentadol: A once daily controlled release pharmaceutical compositions comprising tapentadol, wherein preferably the mean Tmax of tapentadol is reached after 10 hours of administration of the composition. The composition comprises tapentadol, such that it maintains serum concentration of tapentadol of at least about 20 ng/ml for at least about 17 hours... Agent: Lupin Limited

20130022648 - Granules of porous biocompatible materials: The disclosure provides granular forms of porous biomaterials and methods for forming and applying these biomaterials, including uses to promote vascularization and tissue ingrowth.... Agent: Healionics Corporation

20130022651 - Hydrogel materials incorporating eluting ceragenin compound: A hydrogel polymer includes a ceragenin compound. The ceragenin compound has a hydrophobicity/hydrophilicity that produces a release rate in a range of 0.1-100 μg/ml for at least 3 days.... Agent:

20130022644 - Novel n-phenylacetamide derivatives, which inhibit the enzyme soat-1, and pharmaceutical and cosmetic compositions containing them: h

20130022645 - Pharmaceutical formulations of bisphosphonate with enhanced oral bioavailability: Disclosed is an oral bisphosphonate formulation characterized by an enhanced clinical bioavailability of bisphosphonate and by the use of phytic acid and a delayed release means for releasing bisphosphonate at a site of the lower gastrointestinal tract. Having a low phytic acid content, the oral bisphosphonate formulation guarantees high safety... Agent: Dong-a Pharm. Co., Ltd.

20130022647 - Polymers for reversing heparin-based anticoagulation: Embodiments presented herein relate to various polymers. Some of the polymer embodiments are heparin binding polymers. Some embodiments of the heparin binding polymers can be employed to bind to heparin for methods such as separating, purifying, removing, and/or isolating heparin and heparin like molecules.... Agent: University Of British Columbia

20130022649 - Snalp formulations containing antioxidants: The present invention provides methods of preventing, decreasing, or inhibiting the degradation of cationic lipids and/or active agents (e.g., therapeutic nucleic acids) present in lipid particles, compositions comprising lipid particles stabilized by these methods, methods of making these lipid particles, and methods of delivering and/or administering these lipid particles, e.g.,... Agent: Protiva Biotherapeutics, Inc.

20130022652 - Stable medicated chewing gum comprising cyclodextrin inclusion complex: The present invention provides stable medicament-containing chewing gum compositions comprising an inclusion complex comprising cyclodextrin and one or more active compound(s) according to formula I, such as cetirizine, and methods for preparing such chewing gum.... Agent: Fertin Pharma A/s

20130022655 - Metal oxide nanocomposites for uv protection: The present invention relates to a method of protecting a substrate against ultraviolet (UV) irradiation by applying to the substrate metal oxide nanocomposite particles showing at the same time high transmittance of visible light and high absorbance of UV light.... Agent: Basf Se

20130022656 - Water containing powder composition: Powdery composition comprising: a) at least one powder in form of core-shell particles, the core comprising liquid water or a liquid aqueous phase and the shell comprising hydrophobic or hydrophobized particles and b) at least one powder comprising carrier and b1) at least partially water soluble liquid and/or b2) a... Agent: Evonik Degussa Gmbh

20130022658 - Depositing material with antimicrobial properties on permeable substrate using atomic layer deposition: Embodiments relate to depositing a layer of antimicrobial material such as silver on a permeable substrate using atomic layer deposition (ALD). A deposition device includes two injectors that inject source precursor, reactant precursor, purge gas or a combination thereof onto the permeable substrate that passes between the injectors. Part of... Agent: Synos Technology, Inc.

20130022657 - Embedded biocide: A phosphonium compound embedded in a matrix substrate wherein the phosphonium compound is selected from a group consisting of tris (hydroxyorgano) phosphine (THP), a THP+ salt (tetrakis (hydroxyorgano) phosphonium salt) or a condensate of THP and a nitrogen containing compound. The compound may be used to reduce the number of... Agent: Rhodia Uk Limited

20130022659 - Band, bracelet or strip carrier for an anti-microbial agent to reduce the spread of disease: A band, bracelet, strip or patch to be worn around the wrist or ankle or removably attached to the back of the wearer's hand. Each article is treated with an anti-microbial agent (e.g., tea tree oil) that is capable of killing germs and potentially harmful bacteria. The band, bracelet, strip... Agent:

20130022660 - Drug delivery system for the prevention of cerebral vasospasm: The present invention relates to the treatment and prevention of vasospasm. The present invention provides a system for treating a cerebral vasospasm in a human utilizing a pharmaceutical composition and administrating a therapeutically effective amount of the pharmaceutical composition to a predetermined location in close proximity to a cerebral artery... Agent: Edge Therapeutics, Inc.

20130022661 - Bio-remodable bone augmentation device and method: A bio-remodable augmentation device including an implantable member configured for maintaining space in a bone defect. The implantable member is formed from a bio-remodable composite having structural properties so as to aid in the generation of new bone tissue and eventually be reabsorbed in the newly formed bone tissue. This... Agent: Warsaw Orthopedic, Inc.

20130022662 - Compressed chewing gum tablet comprising taste-masking agent: The present invention relates to compressed chewing gum tablets comprising a useful antihistamine. In particular, the present invention is directed to compressed chewing gum tablet, which effectively mask the unpleasant tastes of compound according to formula I, such as cetirizine, contained therein and methods for preparing such compressed chewing gum... Agent: Fertin Pharma A/s

20130022668 - Biologically active taxane analogs and methods of treatment by oral administration: e

20130022669 - Branched, compact polyethyleneglycol derivatives: The present invention relates to branched polyethyleneglycol (PEG) derivatives consisting of a molecule with a quaternary carbon connected to three PEG chains, wherein all three PEG chains are of equal length and each comprises 1-30 —OCH2CH2— units, and one group with at least one carbon atom, wherein said at least... Agent: Spago Imaging Ab

20130022665 - Cationic lipids for therapeutic agent delivery formulations: wherein R1 and R2 is independently selected from a group consisting of C10 to C18 alkyl, C12 to C18 alkenyl, and oleyl group; wherein R3 and R4 are independently selected from a group consisting of C1 to C6 alkyl, and C2 to C6 alkanol; wherein X is selected from a... Agent:

20130022664 - E.coli lpfa antigen for prevention and treatment of infectious diseases: The present disclosure relates to methods and compositions for the treatment and prevention of microbial infections and for the enhancement of resistance to infection. The disclosure includes administration of an effective amount of an E. coli LpfA antigen to enhance the immune system to prevent infections that cause, e.g., inflammatory... Agent:

20130022667 - Fidgetin-like 2 as a target to enhance wound healing: Methods of treating a wound in a subject are provided comprising administering to the subject an amount of an inhibitor of Fidgetin-like 2. Compositions and pharmaceutical compositions comprising an amount of an inhibitor of Fidgetin-like 2 are also provided. Methods are also provided for identifying an inhibitor of Fidgetin-like 2.... Agent:

20130022663 - Method of making and using a topical medicated formula and delivery system to use to prevent and treat breast diseases and breast cancer as well as use as skin wellness and anti-wrinkle formula: t

20130022666 - Methods and compositions for transfer of mitochondria into mammalian cells: Disclosed are compositions comprising a lipid carrier and a mitochondria. Also disclosed are methods of delivering exogenous mitochondria to a cell and methods of treating or reversing progression of a disorder associated mitochondrial dysfunction in a mammalian subject in need thereof... Agent:

20130022670 - Aqueous pharmaceutical formulation of tapentadol for oral administration: An aqueous pharmaceutical composition containing tapentadol or a physiologically acceptable salt thereof and being adapted for oral administration. The composition has excellent storage stability without relying on the presence of high amounts of preservatives.... Agent: Gruenenthal Gmbh

20130022671 - Controlled release compositions of agents that reduce circulating levels of platelets and methods therefor: Provided are prophylactic and therapeutic methods of treatment of subjects for the purpose of inhibiting vaso-occlusive events, including embolism, by administering agents, including anagrelide and anagrelide derivatives, which reduce the number of circulating platelets to low normal or to below normal levels. Methods and pharmaceutical preparations comprising such agents are... Agent:

20130022673 - Enhancement of magnesium uptake in mammals: Disclosed are methods and complexes for increasing magnesium uptake in mammals. Increasing magnesium uptake in mammals is accomplished by concurrently administering one or more magnesium salts with one or more quaternary amines and/or phosphatides and one or more di- or tri-carboxylic acids, in a one part dosage system or a... Agent:

20130022672 - Stabilized amorphous forms of imatinib mesylate: The invention relates to the stabilized amorphous form of the methanesulfonic acid addition salt of 4-(4-methylpiperazin-1-ylmethyl)-N-[4-methyl-3-(4-(pyridin-3-yl)-pyrimidin-2-ylamino)-phenyl]-benzamide, pharmaceutical compositions such as capsules or tablets containing this form, the use of such form in diagnostic methods or, preferably, for the therapeutic treatment of warm-blooded animals, especially humans, and the use of formulation... Agent: Novartis Ag

20130022674 - Pharmaceutical delivery systems for hydrophobic drugs and compositions comprising same: A drug delivery system for oral administration of hydrophobic drugs with enhanced and extended absorption and improved pharmacokinetics is provided. In one embodiment, formulations comprising testosterone and testosterone esters, e.g., testosterone palmitate, are disclosed. Methods of treating a hormone deficiency or effecting male contraception with the inventive formulations are also... Agent: Clarus Therapeutics, Inc.

20130022679 - Controlled release and taste masking oral pharmaceutical composition: Controlled release and taste masking compositions containing one or more active principles inglobated in a three-component matrix structure, i.e. a structure formed by successive amphiphilic, lipophilic or inert matrices and finally inglobated or dispersed in hydrophilic matrices. The use of a plurality of systems for the control of the dissolution... Agent: Cosmo Technologies Limited

20130022677 - Delayed prolonged drug delivery: In one aspect, the present invention is concerned with a treatment where it is desired that an active agent is designed to be released in a prolonged manner at a time point some time after administration of the active agent. The present invention is particularly suited to administering an agent... Agent: University Of Strathclyde

20130022675 - Drug delivery system: A novel encapsulated product is provided and includes: at least one pharmaceutical; at least one compressible material; and at least one tableting material; wherein the encapsulated product is in the form of a caplet having a diameter of from about 1 millimeter to about 7 millimeters and a length from... Agent: Capricorn Pharma Inc.

20130022678 - Oral controlled release dosage form: A dosage form that provides a controlled release solid dosage form for the oral administration of a central nervous system stimulant, preferably methylphenidate hydrochloride.... Agent: Andrx Pharmaceuticals, Inc.

20130022676 - Pulsatile drug release: In one aspect, the present invention is concerned with a treatment where it is desired that an active agent is designed to be released in a pulse at a time point some time after administration of the active agent. The present invention is particularly suited to administering an agent which... Agent: University Of Strathclyde

20130022681 - Granules for pharmaceutical preparations, methods and apparatus for their production: Disclosed are improved granular pharmaceutical preparations, together with improved methods and apparatus for preparation of granules for use in such preparations. Such methods are especially useful for making granules for solid oral dose pharmaceutical preparations, and are particularly suited to the production of granules comprising 5-aminosalicylic acid (5-ASA) for the... Agent: Ferring B.v.

20130022680 - Modalities for the treatment of degenerative diseases of the retina: This invention relates to methods for improved cell-based therapies for retinal degeneration and for differentiating human embryonic stem cells and human embryo-derived into retinal pigment epithelium (RPE) cells and other retinal progenitor cells.... Agent:

20130022682 - Ultra-stable oligonucleotide-gold and-silver nanoparticle conjugates and method of their preparation: A method for stabilizing conjugates between macromolecule and nanoparticle by forming a thin reinforcement layer over the surface of a nanoparticle after macromolecule chains have attached to the surface of the nanoparticle. The stabilized conjugates can be used in a wide range of applications such as in vitro diagnostics, in... Agent:

20130022683 - Method for improving dissolution of anticoagulant agent: It is desired to provide a pharmaceutical composition containing a compound represented by formula (I) or a pharmaceutically acceptable salt thereof, or a solvate thereof, which exhibits an inhibitory effect on activated blood coagulation factor X, and is useful as an agent for preventing and/or treating thrombosis, wherein the pharmaceutical... Agent: Daiichi Sankyo Company, Limited

20130022684 - Oral pharmaceutical composition comprising fenofibric acid and an alkalifying agent: An oral pharmaceutical composition of the present invention comprising fenofibric acid or a pharmaceutically acceptable salt thereof, and 0.22 to 1 part by weight of an alkalifying agent based on 1 part by weight of fenofibric acid has improved bioavailability and a minimized absorption deviation in the gastrointestinal tract, which... Agent: Hanmi Science Co., Ltd.

20130022685 - Topical compositions and methods of detection and treatment: A topical composition includes a nanoemulsion of a plurality of hydrophobic particles having a hydrophilic coating therein. The hydrophobic particles are derived from the same or different hydrophobic material and each hydrophobic particle has a melting point below the melting point of the respective hydrophobic material. The hydrophobic particles comprise... Agent: The Johns Hopkins University

20130022686 - Combinations of liquid filtration media and methods for enhanced filtration of selected water contaminants: By sequentially aligning various filtration media and delivery systems, enhanced synergistic reduction of water contaminants is obtained compared to the prior art or separate use of the individual media/filters. Specific filtration media are formulated with proper proportioning and sequencing to enhance the ability to reduce metals that cause staining, odors... Agent: Hydropure Technologies, Inc.

20130022687 - Topical transdermal method for delivering nutrients through the skin for expedited wound healing: The present invention proposes a cosmetic or pharmaceutical preparation that comprises a mixture of nutritional related co-factors synergistically combined and applied as a topical/transdermal surfactant. Said surfactant formula invokes a precise ordered and sequential synchrony within the treated area initiating the bodies' own natural biological and healing circadia. Said surfactant... Agent:

20130022688 - Use of amisulpride as an anti-emetic: Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.... Agent:

20130022689 - Use of amisulpride as an anti-emetic: Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.... Agent:

20130022690 - Pharmaceutical composition and method for reducing weight: The present invention relates to a pharmaceutical composition, particularly homeopathic medicines for weight reduction, comprising the following components Adonis vernalis, Calcium carbonicum Hahnemann, Capsicum, Cascara, Fucus vesiculosus, Graphites and Kalium Carbonicum and Phytolacca. In addition the invention relates to a nutrition and a method for weight reduction.... Agent:

20130022691 - Nitric oxide generation, dilution, and topical application apparatus and method: An apparatus for controlled delivery of nitric oxide. A pump draws air through an activated carbon filter and into a reaction chamber. The generation of nitric oxide occurs in the reaction chamber. A second pump draws the gas in the reaction chamber through a calcium hydroxide filter and delivers the... Agent:

20130022692 - Expression modulator for clock gene period: The present invention provides a substance which can modulate expression of a Period gene effectively and with a wide range of application. Provided is an expression modulator for the Period gene comprising, as an active ingredient, one or more selected from the group consisting of arnica extract, nuphar extract, black... Agent: Shiseido Company, Ltd.

20130022693 - Plant extracts for treating neurodegenerative diseases: The invention relates to the use of bedstraw extracts that can be obtained by means of extracting using water or water-alcohol solvents or mixtures thereof, for producing a formulation, and for treating or preventing neurodegenerative diseases.... Agent:

20130022694 - Method for treating or relieving inflammatory bowel disease: A method for treating or relieving inflammatory bowel disease (IBD) is provided, including administering an extract of Bupleurum as an active ingredient to a subject. The Bupleurum may be selected from the group consisting of Bupleurum krylovianum, Bupleurum chinense, Bupleurum commelynoideum, Bupleurum scorzonerifolium, Bupleurum triradiatum, Bupleurum falcatum, Bupleurum kaoi and... Agent: Industrial Technology Research Institute

20130022695 - Bacterial extract for digestive or urinary tract disorders and process for its preparation: The present invention relates to an extract from bacterial strains useful as a treatment for disorders such as digestive or urinary tract disorders, compositions comprising the extract, and processes of making the extract from media that do not pose a risk of prion diseases.... Agent: Om Pharma

20130017148 - Systems for producing multilayered particles, fibers and sprays and methods for administering the same: Capsules and particles with at least one encapsulated and/or entrapped agent, such as therapeutic agent, imaging agents, and other constituents may be produced by electrohydrodynamic processes. More particularly, the agent encapsulated in a vehicle, capsule, particle, vector, or carrier may maximize treatment and/or imaging of malignant cancers while minimizing the... Agent:

20130017147 - Targeting agent for tumor site: It is an object of the present invention to provide a targeting agent, which enables the delivery of a drug to tumor sites or the imaging of tumor sites by utilizing its effect of accumulating to such tumor sites. The present invention provides a targeting agent for tumor site, which... Agent: Fujifilm Corporation

20130017149 - Pharmaceutical compounds:

20130017150 - Methods for prevention and treatment of acute renal injury: The disclosure relates to a method for protecting a kidney from renal injury. For example, acute renal injury may be associated with decreased or blocked blood flow in the subject's kidney or exposure to a nephrotoxic agent, such as a radiocontrast dye. The methods include administering to the subject an... Agent: Cornell University

20130017151 - Subsets of antigen-presenting cells (apcs) in the human vagina and their distinct functions: Compositions and methods for generating dendritic cell (DC)-targeting vaccines against vaginal infections, including but not limited to sexually transmitted diseases, are disclosed herein. The present invention reports the isolation of at least four major subsets of myeloid-originated antigen-presenting cells (APCs) that possess distinct phenotypes and functions in directing immune responses,... Agent: Baylor Research Institute

20130017152 - Method for the treatment of multiple sclerosis: A method for treating a subject with multiple sclerosis is disclosed herein. In one embodiment, a method is provided for treating a subject with multiple sclerosis that includes administering to the subject a therapeutically effective amount of an IL-21 receptor antagonist, wherein the subject has failed to respond treatment with... Agent: The Gov. Of The Usa As Represented By The Secretary Of The Dept Of Health And Human Services

20130017153 - Unit dosage of apadenoson: The present invention provides a unit dosage of Apadenoson, a pharmacological stress agent, and use of the same as a pharmacologic agent for myocardial perfusion imaging.... Agent: University Of Virginia Patent Foundation

20130017155 - Dual ct/mri nanoparticle contrast agent: The invention relates to a new tungsten-iron-Ferritin nanoparticle and uses thereof in imaging.... Agent:

20130017154 - Uniform fluorescent microsphere with hydrophobic surfaces: Fluorescent microspheres for the measurement of blood flow are provided. The microspheres are substantially uniform in diameter and have a hydrophobic surface, which allows them to circulate more freely throughout bloodstream, while reducing immunogenicity, particle aggregation and bioaccumulation. The hydrophobic surface on each microsphere is generally comprised of polymeric material... Agent: Life Technologies Corporation

20130017156 - Cefdinir and cefixime formulations and uses thereof: The invention features pharmaceutically acceptable salts of cefdinir, including primary, secondary, and tertiary amine salts of cefdinir, and preparation methods, and pharmaceutical compositions including cefdinir. The invention also features water dispersible pharmaceutical dosage forms including cefdinir as active agent and methods for preparing the dosages. The invention also features tablet... Agent:

20130017157 - Hair styling composition: The present invention is related to a hair styling composition for keratin fibres especially for hair comprising at least one film forming polymer and at least one dipeptide.... Agent: Kao Germany Gmbh

20130017159 - Novel composition: A dentifrice composition providing superior shine and polish, low RDA and effective whitening comprising a calcined aluminium oxide polishing agent, a water soluble condensed phosphate such as an alkali metal phosphate salt and an orally acceptable carrier or excipient is described. The composition is free of a silica abrasive.... Agent:

20130017158 - Oral care compositions comprising phytic acid: An oral care composition comprising a stannous ion source and/or a zinc ion source; a phytic acid or a phytic acid salt or mixtures thereof; characterised in that the phytic acid or phytic acid salt has an average IPn of greater than 5.2. In a composition which comprises stannous, there... Agent:

20130017160 - Thickening additive compositions: A thickening additive composition comprising: (A) a substantially anhydrous solvent system; and (B) a thickening agent, wherein the thickening agent comprises a strongly swellable, lightly to moderately crosslinked polyvinylpyrrolidone. Personal care compositions containing the thickening additive composition are also described.... Agent: Isp Investments Inc.

20130017162 - Cosmetic composition, cosmetic treatment method, kit, and compound: t

20130017161 - Cosmetic compositions with silicone resin polymers: A cosmetic composition containing a silicone resin polymer comprised of M units in combination with Q or T units or both, wherein the number of M units is greater than the number of Q units or T units or combination thereof, and a method for improving the finish of a... Agent: Revlon

20130017163 - Halogenated phenols for diagnostics, antioxidant protection and drug delivery: The present invention provides compositions and methods of their administration for the protection of cells and tissues from damage caused by FROS in the body of an individual. Compositions comprising halogenated phenol compounds are provided that scavenge or consume FROS in the body. These FROS scavenging compounds may not only... Agent:

20130017164 - Cosmetic dermatological composition, cosmetic treatment method, and hyaluronic acid derivative: The invention relates to a cosmetic or dermatological composition comprising a hyaluronic acid derivative which comprises ureidopyrimidone units, to the said derivatives and to a cosmetic treatment method using them.... Agent: L'oreal

20130017165 - Pure chlorine dioxide solution, and gel-like composition and foaming composition each comprising the same: A pure chlorine dioxide solution includes a chlorine dioxide gas dissolved therein, a chlorite, and a pH adjuster which is an acid or a salt thereof having a buffering property whose pH is 2.5 to 6.8 as a 5% aqueous solution at 25° C.... Agent: Taiko Pharmaceutical Co., Ltd.

20130017167 - Hydrophobic block conjugated therapeutic agents: Provided herein are polymers having a therapeutic agent covalently coupled to a hydrophobic block thereof, as well as micelles and therapeutic compositions thereof.... Agent: University Of Washington Through Its Center For Commercialization

20130017166 - Protein-poly(2-oxazoline) conjugates for enhanced cellular delivery and transport across biological barriers: The present invention provides polymer conjugates and methods of use thereof.... Agent: Board Of Regents Of The University Of Nebraska

20130017168 - Methods for enhancing the efficacy of il-2 mediated immune responses: Methods directed to enhancing the effectiveness of IL-2 in stimulating the immune system is disclosed. According to one method, an antagonist directed against the CD25 subunit of the high-affinity IL-2 receptor complex is administered in conjunction with IL-2. The CD25 antagonist may be an anti-CD25 antibody. According to another method,... Agent: Merck Patent Gmbh

20130017169 - Multimeric forms of therapeutic proteins and uses thereof: Multimeric protein structures are disclosed herein, as well a process for preparing same, and methods employing same for treating various diseases or disorders. The multimeric protein structures comprise at least two monomers of a therapeutic protein, including a TNF-alpha, a luteinizing hormone, an immunoglobin, a TNF-alpha receptor, a CTLA-4, a... Agent: Protalix Ltd.

20130017171 - Methods and compositions for treating hepatitis c virus: A method and composition for treating a host infected with hepatitis C comprising administering an effective hepatitis C treatment amount of a described 1′, 2′ or 3′-modified nucleoside or a pharmaceutically acceptable salt or prodrug thereof, is provided.... Agent: Idenix Pharmaceuticals, Inc.

20130017172 - Sensitization of chemotherapeutic agent resistant neoplastic cells with a virus: The present invention relates to a method of increasing the sensitivity of neoplastic cells to chemotherapeutic agents by using a virus, a method of treating proliferative disorders with a virus and chemotherapeutic agents, and a method for preventing a neoplasm from developing drug resistance to chemotherapeutic agents. The virus is... Agent: Oncolytics Biotech Inc.

20130017170 - Substituted pyrrolo-pyrazole derivatives as kinase inhibitors: Compounds represented by formula (Ia) or (Ib) and wherein R and R1 are as defined in the description, and pharmaceutically acceptable salts thereof, are disclosed; the said compounds are useful in the treatment of cell cycle proliferative disorders, e.g. cancer, associated with an altered cell cycle dependent kinase activity.... Agent: Nerviano Medical Sciences S.r.l.

20130017173 - Novel compositions and methods for treating inflammatory bowel disease and airway inflammation: Provided are compositions and methods for treating inflammation due to an immune response. Non-limiting example compositions include class-2 SPATE proteins that are capable of cleaving proteins involved in an inflammatory immune response in a patient. Example compositions include at least one mucin-cleaving class-2 SPATE protein. Further example compositions include protein... Agent:

20130017179 - Lineage-restricted neuronal precursors: A cell population has been identified and isolated that can differentiate into multiple neuronal phenotypes, but cannot differentiate into glial phenotypes. This mammalian CNS neuron-restricted cell expresses highly polysialated or embryonic neural cell adhesion molecule (E-NCAM) and is morphologically distinct from neuroepithelial stem cells (NEP cells) and spinal glial progenitors... Agent: University Of Utah Research Foundation

20130017174 - Compositions and methods for increasing health and reducing pathogenic bacteria in animals: Probiotic compositions comprising a bacterium that is capable of producing nitric oxide and a substrate of nitric oxide synthase are provided. Also provided are methods of improving the gastrointestinal health of a subject by orally administering a bacterium capable of producing nitric oxide and orally administering a substrate of nitric... Agent: The Board Of Trustees Of The University Of Arkansas

20130017181 - Lipid-metabolism-ameliorating agent: Methods for lowering serum triglycerides use pharmaceutical agents and food products that have no side effects, are easy to ingest continuously, and have a serum triglyceride-lowering effect are provided. The pharmaceutical agents and food products are lipid metabolism-ameliorating agents and serum triglyceride-lowering agents, which include as an active ingredient a... Agent: Calpis Co., Ltd.

20130017175 - Activated mesenchymal stem cells for wound healing and impaired tissue regeneration: Inflammatory cytokines e.g. IFN-γ, serve as initiating stimuli for mesenchymal stem cell (MSC) immunosuppresive activity in vivo. Other inflammatory cytokines, such as TNF alpha, the molecule hemoxygenase I, and TLR ligation of MSC, may also provide such a response. Activated MSC's promote tissue regeneration in conditions such as aging, where... Agent: The Board Of Trustees Of The University Of Illinois

20130017176 - Compositions comprising cardiac stem cells overexpressing specific micrornas and methods of their use in repairing damaged myocardium: The invention provides compositions comprising modified stem cells containing a transgene that affects the expression of at least one gene that inhibits or promotes cardiomyogenesis. In particular, the invention discloses compositions comprising cardiac stem cells, wherein said cardiac stem cells comprise a transgene encoding a microRNA. The compositions of the... Agent: New York Medical College

20130017177 - Photo-crosslinked gellan gum-based hydrogels: preparation methods and uses thereof: This invention refers to photo-crosslinked hydrogel materials based in gellan gum suitable for tissue engineering and regenerative medicine applications or as drug delivery systems. Formulations of gellan gum with different degrees of acylation serve as precursor material for insertion of a polymerizable moiety. The materials are capable of free radical... Agent:

20130017178 - Preparation created from an in vitro culture of dedifferentiated, non-elicited cells of the argania tree, use thereof for treating skin ageing, inflammation and scarring, and production thereof: The invention relates to a preparation created from an in vitro culture of dedifferentiated, non-elicited cells of the Argania tree.... Agent: Pierre Fabre Dermo-cosmetique

20130017180 - Platelet rich plasma formulations: Compositions for platelet rich plasma (PRP) and neutrophil-depleted PRP are provided. Methods for treating ischemia damaged tissues by delivering a PRP composition, in some embodiments a neutrophil-depleted PRP composition to the damaged tissue are provided. In some variations, the compositions may be useful to treat ischemic heart disease and repair... Agent:

20130017183 - Compositions containing non-polar compounds: Provided herein are compositions and methods for preparing foods and beverages that contain additives. Additives include nutraceuticals, pharmaceuticals, and supplements, such as essential fatty acids, including omega-3 fatty acids, omega-6 fatty acids, conjugated fatty acids, and other fatty acids; phytochemicals, including phytosterols; other oils; and coenzymes, including Coenzyme Q10, and... Agent:

20130017182 - Multi-criteria optimized dietary supplement formulations: Dietary micronutrient supplement formulations for specific ages, gender, special requirements and health conditions comprising, vitamins, minerals, fish and plant oils, amino acids, enzymes, phytochemicals, herb and fruit extracts and other natural compounds grouped into morning, mid-day and evening formulas based on their synergism and antagonism with each other, their interactions... Agent:

20130017184 - Stabilised solid compositions of factor vii polypeptides: The invention relates to chemically as well as physically stable compositions comprising Factor VII or a Factor VII-related polypeptide such that these compositions can be stored, handled and used at room temperature.... Agent: Novo Nordisk Healthcare A/g

20130017185 - Thermostable phytase variants: The present invention relates to a phytase which has at least 70% identity to a phytase derived from E. coli and comprises at least one modification as compared to this phytase. These phytase variants have modified, preferably improved, properties, such as thermostability, temperature profile, pH profile, specific activity, performance in... Agent: Novozymes A/s

20130017186 - Adherent antimicrobial barrier and sanitizing agent: Provided are viscous and adherent food-safe antimicrobial compositions, and methods for using same in the immediate and residual decontamination of microbial-contaminated substrate surfaces, in reducing or precluding cutting implement-mediated transfer of surface contamination during cutting operations in the food industry, and for reducing or preventing transfer of contamination from contaminated... Agent: Institute For Environmental Health, Inc.

20130017187 - Pharmacological composition whereby statin and coq10 compounds are enhanced: Disclosed is a pharmaceutical natural composition containing both statin compounds (mevinolin and mevinolinic acid) serving as cholesterol biosynthesis inhibitors and coenzyme Q (ubiquinone-10: CoQ10 and ubiquinone-9: CoQ9) compounds which are substances that inhibit factors causing complications such as myalgia involved in long-term use of the statin, prepared using Monascus sp.... Agent: Sungshin Women's University Industry-academic Cooperation Foundation

20130017189 - Functionalised triblock copolymers and compositions containing such polymers: Amphiphilic triblock copolymers B-A-B, wherein A is a linear poly(ethylene glycol) block, having a number average molecular weight (Mn) of between 900 and 3000 Daltons, determined with size exclusion chromatography; wherein B are hydrophobic blocks with at least two cyclic monomers selected from the group consisting of glycolide, lactide, 1,3-dioxan-2-one,... Agent: Ingell Technologies Holding B.v.

20130017191 - Immunoglobulin preparation and storage system for an immunoglobulin preparation: The present invention relates to an immunoglobulin preparation comprising immunoglobulin in a mass-volume percentage of at least 4%, wherein the concentration of oxygen dissolved in the preparation at room temperature is less than 40 μmol/l.... Agent:

20130017188 - Modulation of sgk1 expression in th17 cells to modulate th17-mediated immune responses: The inventors have made the surprising discovery that SGK1, a serine/threonine kinase previously described as being involved in regulation of cellular sodium homeostasis, has a novel and unexpected function in the differentiation and function of a specific subset of CD4 T cells, the TH17 lineage. Described herein are methods and... Agent: The Brigham And Women's Hospital, Inc.

20130017190 - Treatment of inflammatory diseases: The present invention relates generally to the field of inflammatory diseases of the peripheral nervous system. More particularly, it concerns methods for treating inflammatory diseases of the peripheral nervous system by modulating sphingosine-1-phosphate receptor activity. In one embodiment, the present invention provides a method of treating a subject with chronic... Agent:

20130017195 - Anti-folate receptor alpha antibodies and uses thereof: Described herein are antibodies, and antigen-binding fragments thereof, that are specific for folate receptor alpha, related polynucleotides, expression vectors, and cells that express the described antibodies. Also provided are methods of using the described antibodies, and antigen-binding fragments thereof, and related kits. Provided herein are also methods for diagnosing cancers,... Agent:

20130017193 - Antibody formulations: Formulations of VLA-4 binding antibody are described.... Agent: Biogen Idec Ma Inc.

20130017192 - Diagnosis and treatment of autoantibody-mediated heart disease: Provided herein are, inter alia, methods of diagnosing and treating autoimmune cardiomyopathy in subjects, based upon the detection of IgG4 autoantibodies to cardiac troponin I (cTnI).... Agent:

20130017194 - Fak inhibitors: o

20130017198 - Manipulation of calcium channels to regulate after-depolarization events in cardiac myocytes: A novel mechanism by which after-depolarization occurs in cardiac myocytes has been discovered, involving calcium influx through the arachidonate-regulated calcium channel (ARCC) and the store-operated calcium channel (SOCC). Because after-depolarization of the myocyte is a major cause of cardiac arrhythmia, this discovery provides new approaches for treating and preventing heart... Agent: The Uab Research Foundation

20130017197 - Stabilized antibody preparations and uses thereof: The present invention is directed to stabilized intact antibody formulations, related methods and uses thereof. In particular, the invention relates to a method of stabilizing an intact antibody in a liquid carrier.... Agent: Universite De Geneve

20130017196 - Substituted imidazole derivatives: The present invention relates to new substituted imidazole compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds. The compounds of the invention have the following general formula:... Agent:

20130017199 - Simultaneous inhibition of pd-l1/pd-l2: Methods and compositions for treating an infection or disease that results from (1) failure to elicit rapid T cell mediated responses, (2) induction of T cell exhaustion, T cell anergy or both, or (3) failure to activate monocytes, macrophages, dendritic cells and/or other APCs, for example, as required to kill... Agent: Amplimmune ,inc. A Corporation

20130017201 - Bispecific monoclonal antibody capable of cross reacting with lethal factor (lf) and edema factor (ef), and neutralizing edema toxin (et) as well as lethal toxin (lt) of bacillus anthracis: The present invention relates to a monoclonal antibody (mAb) having capabilities of binding with lethal factor (LF) as well as edema factor (EF), and neutralizing lethal toxin (LT) as well as edema toxin (ET) of B. anthracis. It also relates to process for preparation of said mAb, and to pharmaceutical... Agent:

20130017200 - Multispecific antibodies, antibody analogs, compositions, and methods: Multispecific antibodies that specifically bind at least two different epitopes are provided. Structural variants of native antibodies (antibody analogs) are also provided. Also provided are multispecific antibodies and antibody analogs having a range of biological activities. Agonist and antagonist multispecific antibodies and agonist and antagonist antibody analogs are provided. Multispecific... Agent: Genentech, Inc.

20130017204 - Genes of an otitis media isolate of nontypeable haemophilus influenzae: The invention relates to the polynucleotide sequence of a nontypeable stain of Haemophilus influenzae (NTHi) and polypeptides encoded by the polynucleotides and uses thereof. The invention also relates to NTHi genes which are upregulated during or in response to NTHi infection of the middle ear and/or the nasopharynx.... Agent: Nationwide Children's Hospital, Inc.

20130017205 - Inhibition of axl signaling in anti-metastatic therapy: Compositions and methods are provided for alleviating cancer in a mammal by administering a therapeutic dose of a pharmaceutical composition that inhibits activity of AXL protein activity, for example by competitive or non-competitive inhibition of the binding interaction between AXL and its ligand GAS6.... Agent:

20130017206 - Mcam modulation and uses thereof: Methods, uses, agents and compositions useful for the diagnosis, prevention and/or treatment of inflammatory conditions, such as neuroinflammatory conditions such as multiple sclerosis, and for the identification and selection of inflammatory cytokine-secreting T cell or a precursor thereof, based on the expression and/or modulation of melanoma cell adhesion molecule (MCAM)... Agent: Centre Hospitalier De L'universite De Montreal

20130017203 - Methods of treating and preventing staphylococcus aureus infections and associated conditions: The present invention relates to methods and compositions for preventing and treating Staphylococcus aureus in a subject. Therapeutic compositions of the present invention comprise leukocidin E and/or D proteins or polypeptides and anti-leukocidin E and/or D antibodies. The invention further relates to methods of identifying inhibitors of LukE/D cytotoxicity and... Agent: New York University

20130017202 - Pharmaceutical compositions and methods of treatment: e

20130017207 - Chemotherapeutic methods and compositions: Disclosed herein are methods and compositions for enhancing the cell-killing activity of anti-neoplastic agents by inhibiting the activity of a lysyl oxidase-type enzyme. Also disclosed are methods for screening for chemotherapeutic agents, and for molecules that enhance the activity of chemotherapeutic agents, using cells grown on an extracellular matrix.... Agent: Gilead Biologics, Inc.

20130017208 - Anti-il-6 antibodies, compositions, methods and uses: An anti-IL-6 antibody, including isolated nucleic acids that encode at least one anti-IL-6 antibody, vectors, host cells, transgenic animals or plants, and methods of making and using thereof have applications in diagnostic and/or therapeutic compositions, methods and devices.... Agent:

20130017209 - A-beta binding polypeptides: The invention relates to biparatopic A-beta binding polypeptides and, more specifically, to biparatopic A-beta binding polypeptides comprising at least two immunoglobulin single variable domains binding to different epitopes of A-beta. The invention also relates to specific sequences of such polypeptides, methods of their production, and methods of using them, including... Agent: Boehringer Ingelheim International Gmbh

20130017210 - Display of antibody fragments on virus-like particles of rna bacteriophages: The invention enables the display of antibody single-chain variable fragments (scFv's on virus-like particles (VLPs) of bacteriophages such as MS2. The VLPs encapsidate mRNA encoding the coat protein from which it assembles, enabling the recovery by reverse transcription and PGR of affinity-selected sequences from scFv libraries. Related virus-like particles, method... Agent: Stc.unm

20130017212 - Therapeutic use of the ß2m protein: The use of beta2-microglobulin (β2m) as active ingredient, in particular in pharmaceutical compositions intended for the treatment of autoimmune diseases.... Agent: Beta Innov

20130017211 - Use of beta-1,3 (4)-endoglucanohydrolase, beta-1,3 (4)-glucan, diatomaceous earth, mineral clay and glucomannan to augment immune function: A method for the augmentation of immune function is described. The invention comprises a combination of β-1,3 (4)-endoglucanohydrolase, β-1,3 (4)-glucan, diatomaceous earth, mineral clay and glucomannan, which is fed to or consumed by mammalian or avian species in amounts sufficient to augment immune function. The invention described may be admixed... Agent: Omnigen Research, LLC

20130017213 - Peptide analogues: Some embodiments relate to analogs of peptides corresponding to class I MHC-restricted T cell epitopes and methods for their generation. These analogs can contain amino acid substitutions at residues that directly interact with MHC molecules, and can confer improved, modified or useful immunologic properties. Additionally, classes of analogs, in which... Agent: Mannkind Corporation

20130017214 - Bacteremia-associated antigen from staphylococcus aureus: The BAA antigen of Staphylococcus aureus was identified in a highly bacteremic MRSA strain that has enhanced in vitro binding to fibronectin and other extracellular matrix proteins compared with other endemic and related strains. BAA is a phage-encoded surface-expressed adhesin which binds fibronectin in vitro. It may be responsible for... Agent: Guy's And St Thomas's Nhs Foundation Trust

20130017215 - Secreted campylobacter flagella coregulated proteins as immunogens: The invention relates to an immunogenic composition composed of secreted polypeptides derived from Campylobacter jejuni non-flagellar proteins that are coordinately expressed with the flagellar regulon. The invention also relates to a method of inducing an immune response to the non-flagellar protein polypeptides.... Agent:

20130017216 - Modified influenza virus for monitoring and improving vaccine efficiency: The immunogenicity of the influenza virus hemagglutinin (HA) molecule may be increased by substitutions of amino acids in the HA sequence. The substitution of specific HA residues, such as asparagine at position 223 of H5 HA, increase the sensitivity of the hemagglutinin inhibition (HI) assay by altering receptor specificity and/or... Agent: St. Jude Children's Research Hospital

20130017217 - Codon-optimized polynucleotide-based vaccines against human cytomegalovirus infection: The invention relates to plasmids operably encoding HCMV antigens, in which the naturally-occurring coding regions for the HCMV antigens have been modified for improved translation in human or other mammalian cells through codon optimization. HCMV antigens, which are useful in the invention include, but are not limited to pp65, glycoprotein... Agent: Vical Incorporated

20130017218 - Live bacterial vaccine safety: The present invention provides for a method of reducing the reactogenicity of live attentuated bacterial vaccines by deleting at least a portion (e.g., the TLR-5 stimulating domain of a flagellin protein) of at least one of the bacterial genes that encodes a flagellin from the bacterium genome. These vaccines are... Agent: The Brigham And Women's Hospital, Inc.

20130017219 - Purification of bacterial vesicles: A two stage size filtration process is used to purify immunogenic bacterial vesicles. A first step separates the vesicles from intact bacteria based on their different sizes, with the smaller vesicles passing into the filtrate (permeate). A second step then uses a finer filter to remove smaller contaminants, with the... Agent: Novartis Vaccines Institute For Global Health Srl

20130017220 - Gel vaccine delivery system for treating poultry: Safe and effective gel-bead vaccines for treating domesticated birds for diseases caused by cyst-forming protozoa, especially for coccidiosis.... Agent:

20130017221 - Primers for detecting plasmodium: The present invention provides an easy and rapid method for detecting/identifying the presence or absence of specific Plasmodium parasites and four species of malaria parasites in a human specimen, an anti-malaria measure support system, and a malaria infection-prevention/treatment system, which can contribute to practical diagnosis in a malaria endemic area.... Agent: Ehime University

20130017222 - Human prostate cell lines in cancer treatment: The invention provides methods and compositions for the treatment of primary, metastatic, and residual cancer in mammals, and more particularly, the use of materials such as whole cells and derivatives and portions thereof to stimulate the immune system to attack cancer.... Agent: Onyvax Limited, St. George's Hospital Medical School

20130017223 - Methods and compositions for delivery of nucleic acids: A lipid particle can include a plurality of cationic lipids, such as a first cationic lipid and a second cationic lipid. The first cationic lipid can be selected on the basis of a first property and the second cationic can be selected on the basis of a second property. The... Agent: Alnylam Pharmaceuticals, Inc.

20130017225 - Natural plant products for control of cancer metastasis: The invention provides compositions comprising soluble extracts or isolated polypeptides from the edible roots of the plant Colocasia, such as Colocasia esculenta, commonly known as Taro, and from Xanthosoma, such as Xanthosoma sagittifolium, commonly known as Malanga Blanca or Yautia. The compositions exhibit inhibitory effects on metastasis of cancer cells... Agent: University Of Maryland ,baltimore

20130017224 - Nucleic acid molecules encoding rantes, and compositions comprising and methods of using the same: Nucleic acid molecules comprising a nucleotide sequence encoding RANTES and fragments and variants thereof are disclosed. Additionally, nucleic acid molecules and compositions comprising the nucleotide sequence encoding RANTES and fragments and variants thereof in combination with nucleic acid sequences encoding immunogens are provided. Recombinant viral vectors comprising the nucleotide sequence... Agent:

20130017226 - Tnf-a and tweak dual antagonist for the prophylaxis and treatment of autoimmune diseases: The present invention relates to TNFR2-TWEAKR fusion protein, more precisely to TNFR2-TWEAKR fusion protein acting as a double-antagonist to TNF-α and TWEAK, known as major causes of autoimmune arthritis which is one of autoimmune diseases. When the composition comprising TNFR2-TWEAKR fusion protein was treated to Th17 cells, the secretion of... Agent: Korea Research Institute Of Bioscience And Biotechnology

20130017229 - Active scaffolds for on-demand drug and cell delivery: The invention provides a composition whose porosity, pore size, pore connectivity, swelling agent concentration, and/or specific volume undergoes a change from a first value to a second value in response to an electromagnetic signal, the composition having a matrix material in which is distributed a magnetic material.... Agent: President And Fellows Of Harvard College

20130017231 - Composition for forming a temporary intestinal occlusion in a mammal: The invention relates to a composition for forming a temporary intestinal occlusion in a mammal, said composition being flowable and solidifiable to form a solid plug at a predetermined site in the intestine, the structure of said plug being changeable to allow for a subsequent, at least partial removal of... Agent:

20130017234 - Implant modified with non-hydroxylated vitamin d precursors: An implant to be used as medical or dental implant, comprising a metallic or polymeric base which is covered by the vitamin D precursor cholecalciferol. The implant can be obtained by direct covering of the polymeric or metallic base with a solution comprising cholecalciferol or also covering the base with... Agent: Numat Biomedical S.l.

20130017230 - Jelly-form preparation and method for producing jelly-form preparation: Provided is a jelly preparation which enables easy intraoral dissolution thereof, easy adjustment of the dissolution time, and stable containment of a drug therein. The jelly preparation of the present invention is a jelly preparation including water, a gelatin, a drug, and a trivalent metal ion.... Agent: Nitto Denko Corporation

20130017228 - Methods and compositions for bone formation: A method and system to induce bone growth by locally delivering bone morphogenetic proteins (BMPs) to the target location for a prolonged period without invasive procedures are disclosed. The new bone growth is induced by delivering cells producing BMPs from transduced viral vectors to the target cite. In various embodiments,... Agent: Baylor College Of Medicine

20130017235 - Orally administered agent and an orally administered agent/supporting substrate complex: With an object of providing an orally administered agent (in particular a film-shaped orally administered agent) with which the ease and safety of taking the agent are improved, to attain this object, in an orally administered agent 1b having one drug-containing layer 11 and two water-swellable gel-forming layers 12, the... Agent: Lintec Corporation

20130017232 - Synthetic bone grafts: The disclosure provides Bone-mimetic mineral/polymer composite materials useful for formation of artificial bone grafts and for bone tissue engineering. The disclosure provides a hydrogels, cryogels and macroporous compositions modified with varying lengths of anionic pendant side chains (CH2═CHCONH(CH2)nCOOH, where n=1 to 12).... Agent: The Regents Of The University Of California

20130017233 - Tricalcium phosphate coarse particle compositions and methods for making the same: Methods for preparing a tricalcium phosphate coarse particle composition are provided. Aspects of the methods include converting an initial tricalcium phosphate particulate composition to hydroxyapatite, sintering the resultant hydroxyapatite to produce a second tricalcium phosphate composition and then mechanically manipulating the second tricalcium phosphate composition to produce a tricalcium phosphate... Agent:

20130017227 - Wound healing compositions and associated methods: In one embodiment, the present disclosure provides a composition including an aqueous solution comprising about 1% to about 50% weight/volume poloxamer having the general formula HO(C2H4O)a(C3H6O)b(C2H4O)aH, wherein a ranges from 12-101 and b ranges from 20-56, and a substrate. In another embodiment, the present disclosure provides a method of attaching... Agent:

20130017237 - Antiplaque oral care compositions:

20130017239 - Lipid nanoparticle capsules: A delivery system for active ingredients which comprises lipid nanoparticles, such as solid lipid nanoparticles (SLN) or nanostructured lipid carriers (NLC), polymerically coated, and their use in the preparation of pharmaceutical, cosmetic and/or alimentary compositions.... Agent: Lipotec S.a.

20130017238 - Oral care composition: Disclosed are oral care compositions, for example dentifrice compositions, comprising an orally acceptable vehicle, metal oxide particles having an average particle size of no greater than a dentin tubule and a polymeric adherent material for adhering the metal oxide particles in the dentin tubule. The metal oxide particles have a... Agent: Colgate-palmolive Company

20130017240 - Oral care composition: Disclosed are oral care compositions, for example dentifrice compositions, comprising an oral care composition comprising an orally acceptable vehicle, metal oxide particles having an average particle size of no greater than a dentin tubule and at least one amino acid capable of chelating the metal oxide. The composition may comprise... Agent: Colgate-palmolive Company

20130017236 - Toothpaste or tooth gel containing silver nano particles coated with silver oxide: Toothpaste or tooth gel containing silver nano particles coated with silver oxide as the active ingredient.... Agent:

20130017241 - Encapsulated chlorine dioxide generator: An encapsulated chlorine dioxide generator is provided. The encapsulated generator includes a core particle that includes a metal chlorite and a solid acid. The encapsulated generator also includes a protective layer that is disposed about at least a portion of the core particle. The protective layer includes a copolymer of... Agent: Basf Se

20130017242 - Articles and methods for applying antimicrobial protection: Among other things, there is disclosed an improved wet wipe or similar substrate for applying an antibacterial/antibiotic layer to surfaces or other items. A wipe substrate is impregnated with a solution in water of organo-functional silane-based molecule, such as 3-(trihydroxysilyl) propyldimethyloctadecyl ammonium chloride and/or octadecyldimethyl trimethoxysilylpropyl ammonium chloride. Packages of... Agent:

20130017244 - Sustained release intraocular implants and related methods: Biocompatible intraocular implants include a steroid and a polymer associated with each other to facilitate release of the steroid into an eye for a period of time greater than about two months. The steroid may be associated with a biodegradable polymer matrix, such as a matrix of a two biodegradable... Agent: Allergan, Inc.

20130017243 - Sustained-release reservoir implants for intracameral drug delivery: The present invention provides a sustained release implant for intraocular use to treat elevated intraocular pressure, which implant is configured for intracameral or anterior vitreal administration to a patient with elevated intraocular pressure (IOP), said implant comprising a core of an antihypertensive agent surrounded by a polymer, which limits the... Agent: Allergan, Inc.

20130017245 - Solid preparation: A solid preparation 1 comprises a drug-containing unit 2 containing a drug, and a gel-forming layer 4 for covering the drug-containing unit 2 and forming a gel by water absorption, and optionally an intermediate layer 3 interposed between the drug-containing unit 2 and the gel-forming layer 4. The solid preparation... Agent: Lintec Corporation

20130017246 - Switchable adhesives: The present invention provides switchable adhesives comprising a mixture, in proportions by weight, of 20% to 98% of an adhesive, 2% to 80% of curable molecules and 0.05% to 10% of photoinitiator in which the weight proportion of the adhesive is calculated on the basis of its dry weight and... Agent: Lumina Adhesives Ab

20130017251 - Antibody specific for apolipoprotein and methods of use thereof: The present disclosure provides synthetic antibodies specific for an epitope present on an apolipoprotein E polypeptide. The antibodies are useful in various treatment, diagnostic, and monitoring applications, which are also provided.... Agent:

20130017248 - Cationic liposomes and method of use: Highly efficient cationic liposomes are provided as a system for the delivery to cells of agents or compounds, such as, compounds capable of silencing a target protein and enzyme stubstrates. The cationic liposomes can be used in methods of detecting the inhibition activity or apparent activity of a target protein... Agent: Life Technologies Corporation

20130017249 - Compounds for targeting drug delivery and enhancing sirna activity: wherein the targeting molecule is a retinoid or a fat soluble vitamin having a specific receptor on the target cell; wherein m and n are independently 0, 1, 2 or 3; and wherein the linker comprises a polyethylene glycol (PEG) or PEG-like molecule, as well as compositions and pharmaceutical formulations... Agent:

20130017253 - Inducing cellular immune responses to human papillomavirus using peptide and nucleic acid compositions: This invention uses our knowledge of the mechanisms by which antigen is recognized by T cells to identify and prepare human papillomavirus (HPV) epitopes, and to develop epitope-based vaccines directed towards HPV. More specifically, this application communicates our discovery of pharmaceutical compositions and methods of use in the prevention and... Agent:

20130017252 - Method for selectively inhibiting the activity of acat1 in the treatment of alzheimer's disease: The present invention features methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating Alzheimer's disease by selectively inhibiting the activity of Acyl-CoA:Cholesterol Acyltransferase 1, but not Acyl-CoA:Cholesterol Acyltransferase 2.... Agent: Trustees Of Dartmouth College

20130017250 - Methods for high density lipoprotein cholesterol regulation: It was discovered that insulin binding to insulin receptors signals the upregulation of expression of the liver enzyme deiodinase 1 (Dio1), which in turn activates the ApoA-1 promoter, thereby thereby increasing ApoA-1 expression (primarily in the liver), that in turn raises the levels of plasma ApoA-1, the major and necessary... Agent: The Trustees Of Columbia University In The City Of New York

20130017247 - Treatment and/or prevention of oral allergic symptoms caused by oral contact with fruits and/or vegetables: Treatment or prevention of oral allergy syndrome, or other allergy-related oral inflammatory processes using a topical preparation of at least one of a mast cell stabilizer and an antihistamine is disclosed. For example, the topical administration of Cromolyn Sodium prior to ingestion of raw fruits and raw vegetables may be... Agent:

20130017256 - Methods of treating hypertriglyceridemia: In various embodiments, the present invention provides methods of treating and/or preventing cardiovascular-related disease and, in particular, a method of blood lipid therapy comprising administering to a subject in need thereof a pharmaceutical composition comprising eicosapentaenoic acid or a derivative thereof.... Agent: Amarin Pharmaceuticals Ireland Limited

20130017254 - Pharmaceutical formulation containing phenytoin sodium and magnesium stearate: The present invention relates to a novel pharmaceutical formulation comprising phenytoin sodium, a high amount of magnesium stearate, and a low level of a hydrophilic polymer such as a methocel, and a method of preparing the same by blending.... Agent: Taro Pharmaceuticals North America, Inc.

20130017255 - Tamper resistant dosage form comprising an adsorbent and an adverse agent: Pharmaceutical compositions and dosage forms comprising an adsorbent, and an adverse agent, such as an opioid antagonist. In one embodiment, at least a portion of the adverse agent is on the surface or within the micropore structure of an adsorbent material. The pharmaceutical compositions and dosage forms comprising the adsorbent... Agent:

20130017257 - Dry powder formulation containing tiotropium for inhalation: The present invention is related to a dry powder formulation containing tiotropium to be administered via inhalation, the use of said formulation in the treatment of respiratory diseases especially asthma and COPD (Chronic obstructive pulmonary disease), and the production process of said formulation.... Agent:

20130017258 - Self-microemulsifying mitotane composition: The invention relates to a self-microemulsifying drug delivery system (“SMEDDS”) of mitotane, with enhanced bioavailability. More particularly the invention provides a mitotane oily formulation comprising propylene glycol monocaprylate (10 to 30% w/w), propylene glycol dicaprate (20 to 60% w/w) and polyoxyethylenesorbitanne monooleate (10 to 30% w/w).... Agent:

20130017259 - Compositions and methods for treatment of symptoms in parkinson's disease patients: The invention provides dosage forms and methods utilizing nicotine to treat symptoms of a neurologic disorder. In some embodiments, the invention provides compositions for treatment of gait and balance problems associated with Parkinson's Disease.... Agent: The Parkinson's Institute

20130017260 - Oral pharmaceutical formulations for the treatment of human canities: The present application relates generally to oral pharmaceutical formulations for the treatment of human canities.... Agent:

20130017261 - Use of lactobacillus for treatment of virus infections: The present invention relates to the use of at least one strain of probiotic bacteria selected from Lactobacillus for the manufacture of a pharmaceutical composition for the treatment and/or prevention of a virus infection.... Agent: Probi Ab

20130017262 - Immediate/delayed drug delivery: In one aspect, the present invention is concerned with a treatment where it is desired that an active agent is designed to be released immediately following administration and again at a time point some time after administration of the active agent. The present invention is particularly suited to administering an... Agent: University Of Strathclyde

20130017263 - Gastric acid secretion inhibiting composition: An oral pharmaceutical dosage form comprises pharmacologically effective amounts of an acid-susceptible proton pump inhibitor and an H2 receptor antagonist in combination with at least on pharmacologically acceptable excipient which causes a delayed release and/or an extended release of the proton pump inhibitor. The H2 receptor antagonist is included in... Agent: Orexo Ab

20130017264 - Alginate tube drug delivery system and method therefor: A drug delivery system which comprises alginate tube that is prepared by coating a substrate with alginate gel. One or more therapeutic drugs may also be present in the alginate gel or in the cavity of the tube. The activity of the alginate drug delivery system is highly adjustable so... Agent: Piramal Life Sciences Limited

20130017267 - Method of making particles for use in a pharmaceutical composition: The invention relates to a method for making composite active particles for use in a pharmaceutical composition for pulmonary administration, the method comprising a milling step in which particles of active material are milled in the presence of particles of an additive material which is suitable for the promotion of... Agent: Vectura Limited

20130017265 - Particles for multiple agent delivery: Delivery compositions are provided that include two or more active agents, wherein at least one active agent is conjugated to a polymer. The delivery compositions allow for controlled release of multiple active agents, including active agents with varying solubility, charge, and/or molecular weight.... Agent: The Brigham And Women's Hospital, Inc.

20130017266 - Radiation therapy agent: Provided is a radiotherapeutic agent, including a composite particle, which is obtained by binding a molecule that specifically recognizes a target to a substrate particle including titanium peroxide, and which generates reactive oxygen through irradiation with a radiation. Further, because the radiotherapeutic agent contains the molecule that specifically recognizes a... Agent: National University Corporation Kobe University

20130017268 - Prostaglandin and prostamide drug delivery systems and intraocular therapeutic uses thereof: Biocompatible, bioerodible implants and microspheres include latanoprost and a biodegradable polymer effective, when placed intraocular (such as into the subtenon space) to treat glaucoma.... Agent: Allergan, Inc.

20130017269 - Diane's manna: This is a potent drug with narcotic benefits made from distinctly and uniquely combined and processed interchangeable seed and seed derivatives that are so potent that it removes or alleviates depression, mood disorders, Attention Disorder symptoms, thought disorder, mental illness, pain, right lip retardation symptoms, physical problems, Lymph Node cancer... Agent: Children's Fund

20130017270 - Fenton reaction catalyst using coffee grounds or tea dregs as raw material: A Fenton reaction catalyst including a reaction product as an active component, in which the reaction product is obtained by using roasted and ground coffee beans (in particular, coffee grounds) or tea leaves (in particular, tea dregs) as feedstocks for supplying a component having a reduction effect, and mixing the... Agent:

20130017271 - Micronized copper-containing compositions useful to mitigate residues on wood surfaces: Disclosed is a wood preservative composition comprising micronized copper and copper-amine complex, wherein the copper component of the copper amine complex is from about 5% to about 50% by weight, based upon the total weight of copper in the composition. The copper amine complex serves to avoid wood surface “chalking”... Agent:

20130017273 - Compounds useful as inhibitors of atr kinase: s

20130017272 - Method for treating non-small cell lung cancer: A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has... Agent:

20130017274 - Low dose lithium in the treatment or prophylaxis of parkinson's disease: In various embodiments methods of delaying the onset of and/or mitigating the severity of one or more symptoms of Parkinson's disease in a mammal are provided. In certain embodiments the methods involve administering to a mammal diagnosed as having or as at risk for Parkinson's disease a chronic low dose... Agent: Buck Institute For Research On Aging

20130017275 - Herbal medicinal composition and extract thereof for inhibiting growth of cancer cells: The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae fructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2SO4, and Atractylodis Rhizoma. The residual examples are described... Agent:

20130017276 - Composition, and method of using the composition, effective for minimizing the harmful effects associated with individuals suffering from alcohol intoxication: The present invention relates to a composition, and methods of using the composition, for minimizing the harmful effects associated with alcohol consumption. The composition includes a plurality of ingredients, which when combined, have the unexpected effect of increasing one or more metabolic pathways in the individual. As the metabolic rate... Agent:

20130017277 - Conversion of nitrogen dioxide (no2) to nitric oxide (no): Inhalation of low levels of nitric oxide can rapidly and safely decrease pulmonary hypertension in mammals. A nitric oxide delivery system that converts nitrogen dioxide to nitric oxide employs a surface-active material, such as silica gel, coated with an aqueous solution of antioxidant, such as ascorbic acid.... Agent:

20130017278 - Composition and method for improving brain function: A composition and method for improving and maintaining brain function wherein the composition comprises an effective amount of coconut oil and an effective amount of medium-chain triglycerides. The medium-chain triglycerides and coconut oil may be mixed in a ratio of between 90% medium-chain triglycerides to 10% coconut oil and 40%... Agent:

20130017279 - Formulations for treatment of skin disorders: The Present Invention teaches herbal formulations based on a non-aqueous extract of wrightia tinctoria and an extract of cocos nucifera, which, when applied topically and used as directed in therapeutically effective amounts, have been clinically proven to be safe and effective for people needing treatment for skin conditions such as... Agent: Apptec, Inc.

20130017280 - Composition for accelerating change in muscle type: The present invention provides a composition for accelerating a change in muscle type, increasing the amount of muscle, strengthening muscle, enhancing athletic abilities, reducing lipids, suppressing the accumulation of lipids, lowering blood sugar, controlling body weight or lowering body weight, containing a PPAR-δ promoter, an AMPK promoter and a PGC1-α... Agent: Amorepacific Corporation

20130017281 - Natural composition for killing parasites on a companion animal: The present invention relates to a method for killing parasites that includes topically applying onto a companion animal a composition including a natural, non-synthetic active ingredient. The composition may be applied to the animal in various forms, such as a spot-on, shampoo, an on animal spray, or an on animal... Agent: Sergeant's Pet Care Product, Inc.

20130017282 - Pain relieving composition: A pain relieving composition that includes an anesthetic in the range of 0.5%-7.0% by weight (“w/w”), an anti-inflammatory agent in the range of 1.0%-11.0% w/w, a moisturizing agent in the range of 0.5%-12.0% w/w, a humectant in the range of 0.5%-13.0% w/w, a penetration enhancing agent in the range of... Agent:

20130017283 - Compositions and methods for modulating metabolic pathways: Compositions and methods useful for inducing an increase in fatty acid oxidation or mitochondrial biogenesis, reducing weight gain, inducing weight loss, or increasing Sirt1, Sirt3, or AMPK activity are provided herein. Such compositions can contain synergizing amounts of a sirtuin-pathway activators, including but not limited to resveratrol, in combination with... Agent:

20130017284 - Compositions and methods for modulating metabolic pathways: Compositions and methods useful for inducing an increase in fatty acid oxidation or mitochondrial biogenesis, reducing weight gain, inducing weight loss, or increasing Sirt1, Sirt3, or AMPK activity are provided herein. Such compositions can contain synergizing amounts of a sirtuin-pathway activators, including but not limited to resveratrol, in combination with... Agent:

20130017285 - Compositions and methods for treating hair loss: Provided are compositions containing a unique combination of vitamin B1, vitamin B6, vitamin B12, folic acid, magnesium glycinate, ferric glycinate, L cysteine, biotin, Polygonum multiflorum, and Emblica officinalis. Methods of increasing hair volume in a subject by administering to the subject a composition containing vitamin B1, vitamin B6, vitamin B12,... Agent:

20130017286 - Pomegranate based skin protectant and topical application: A cosmetic composition is provided having ingredients that may prevent signs or conditions of aging and/or damage in skin, improve the aesthetic appearance of skin, and promote recovery from environmental stresses. The composition includes natural ingredients, including pomegranate juice concentrate; pomegranate extract; pomegranate seed oil; and at least one pharmaceutically... Agent:

20130011332 - Frozen compositions and methods for piercing a substrate: Certain embodiments disclosed herein relate to compositions, methods, devices, systems, and products regarding frozen particles. In certain embodiments, the frozen particles include materials at low temperatures. In certain embodiments, the frozen particles provide vehicles for delivery of particular agents. In certain embodiments, the frozen particles are administered to at least... Agent: Searete LLC,

20130011333 - Methods and compositions for nanoparticle-mediated cancer cell-targeted delivery: The present invention provides methods and compositions to selectively and directly deliver nanoparticles carrying an active agent to tumor cells. The active agent is internalized by the tumor cells, producing an anti-tumor effect for therapeutic applications and/or depositing a detectable marker for diagnostic applications. The present invention further provides a... Agent: Board Of Regents, The University Of Texas System

20130011335 - Materials and methods related to sodium/potassium adenosine triphosphate and src: This invention is based in part on the elucidation of new structural conformations and functions of the sodium/potassium adenosine triphosphate synthase (Na/K ATPase), and especially elucidation of new binding sites and interactions. The present invention provides practical applications of several surprising structural and functional relationships between Na/K ATPase and compounds... Agent: University Of Toledo

20130011334 - Modified ubiquitin proteins having a specific binding activity for the extradomain b of fibronectin: The present invention refers to novel hetero-multimeric proteins obtained from modified ubiquitin capable of binding the extradomain B of fibronectin (ED-B) with high affinity. Furthermore, the invention refers to fusion proteins comprising said recombinant protein fused to a pharmaceutically and/or diagnostically active component. The invention is further directed to the... Agent:

20130011336 - Imaging agents of fibrotic diseases: Agents and methods for imaging a cell and/or a portion of tissue characterized by fibrosis, as well as to agents and methods for determining and/or diagnosing fibrotic diseases are disclosed herein. Also disclosed herein are polymer conjugates that can include a detectable label, a retinoid and a polymer. The polymer... Agent: Nitto Denko Corporation

20130011339 - Nanoparticle compositions comprising a lipid bilayer and associated methods: Bilayer-nanoparticle compositions comprising a nanoparticle core and a lipid bilayer disposed around the exterior surface of the nanoparticle core are provided. In some embodiments, these bilayer-nanoparticle compositions may be dispersed in an aqueous solution. Associated methods are also provided.... Agent:

20130011338 - Cupredoxin derived transport agents and methods of use thereof: The present invention discloses methods and materials for delivering a cargo compound into a cancer cell. Delivery of the cargo compound is accomplished by the use of protein transduction domains derived from cupredoxins. The invention further discloses methods for treating cancer and diagnosing cancer.... Agent: The Board Of Trustees Of The University Of Illinois

20130011340 - Compositions and methods comprising magnetic resonance contrast agents: The present invention relates to compositions and methods for imaging with magnetic resonance contrast agents. In particular, the present invention provides targeted contrast agents for selective imaging.... Agent: Northwestern University

20130011337 - Therapeutic agent and diagnostic agent for mitochondrial dysfunction brain diseases: wherein R1 and R2 each independently represents a hydrogen atom, an alkyl group, an acyl group, an alkoxycarbonyl group, an aryl group, or an aralkyl group; and R3 represents a hydroxy group, an alkoxy group, an acyloxy group, an alkoxycarbonyloxy group, an aryloxy group, an aralkyloxy group, or an amino... Agent: Sbi Pharmaceuticals Co., Ltd.

20130011341 - Compressed gas aerosols with enhanced intensity and longevity of actives: Aerosol compositions propelled by compressed gas providing enhanced intensity of one or more active components (e.g., fragrance, malodor counteractant, insecticide, disinfectant, or antimicrobial) over an extended period of time in the environment of use consistently over the life of the product. This is provided by a selected combination of spray... Agent:

20130011342 - Surfactant-free, water-free formable composition and breakable foams and their uses: A substantially surface active agent-free and foam adjuvant-free composition which includes a hydrophobic solvent, a wax and a propellant. A substantially surface active agent-free and foam adjuvant-free composition, further comprising, a tetracycline antibiotic, or one or More other active agents. A method of treatment, using a substantially surface active agent-free... Agent: Foamix Ltd.

20130011343 - Chewing gum having sustained release of nicotine: The present invention relates to a chewing gum having a high Surface Area to Volume ratio (SAV ratio), wherein said chewing gum comprises a water insoluble gum base matrix, a water soluble bulk portion and nicotine, wherein the gum base matrix, nicotine and the bulk portion are mixed and extruded... Agent: Fertin Pharma A/s

20130011344 - Use of iminocyclitols as inhibitors of bacterial adherence to epithelial cells: It comprises the use of D-fagomine or derivatives thereof in the prevention and/or coadjuvant treatment of bacterial infections, as well as to pharmaceutical, veterinary, or food and feed, pet food compositions containing them.... Agent: Bioglane

20130011345 - Flavor-enhancing amide compounds:

20130011350 - Metal oxide particles aftertreated with organic phosphorus compounds: The invention relates to metal oxide particles and/or metal hydroxide particles, aftertreated with an organic phosphorus compound, process for the preparation thereof, and compositions comprising same.... Agent: Merck Patent Gmbh

20130011348 - Oil-in-water type emulsion sunscreen cosmetic composition: Disclosed is an oil-in-water type emulsion sunscreen cosmetic composition which has improved ultraviolet blocking capability by containing a large amount of an ultraviolet absorbent, while having excellent emulsion stability and good usability. Specifically disclosed is an oil-in-water type emulsion sunscreen cosmetic composition which is characterized by containing (A) 1-7.5% by... Agent:

20130011347 - Personal care compositions with improved solubility of a solid cosmetic active: s

20130011346 - Personal care compositions with improved solubility of a solid uv active: wherein R′ and R″ are independently selected from a straight or branched C1-30 chain, which may be saturated or unsaturated. The composition may further comprise a solid UV active soluble in the isosorbide diester and a dermatologically acceptable carrier. The personal care composition may be in the form of an... Agent:

20130011349 - Topical formulations containing palm pollen: Compositions are provided that include date palm pollen or an extract thereof. The compositions may be formulated for topical use in methods of treatment or prophylaxis of various skin conditions or methods to counteract the effects of skin aging.... Agent:

20130011351 - Antimycotic pharmaceutical composition: In a pharmaceutical composition for external use containing a compound such as luliconazole and/or a salt thereof in an amount of 5% by mass or more, comprised is/are acetone, a polyoxyethylene alkyl (having 8 to 30 carbon atoms) ether, and/or a polyoxyethylene alkenyl (having 8 to 30 carbon atoms) ether.... Agent: Nihon Nohyaku Co., Ltd.

20130011353 - 2-hydroxy-6-methyl-heptane derivatives as perfuming ingredients: in the form of any one of its stereoisomers or a mixture thereof, and wherein R1 represents a hydrogen atom, a C1-4 alkyl or alkenyl group, or a (CHR)2OH group, each R being a hydrogen atom or a methyl group; R2 represents a hydrogen atom or a methyl, ethyl or... Agent: Firmenich Sa

20130011352 - Organic carbonates with vanilla odor:

20130011354 - Compositions for enhancing hair growth: Methods and compositions for stimulating the growth of hair are disclosed wherein emulsions include a cyclopentane heptanoic acid, 2-cycloalkyl or arylalkyl compound represented by the formula I wherein the dashed bonds represent a single or double bond which can be in the cis or trans configuration, A, B, Z, X,... Agent: Allergan, Inc.

20130011355 - N-acyl basic amino acid dispersion: t

20130011360 - Cosmetic composition comprising at least one organic silicon compound, at least one anionic surfactant and at least one aminated silicone as well as a method employing said composition: The present disclosure relates to cosmetic compositions for washing and conditioning keratin fibers, such as human keratin fibers, for example, the hair, comprising in a cosmetically acceptable medium: i) at least one organic silicon compound chosen from silanes comprising one silicon atom and siloxanes comprising two or three silicon atoms,... Agent: L'oreal S.a.

20130011359 - Solid or powder hair styling composition: The object of the present invention is to provide a hairdressing that is used on towel-dried wet hair after hair washing, not a conventional liquid, paste, or cream hairdressing but a solid or powder hairdressing that contains none or a drastically reduced amount of ethanol or water, which is a... Agent:

20130011356 - Hair-binding peptides: Hair-binding peptides were isolated for their use in a variety of personal care formulations and applications. The isolation of hair-binding peptides was accomplished by enrichment using mRNA-display selection technology. Hair care compositions comprising peptide-based reagents prepared comprising the hair-binding peptides are also provided.... Agent: E I Du Pont De Nemours And Company

20130011358 - Cleansing composition: wherein R1 is a saturated or unsaturated, straight or branched alkyl chain with 7 to 17 C atoms, R2 is H or a methyl, R3 is H, COO−M+, CH2COO−M or COOH, n is 0 to 2, X is COO− or SO3− and M is independent from each other H, sodium... Agent: Kao Germany Gmbh

20130011357 - Conditioning composition for hair: The present invention is related to aqueous conditioning composition for hair comprising at least one silicone compound with multiple quaternary ammonium groups in its molecule and at least one additional silicone compound which is different from the former one. Conditioning composition of the present invention can be in the form... Agent: Kao Germany Gmbh

20130011361 - Pyrazole derivatives which modulate stearoyl-coa desaturase: The present invention provides heterocyclic derivatives of formula (I) that modulate the activity of stearoyl-CoA desaturase. Methods of using such derivatives to modulate the activity of stearoyl-CoA desaturase and pharmaceutical compositions comprising such derivatives are also encompassed.... Agent: Novartis Ag

20130011362 - Targeting monomers and polymers having targeting blocks: Provided herein are monomers incorporating folate or other targeting agent, polymers prepared therefrom, polymers prepared therefrom having a therapeutic agent covalently coupled thereto, as well as micelles and therapeutic compositions thereof.... Agent: University Of Washington Through Its Center For Commercialization

20130011363 - Cationic betaine precursors to zwitterionic betaines having controlled biological properties: Cationic polymers hydrolyzable to zwitterionic polymers, monomers for making the cationic polymers, surfaces that include the polymers, therapeutic agent delivery systems that include the cationic polymers, methods for administering a therapeutic agent using the delivery systems, and methods for making and using the cationic polymers, monomers, surfaces, and therapeutic agent... Agent: University Of Washington

20130011364 - Molecularly imprinted polymers for eliminating metabolites: The present invention relates to polymers imprinted by retention solutes, use of same as well as compositions containing same.... Agent:

20130011365 - Parp inhibitor compounds, compositions and methods of use: The present invention relates to tetraaza phenalen-3-one compounds which inhibit poly (ADP-ribose) polymerase (PARP) and are useful in the chemosensitization of cancer therapeutics. The induction of peripheral neuropathy is a common side-effect of many of the conventional and newer chemotherapies. The present invention further provides means to reliably prevent or... Agent: Eisai Inc.

20130011366 - Therapeutic agent for infections, and treatment method using the same: The present invention provides a therapeutic agent for infections comprising as active ingredient: 15K granulysin, a combination of 15K granulysin and 15K granulysin in vivo expression vector, a combination of 15K granulysin and at least one interleukin selected from IL-6, IL-23 or IL-27, a combination of 15K granulysin in vivo... Agent: National Hospital Organization, Kinki-chuo Chest Medical Center (27%)

20130011367 - Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis: Isolated polynucleotide sequences exhibiting endothelial cell specific promoter activity, novel cis regulatory elements and methods of use thereof enabling treatment of diseases characterized by aberrant neovascularization or cell growth are disclosed.... Agent: Vascular Biogenics, Ltd.

20130011372 - Inactivated microorganisms containing double -strand rna molecules (dsrna), their use as pesticides and methods for their preparation: The present invention relates to a new group of pesticides consisting of inactivated microorganisms containing double-strand RNA molecules (dsRNA), corresponding to receptor genes coupled with G proteins (GPCR) whose functioning is vital for phytophagous invertebrates (insects, mites and molluscs) or for infesting or in any case harmful organisms for the... Agent: Arterra Bioscience S.r.l

20130011373 - Side population cells in cardiac repair: It has been discovered that side-population cells induce cardiac tissue repair of infarcted myocardium. Provided herein are methods directed to treatment of cardiac injury using side-population cells.... Agent: The Trustees Of Columbia University In The City Of New York

20130011368 - Metabolically active micro-organisms and methods for their production: The invention relates to a preparation of metabolically active bacteria, compositions comprising such a preparation, e.g., probiotic supplements or animal feeds, and to uses thereof, for example in the treatment of diseases affecting the intestinal microbial balance. Also described are a growth substrate for microorganisms comprising a mixture of complex... Agent:

20130011374 - Growth inhibition of microorganisms by lactic acid bacteria: The present invention relates to growth inhibition of microorganisms by lactic acid bacteria. The present invention also relates to the reduction and/or treatment of food-borne pathogen infections and/or nosocomial infections. The present invention also relates to the inhibition of spoilage microorganisms in food products. The present invention further relates to... Agent: Bio-k Plus International Inc.

20130011369 - Method for prevention and treatment of salmonella infection: The present invention relates to a composition comprising bacteriophage SP-1, the bacteriophage capable of destroying Salmonella once being infected in Salmonella, as an active ingredient, and a method for prevention and treatment of Salmonella infection using the same. Bacteriophage SP-1, the active ingredient of the composition of the present invention,... Agent: Intron Biotechnology, Inc.

20130011370 - Uniform field magnetization and targeting of therapeutic formulations: Systems and methods for magnetic targeting of therapeutic particles are provided. Therapeutic particles comprise one or more magnetic or magnetizable materials and at least one therapeutic agent. Therapeutic particles are specifically targeted using uniform magnetic fields capable of magnetizing magnetizable materials, and can be targeted to particular locations in the... Agent: The Children's Hospital Of Philadelphia

20130011371 - Establishment of patient- or person- specific cardiac myocyte cell lines from human induced pluripotent stem cells (ipscs): A composition and method for generating patient- or person-specific proliferative and substantially pure cardiac myocyte cell lines from pluripotent stem cells (iPSCs) is described herein. The patient-specific cardiac myocyte cell lines of the present invention find applications in research, drug screening and autologous cell-based therapy. The method of the present... Agent: Baylor Research Institute

20130011376 - Methods for enhancing natural killer cell proliferation and activity: Methods of ex-vivo culture of natural killer (NK) cells are provided and, more particularly, methods for enhancing propagation and/or functionality of NK cells by treating the cells with a nicotinamide or other nicotinamide moiety in combination with cytokines driving NK cell proliferation. Also envisioned are compositions comprising cultured NK cells... Agent: Gamida Cell Ltd.

20130011375 - T cell receptors specific for immunodominant ctl epitopes of hcv: The present invention relates generally to the field of immunology. More particularly, aspects of the invention concern the discovery of several T cell receptors (TCRs) that are specific for an immunodominant CTL epitope of hepatitis C virus (HCV). Embodiments include TCRs, DNAs encoding TCRs, methods of making TCRs, and methods... Agent: Chrontech Pharma Ab

20130011377 - Compositions, kits and methods for nutrition supplementation: The present invention relates to compositions, kits and methods for the administration of various vitamin, mineral and nutrient compositions, and in a specific embodiment, the compositions, kits and methods may utilize or include vitamin D, iodine, vitamin B1, vitamin B6, vitamin B12, vitamin B2, vitamin B9, vitamin B3, vitamin E,... Agent: Chemo S.a. France

20130011378 - Stable formulations of a hyaluronan-degrading enzyme: Provided are compositions that are stable formulations of a hyaluronan-degrading enzyme or are stable co-formulations of a fast-acting insulin and a hyaluronan degrading enzyme, including a recombinant human PH20 (rHuPH20).... Agent:

20130011379 - Pyridoxamine for the treatment of diabetic kidney disease: The present invention provides pharmaceutical compositions comprising dosage units of pyridoxamine, or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable carrier, and methods for their use in limiting the progression of renal disease and/or diabetic complications in human diabetic patient.... Agent: Nephrogenex, Inc.

20130011380 - Use of cytidine deaminase-related agents to promote demethylation and cell reprogramming: Methods, compositions and kits for modulating demethylation in a mammalian cell are provided. Also provided are methods, compositions and kits for screening candidate agents for activity in modulating genomic DNA demethylation in mammalian cells. These methods, compositions and kits find use in producing induced pluripotent stem cells (iPS) and somatic... Agent:

20130011381 - Modified enzyme treatment method: Disclosed is a method for the treatment of lysosomal storage disease in mammals wherein the mammal is administered a therapeutically effective amount of an isolated, modified recombinant β-glucuronidase whereby said storage diseased disease is relieved in the brain and visceral organs of the mammal. There is also disclosed an isolated,... Agent: Saint Louis University

20130011382 - Fibrinogen preparations enriched in fibrinogen with an extended alpha chain: The present invention relates to fibrinogen preparations enriched in α-extended fibrinogen. Compositions comprising such preparations show improved clotting properties compared to preparations based on HMW Fib which typically contain no or only low amounts of α-extended fibrinogen. In particular, clot formation time and the clot strength of a clot made... Agent: Profibrix Bv

20130011383 - Compositions and methods for the treatment of asthma: Compositions and methods for the treatment of asthma may be prepared by drilling a hole in a coconut, adding about 1/4 pound of brown sugar (piloncillo) to an inside of the coconut, plugging the hole, wrapping the coconut in plastic, and allowing the coconut water and its contents to ferment... Agent:

20130011384 - Use of a material, produced from fungal fermentation, as a food supplement: The invention relates to the use of a material produced from fermentation of an organic substrate by at least one fungal microorganism belonging to the Monascus genus, for manufacturing a food supplement composition for reducing methane production in ruminants.... Agent:

20130011386 - Active protease-resistant antibody fc mutants: The present invention relates to modified Fc-containing molecules including modified antibodies characterized by increased resistance to host and pathogen-derived proteases, ability to interact with FcγR receptors except with FcγRI, and lack of induction of IL-10 secretion by macrophages, and methods of using and making them.... Agent:

20130011388 - Intravenous immunoglobulin composition: A concentrated, immunoglobulin composition for treating subjects vaccinated against or infected with a pathogenic microorganism, is made by (a) selecting a population of individuals previously vaccinated against antigens associated with the pathogenic microorganism; (b) identifying very high titre individuals by determining the level of specific antibodies immunoreactive with the pathogenic... Agent: Omrix Biopharmaceuticals Ltd.

20130011387 - Systems and methods for obtaining immunoglobulin from blood: The present disclosure relates generally to systems for obtaining a pharmaceutically acceptable immunoglobulin from blood of a donor comprising a first conduit configured to convey blood from the donor to a substrate, wherein said blood includes at least one first component and at least one second component, said first component... Agent: Baxter International Inc.

20130011385 - Transparent bacterial cellulose nanocomposite hydrogels: A transparent polymeric nanocomposite hydrogel is provided, wherein the polymeric nanocomposite hydrogel is made from a water insoluble polymer, i.e. poly(2-hydroxyethyl methacrylate) (PHEMA) or/and crosslinked PHEMA and a water insoluble nanofiber, i.e., bacterial cellulose (BC). Disclosed is a synthetic route for polymeric nanocomposites hydrogels. The preferred polymeric nanocompositions are produced... Agent: Axcelon Biopolymers Coproration

20130011391 - Anti-psgl-1 antibodies and uses thereof: Provided herein, in one aspect, are antibodies that immunospecifically bind to PSGL-1, polynucleotides comprising nucleotide sequences encoding such antibodies, and expression vectors and host cells for producing such antibodies. Also provided herein are kits and pharmaceutical compositions comprising antibodies that specifically bind to PSGL-1, as well as methods of treating... Agent: Abgenomics Cooperatief U.a.

20130011393 - Bad pathway gene signature: The invention provides materials and methods for prognosing cancer, and predicting an individual's responsiveness to cancer treatments, methods of treating cancer, and materials and methods for obtaining BAD pathway gene expression profiles useful in carrying out the methods of the invention.... Agent:

20130011394 - Complexes comprising mhc class i fusion polypeptides and antigen-specific antibodies and methods of use: The invention comprises a complex comprising as first part an antibody derived part that specifically binds to a target antigen, and as second part a virus-derived peptide linked to a MHC class I protein complex.... Agent: Hoffmann-la Roche Inc.

20130011389 - Compositions and methods for treating coagulation related disorders: Disclosed are methods for preventing or treating sepsis, a sepsis-related condition or an inflammatory disease in a mammal. In one embodiment, the method includes administering to the mammal a therapeutically effective amount of at least one humanized antibody, chimeric antibody, or fragment thereof that binds specifically to tissue factor (TF)... Agent:

20130011392 - Method for assessing the ability of a patient to respond to or be safely treated by a nucleoside analog based-chemotherapy: The invention relates to an in vitro method for determining the ability of a patient with cancer to respond to a monochemotherapy or to a polychemotherapy involving the administration of at least one chemotherapeutic agent the liver elimination of which involves cytidine deaminase (CDA), or to be treated by at... Agent: Universite D'aix Marseille

20130011395 - Methods and compositions for treating autoimmune diseases or conditions: The present invention relates to methods of treating immune disorders, particularly autoimmune and inflammatory disorders such as rheumatoid arthritis, and methods of producing antibodies for use in therapeutic strategies for treating such disorders. Generally, the present methods involve the use of antibodies that specifically bind to NKG2D receptors present on... Agent:

20130011390 - Methods of treating central nervous system ischemic or hemorrhagic injury using anti alpha4 integrin antagonists: Methods of, and compositions for, treating central nervous system injury with an antagonist of an alpha4 subunit containing integrin are described.... Agent: Biogen Idec Ma Inc.

20130011396 - Treatment protocol: Combination treatments with an antiangiogenesis agent and non-toxic blood levels of ethanol and/or DMSO are disclosed.... Agent:

20130011398 - Serpin fusion polypeptides and methods of use thereof: This invention relates to molecules, particularly polypeptides, more particularly fusion proteins that include a serpin polypeptide or an amino acid sequence that is derived from a serpin and second polypeptide comprising of at least one the following: an Fc polypeptide or an amino acid sequence that is derived from an... Agent: Inhibrx LLC

20130011397 - Transforming growth factor-beta (tgf-beta) antagonists for use in treating pain: Provided herein are methods for treating pain and for reducing the excitability of nociceptors, comprising administering a TGF-β antagonist. In some embodiments, a TGF-β antagonist is a monoclonal TGF-β neutralizing antibody or a fusion product comprising a monoclonal TGF-β neutralizing antibody, a soluble receptor, an antisense oligodeoxynucleotides (ODNs), a ribozymes,... Agent: The Board Of Trustees Of The Leland Stanford Junior University

20130011399 - Wap domain fusion polypeptides and methods of use thereof: This invention relates to fusion proteins that include a whey acidic protein (WAP) domain-containing polypeptide and a second polypeptide. Additionally, the invention relates to fusion proteins that include a WAP domain-containing polypeptide, a second polypeptide, and a third polypeptide. The second and/or third polypeptides of the fusion proteins of the... Agent: Inhibrx LLC

20130011400 - Methods for inducing autolysis in infectious bacteria: The present invention relates to methods for the killing of infectious bacteria by modulating the extra-cellular concentration of bacterial cell signalling molecules. This has the effect of inducing rapid cell death (autolysis) in the majority of bacterial cells, and preventing virulence or restoring a benign state in surviving cells. These... Agent: Haptogen Ltd.

20130011401 - Soluble proteins for use as therapeutics: e

20130011405 - Antagonist anti-cd40 monoclonal antibodies and methods for their use: Compositions and methods of therapy for treating diseases mediated by stimulation of CD40 signaling on CD40-expressing cells are provided. The methods comprise administering a therapeutically effective amount of an antagonist anti-CD40 antibody or antigen-binding fragment thereof to a patient in need thereof. The antagonist anti-CD40 antibody or antigen-binding fragment thereof... Agent: Novartis Vaccines And Diagnostics, Inc.

20130011406 - Anti-kit antibodies and uses thereof: Provided herein, in one aspect, are antibodies that immunospecifically bind to a human KIT antigen comprising the fourth and/or fifth extracellular Ig-like domains (that is, D4 and/or D5 domains), polynucleotides comprising nucleotide sequences encoding such antibodies, and expression vectors and host cells for producing such antibodies. The antibodies can inhibit... Agent: Kolltan Pharmaceuticals, Inc.

20130011402 - Compositions and methods for the diagnosis and treatment of tumor: The present invention is directed to compositions of matter useful for the diagnosis and treatment of tumor in mammals and to methods of using those compositions of matter for the same.... Agent:

20130011403 - Klebsiella antigens: The present invention relates to an isolated nucleic acid molecule encoding an antigen, a vector comprising such nucleic acid molecule and a host cell comprising such vector. Furthermore, the invention provides antigens from Klebsiella species, fragments and variants thereof, a process for producing such antigens, and a process for producing... Agent: Intercell Ag

20130011404 - Methods and compositions for regulating musashi function: The invention generally features compositions and methods for detecting and regulating cell proliferation, potentiation, and differentiation in a population of cells. In particular, compositions and methods are provided for modulating the activity of Musashi proteins. Diagnostic, screening, and therapeutic methods utilizing compositions of the invention are also provided.... Agent: Board Of Trustees Of The University Of Arkansas

20130011407 - Pharmaceutical composition for treatment or prevention of osteoarthritis, and method of production therefor: Pharmaceutical compositions for treating or preventing diseases classified as any of grade 1 to 3 according to the ICRS classification of osteoarthritis, classified as any of grade 1 to 3 according to the Kellgren-Lawrence classification of osteoarthritis or classified as any of grade 1 to 3 according to the Outerbridge... Agent: Axis Inc.

20130011408 - Epidermal growth factor receptor (egfr) protein srm assay: The current disclosure provides for specific peptides from the Epidermal Growth Factor Receptor (EGFR) protein and the derived ionization characteristics of those peptides that are advantageous for quantifying the EGFR directly in formalin fixed biological samples by the method of Selected Reaction Monitoring (SRM) mass spectrometry. Such fixed biological samples... Agent: Expression Pathology, Inc.

20130011409 - Compositions, kits, and methods for the diagnosis, prognosis, monitoring, treatment and modulation of post-transplant lymphoproliferative disorders and hypoxia associated angiogenesis disorders using galectin-1: The present invention is based, in part, on the discovery that galectin-1 (Gal1) plays a role in viral-associated PTLD, e.g., EBV-associated PTLD and hypoxia associated angiogenesis disorders. Accordingly, the invention relates to compositions, kits, and methods for diagnosing, prognosing, monitoring, treating and modulating viral-associated PTLD, e.g., EBV-associated PTLD and hypoxia... Agent: Dana-farber-cancer Institute, Inc.

20130011410 - Egg white antibodies for prevention and treatment of specific localized intestinal infections and diseases associated with a pathogenic organism or molecule: The present invention provides the method for prevention and treatment of specific localized intestinal infections and diseases using IgA and IgM antibodies obtained from the eggs of hens which have been hyperimmunized to the same specific infections and diseases. The invention describes the high functionality of IgA and IgM antibodies... Agent: Amicus Biotech Inc.

20130011412 - Antibodies to lymphotoxin-alpha: The invention provides various antibodies that bind to lymphotoxin-α, methods for making such antibodies, compositions and articles incorporating such antibodies, and their uses in treating, for example, an autoimmune disorder. The antibodies include murine, chimeric, and humanized antibodies.... Agent: Genentech, Inc.

20130011413 - Method and pharmaceutical composition for treatment of intestinal disease: Provided is a pharmaceutical composition for the treatment of intestinal disease which contains an inhibitor of inflammatory cytokine IL-1 family molecules and IL-17 family molecules, and in particular contains an IL-17F inhibitor. Also provided is a pharmaceutical composition for the treatment of intestinal disease which contains an IL-17F inhibitor and... Agent: The University Of Tokyo

20130011411 - Methods and compositions for the diagnosis, prognosis, and treatment of cancer: Methods and compositions for diagnosing and treating cancer, such as breast cancer are provided. In particular, methods and compositions relating to nucleic acids encoding DACH1 and DACH1 proteins are provided.... Agent:

20130011414 - Broadly cross-reactive hiv-1-specific antibodies for prevention and treatment of hiv: Provided herein are HIV-1-specific transforming antibodies (tAbs) and antigens that are recognized by HIV-1-specific tAbs. Also provided herein are methods for screening and/or generating HIV-1-specific tAbs and uses of tAbs for prevention and treatment of HIV-1 infection.... Agent: University Of Hong Kong

20130011415 - Milk derived antigen specific antibodies for inducing an adaptive immune response, methods of preparation and uses thereof: The invention relates to the field of antibodies. In particular the invention relates to milk-derived antigen specific antibodies for generating an adaptive immune response, methods of preparation, and uses thereof.... Agent:

20130011417 - Colchicine derivatives or pharmaceutically acceptable salts thereof, method for preparing said derivatives, and pharmaceutical composition comprising said derivatives: The present invention relates to colchicine derivatives expressed in chemical formula 1, or to pharmaceutically acceptable salts thereof, to a method for preparing said derivatives, and to a pharmaceutical composition comprising said derivatives. The colchicine derivatives according to the present invention exhibit superior immunomodulatory effects as compared with conventional immunomodulators... Agent:

20130011416 - Injectable solution containing therapeutic agent for osteoarthritis: Injections for treating and preventing diseases classified as any of grade 1 to 3 according to the ICRS classification of osteoarthritis, diseases classified as any of grade 1 to 3 according to the Kellgren-Lawrence classification of osteoarthritis or diseases classified as any of grade 1 to 3 according to the... Agent: Axis Inc.

20130011418 - Antibody-drug conjugates: Disclosed are anti-5T4 antibody drug conjugates and methods for preparing and using the same.... Agent: Wyeth LLC

20130011419 - Cross-linkers and their uses: Charged or pro-charged cross-linking moieties and conjugates of cell binding agents and drugs comprising the charged or pro-charged cross-linking moieties and method of making the same.... Agent: Immunogen, Inc.

20130011420 - Antisense antiviral compounds and methods for treating a filovirus infection: The present invention provides antisense antiviral compounds, compositions, and methods of their use and production, mainly for inhibiting the replication of viruses of the Filoviridae family, including Ebola and Marburg viruses. The compounds, compositions, and methods also relate to the treatment of viral infections in mammals including primates by Ebola... Agent: Avi Biopharma, Inc.

20130011421 - Triterpene saponins, methods of synthesis, and uses thereof: The present invention relates to triterpene glycoside saponin-derived adjuvants, syntheses thereof, intermediates thereto, and uses thereof. QS-7 is a potent immuno-adjuvant that is significantly less toxic than QS-21, a related saponin that is currently the favored adjuvant in anticancer and antiviral vaccines. Tedious isolation and purification protocols have hindered the... Agent: Sloan-kettering Institute For Cancer Research

20130011423 - Metalloproteinase oligopeptides and their therapeutic use: The invention discloses identification and therapeutic use of matrix metalloproteinase oligopeptides, SEQID 5-SEQID 21. These oligopeptides are bound to antibodies to create an immune response in the subject mammal against the matrix metalloproteinases of various diseases. This is a means of therapeutic intervention against the disease spread created by the... Agent:

20130011424 - Polyepitope constructs and methods for their preparation and use: The invention relates to immunogenic polyepitope constructs containing CTL and/or Th epitopes and optimized spacer sequences which improve processing and presentation of the epitopes leading to induction of high level of both CD4+ and CD8+ specific T-cell responses and specific types of cytokines, and high level of protection and therapeutic... Agent:

20130011422 - Tumor antigens for the prevention and/or treatment of cancer: The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide in preventing and/or treating cancer. In particular, the invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in immunotherapeutic treatment of... Agent:

20130011427 - Flavivirus species-specific peptide tags for vaccine and diagnostic use: Flaviviruses represent an increasing global public health issue, with no prophylactic and therapeutic formulations currently available for many of them. The combination of factors such as evolutionary change, global warming and wide range of animal hosts suggest the possible occurrence of Flavivirus strains with greater distribution and human pathogenicity. There... Agent: The Johns Hopkins University

20130011425 - Rapid, efficient purification of hsv-specific t-lymphocytes and hsv antigens identified via same: Described is a method of identifying an immunologically active antigen of a virus that attacks skin, as well as a method of enriching a population of lymphocytes for T lymphocytes that are specific to a virus that attacks skin. Also provided are HSV antigens and epitopes that are useful for... Agent: University Of Washington

20130011426 - Recombinant vaccines and use thereof: The present invention relates to fusion molecules of antigens, the nucleic acids coding therefor and the use of such fusion molecules and nucleic acids. In particular, said invention relates to fusion molecules, comprising an antigen and the trans-membrane region and cytoplasmic region of a MHC molecule and/or the cytoplasmic region... Agent: Biontech Ag

20130011428 - Novel streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof: The present invention relates to newly identified open reading frames comprised within the genomic nucleotide sequence of Streptococcus pneumoniae, wherein the open reading frames encode polypeptides that are surface localized on Streptococcus pneumoniae. Thus, the invention relates to Streptococcus pneumoniae open reading frames that encode polypeptides encoded by the Streptococcus... Agent: Wyeth Holdings Corporation

20130011429 - Immunogenic composition: Immunogenic compositions and methods of their use, as well as processes for their production are provided herein.... Agent:

20130011430 - Human chorionic gonadotropin (hcg) based vaccine for prevention and treatment of cancer: The present invention is directed to a vaccine and a pharmaceutical composition comprising hCG and Mycobacterium w suitable for administration to a subject in need thereof for the prevention and/or treatment of cancer. The compositions when administered to a subject in need thereof results in enhanced immunogenicity and prevention against... Agent:

20130011431 - Composition comprising the amyloid beta 1-6 peptide coupled to a virus-like particle and an adjuvant: The present invention relates to compositions comprising a construct comprising the Aβ1-6 peptide and a pharmaceutically acceptable adjuvant, for the treatment of patients suffering from dementia, in particular dementia of the Alzheimer's type. In one embodiment, the construct containing the Aβ1-6 peptide consists of a virus-like particle (VLP) of the... Agent: Novartis Ag

20130011432 - Disrupted adenovirus-based vaccine against drugs of abuse: The invention is directed to an adenovirus-antigen conjugate comprising (a) a disrupted adenovirus with a coat protein and (b) an antigen conjugated to the coat protein of the disrupted adenovirus, as well as a conjugate comprising (a) a disrupted adenovirus with a coat protein and (b) an antigen conjugated to... Agent: Cornell University (cctec)

20130011433 - Dengue tetravalent vaccine containing a common 30 nucleotide deletion in the 3'-utr of dengue types 1, 2, 3, and 4, or antigenic chimeric dengue viruses 1, 2, 3, and 4: The invention relates to a dengue virus tetravalent vaccine containing a common 30 nucleotide deletion (Δ30) in the 3′-untranslated region of the genome of dengue virus serotypes 1, 2, 3, and 4, or antigenic chimeric dengue viruses of serotypes 1, 2, 3, and 4.... Agent: The Government Of The Usa, As Represented By The Secretary, Department Of Health And Human Services

20130011434 - Adjuvant diluents for live vaccines for pig diseases: A method for preparing an injectable vaccine composition intended to combat porcine reproductive and respiratory syndrome (PRRS), includes at least the step in which: a) a live vaccine is mixed extemporaneously with an adjuvant diluent (AD). The adjuvant diluent is an oil-in-water-type emulsion or an oil-in-water-type microemulsion, or an aqueous... Agent: Societe D'exploitation De Produits Pour Les Industries Chimiques Seppic

20130011435 - Composition for treating hbv infection: The present invention provides a composition comprising hepatitis B virus (HBV) component(s), and which may be either nucleic acid- or polypeptide-based as well as nucleic acid molecules and vectors encoding such HBV component(s). It also relates to infectious viral particles and host cells comprising such nucleic acid molecules or vectors.... Agent: Transgene Sa

20130011436 - Methods and compositions containing fc fusion proteins for enhancing immune responses: Provided are compositions and methods for inhibiting cell growth. The cells that are targeted by the compositions and methods of the invention express an antigen, a mimotope of the antigen, or a CXCR4 chemokine receptor. The method entails administering to an individual a polynucleotide encoding an immunoglobulin Fc and an... Agent: Health Research, Inc.

20130011437 - Immune compositions for treating h. pylori infection: An immune composition for use, via topical administration, in eliciting Th2 or regulatory T cell-mediated immune responses specific to H. pylori. The immune composition, free of both liposaccharides and mammalian proteins, contains a whole-cell H. pylori lysate, and optionally, a vitamin D compound, halofuginone, or a mixture thereof as the... Agent: Life Spring Immuno Science Corp.

20130011438 - Means and methods for active cellular immunotherapy of cancer by using tumor cells killed by high hydrostatic pressure and dendritic cells: Disclosed are pharmaceutical compositions for inducing an immune response against tumor cells comprising tumor cells which are made apoptotic by treatment with high hydrostatic pressure and dendritic cells, and methods for producing such compositions.... Agent: Sotio A.s.

20130011439 - Inactivated bacterial cell formulation: The invention relates to the use of lactic acid-producing bacteria to boost the immune system.... Agent: Ganeden Biotech, Inc.

20130011446 - Ceramic composition for filling bone defects: The invention is directed toward a sterile formable implant composition for application to a bone defect site comprising bioactive glass particles in an aqueous carrier solution, the bioactive glass particles being added to a viscous carrier at a concentration ranging from about 68% to about 76% (w/w), the carrier comprising... Agent: Musculoskeletal Transplant Foundation

20130011444 - Compositions and methods for overcoming resistance to tramadol: There is disclosed a composition for oral administration of O-desmethyltramadol. There is further disclosed a method for treating disorders modulated by at least opiate receptor activity or monoamine activity, including acute and chronic pain, comprising administering a pharmaceutical formulation comprising O-desmethyltramadol. Compositions and methods are also provided that are effective... Agent: Syntrix Biosystems, Inc.

20130011447 - Controlled release nanoparticulate compositions: Described are controlled release nanoparticulate formulations comprising a nanoparticulate agent to be administered and a rate-controlling polymer which functions to prolong the release of the agent following administration. The novel compositions release the agent following administration for a time period ranging from about 2 to about 24 hours or longer.... Agent: Alkermes Pharma Ireland Limited

20130011450 - Deodorizing fiber structure: A deodorizing fiber structure contains a material composed of a hydroxy acid derivative is secured to a polyester-based fiber structure, and a method for producing a fiber structure including the steps of immersing a polyester-based fiber structure in a hydroxy acid aqueous solution, subsequently drying, and then heat-treating.... Agent: Toray Industries, Inc.

20130011443 - Human respiratory syncytial virus vaccine: The present invention relates to RSV vaccines and methods for inducing an immune response to RSV in a subject comprising administering an RSV vaccine.... Agent: Nanobio Corporation

20130011440 - Method and device for depositing thin layers, especially for the production of multiple layers, nanolayers, nanostructures and nanocomposites: The present disclosure relates to a method for the deposition of thin layers, particularly for producing multi-layer coatings, nanolayers, nanostructures and nanocomposites by laser deposition from target materials on a substrate surface, which is characterized by the following features: a) the target is divided into segments with materials having most... Agent: Vascotec Gmbh

20130011442 - Method for repair of articular cartilage defect and a device used therein: The invention provides a single surgical procedure by using autologous platelet-rich fibrin (PRF) and cartilage fragments to solve problems of contamination during incubation of chondrocytes and transplant rejection in vivo, which has the benefit of a more efficient and shorter recovery time. The invention also provides a device for easily... Agent: Taipei Medical University

20130011445 - Polymer-agent conjugates, particles, compositions, and related methods of use: Described herein are polymer-agent conjugates and particles, which can be used, for example, in the treatment of cancer. Also described herein are mixtures, compositions and dosage forms containing the particles, methods of using the particles (e.g., to treat a disorder), kits including the polymer-agent conjugates and particles, methods of making... Agent:

20130011449 - Solid preparation: A solid preparation 1 comprises a drug-containing unit 2 containing a drug, a gel-forming layer 4 for covering the drug-containing unit 2 and forming a gel by water absorption, and an intermediate layer 3 interposed between the drug-containing unit 2 and the gel-forming layer 4. The elution property of the... Agent:

20130011448 - System for improved delivery of gene modulating compounds: It also relates to the use of the system in diagnosis of diseases, as research tool and as a targeting system, a composition comprising the system and especially a pharmaceutical composition, a material covered with the system and a material having the delivery systems within the material.... Agent: Ge Healthcare Bio-sciences Ab

20130011441 - Targeted delivery of sirna: The present invention relates to nanostructured bioconjugates and nano-structured network hydrogels used to deliver nucleic acids to targeted biological locations. The present invention further relates to methods of treating clinical conditions using the nanostructured bioconjugates and nano-structured network hydrogels.... Agent: Carnegie Mellon University

20130011453 - Buffered microencapsulated compositions and methods: A microcapsule composition comprising at least one polymer substantially disposed as a semi-permeable shell around a buffered solution and at least one therapeutic agent, wherein the therapeutic agent permeates the shell, and wherein the composition is suitable for delivery to a mammal. This invention also provides related compositions, products and... Agent: Premier Dental Products Company

20130011451 - Footbed with non-denatured collagen: The invention relates to a composition comprised of a prepolymer, at least one additive, and non-denatured collagen fibers and a method of making the same. The composition of the instant invention is for use as a footbed to augment the shock absorption already provided to the human body via a... Agent: Diversified Glogal Technologies, LLC

20130011455 - Novel carrier system for the transport of active substances into the skin: Vesicle, comprising at least the following components:—an aqueous core, which can comprise at least one cosmetic and/or at least one pharmaceutical active substance, and—a continuous membrane which surrounds the core and which is formed by at least one emulsifier, selected from the group of the food additives E 472 a... Agent:

20130011454 - Oil-in-water type nano-emulsion composition and method for preparing same: The present invention relates to an oil-in-water (O/W) type nano-emulsion composition comprising an oil component containing oil and a polyethylene glycol ester-based emulsifier; and a water component containing a polyol or a polyol derivative. The present invention also relates to a cosmetic composition comprising the oil-in-water type nano-emulsion composition, and... Agent: Amorepacific Corporation

20130011452 - Topical foam composition: The present invention relates to a novel oil in water emulsion aerosol foam composition containing an active agent for the treatment of various chronic and acute skin conditions, particularly acne and psoriasis; and processes for preparing the emulsion aerosol foam compositions. In particular, the present invention relates to oil in... Agent:

20130011456 - Antimicrobial parylene coatings and methods of depositing same: Antimicrobial parylene coatings and methods for their vapor-phase deposition.... Agent:

20130011457 - Antimicrobial polymers and methods of manufacture thereof: Biodegradable cationic block copolymers are disclosed, comprising a hydrophilic block comprising first repeat units derived from a first cyclic carbonyl monomer by ring-opening polymerization, wherein more than 0% of the first repeat units comprise a side chain moiety comprising a quaternary amine group; a hydrophobic block comprising second repeat units... Agent: International Business Machines Corporation

20130011458 - Anti-virus hydrophilic polymeric material: The invention provides a method for imparting antiviral properties to a hydrophilic polymeric material comprising preparing a hydrophilic polymeric slurry, dispersing an ionic copper powder mixture containing cuprous oxide and cupric oxide in said slurry and then extruding or molding said slurry to form a hydrophilic polymeric material, wherein water-insoluble... Agent: The Cupron Corporation

20130011459 - Composite for controleed release of small molecules in aquatic environments: A composite material formulated for slow release of a small molecule in seawater includes a porous inorganic oxide framework and micelles embedded within the pores of the framework. The micelles include a surfactant and a small molecule, the surfactant being present in the composite material at no more than 80... Agent: Naval Research Laboratory

20130011460 - Drug-carrying contact lens and method for fabricating the same: The present invention discloses a drug-carrying contact lens and a method for fabricating the same. The drug-carrying contact lens comprises a contact lens containing at least one amphiphatic hybrid nanocarrier carrying drug molecules. According to the heat or light sensitivity of the drug molecule, the present invention respectively fabricates an... Agent:

20130011461 - Nicotine-containing chewing gum piece packed in a wrapping of laminate: A nicotine-containing chewing gum piece packed in a wrapping of laminate, where the laminate comprises at least an inner layer facing the chewing gum and a nicotine degradation agent barrier layer of a metal foil. The nicotine-containing chewing gum piece is shaped as an elongate plate having two ends and... Agent: Fertin Pharma A/s

20130011462 - Melt extruded nicotine thin strips: A thin strip for oral ingestion is between 0.05 millimeters and 2.00 millimeters thick. It includes 10 to 80% by weight of polyethylene oxide having a molecular weight of from 70,000 to 300,000 daltons. It further includes 5 to 50% by weight of a sugar alcohol having a melting point... Agent: Novartis Ag

20130011463 - Method and device for synovial cell-charged collagen membrane or gel: An implant for repair of a cartilaginous defect in a subject includes a collagen matrix charged with synovial cells. A method preparing an implant for repair of a cartilaginous defect in a subject includes obtaining a fluid containing synovial cells and charging the synovial cells to the matrix. A device... Agent: Geistlich Pharma Ag

20130011465 - Composition and method for the treatment of diseases affected by apoptosis: The present invention includes methods of making and methods of using peptidomimetics compositions that mimic α-helical BH3 sequences in cells. The peptidomimetics can be used to mimic α-helical BH3 sequences and kill cancer cells.... Agent: Board Of Regents, The University Of Texas System

20130011466 - Liposome encapsulating ammine-platinum complex at high concentration, and method for production of the liposome: The present invention provides a method of producing a liposome encapsulating an ammine platinum complex. The method includes A) providing a water-soluble ammine platinum complex, platinum complex raw materials or the combination thereof; B) providing a liposome, liposome raw materials or the combination; and C) preparing a mixture of the... Agent: Katayama Chemical Industries Co., Ltd.

20130011467 - Method of treating malignant solid tumors using transcatheter arterial chemoembolization (tace): This invention is directed to methods of treating solid tumor cancers, particularly refractory cancers by administration of two pluralities of microparticles, one comprising drug-carrying microparticles sized to lodge at the tumor preferably in the capillary bed of the tumor and the other comprising non-drug-carrying microparticles sized to lodge in the... Agent: Abbott Cardiovascular Systems Inc.

20130011464 - Drug carrier and drug carrier kit for inhibiting fibrosis: An astrocyte-specific drug carrier containing a retinoid derivative and/or a vitamin A analog as a constituent; a drug delivery method with the use of the same; a drug containing the same; and a therapeutic method with the use of the drug. By binding a drug carrier to a retinoid derivative... Agent: Nitto Denko Corporation

20130011468 - Fatty acid composition for treatment of alzheimer's disease and cognitive dysfunction: This invention relates to the use of a fatty acid composition comprising at least (all-Z omega-3)-4,7,10,13,16,19-docosahexaenoic acid (DHA), or derivatives thereof, and (all-Z omega-3)-5,8,11,14,17-eicosapentaenoic acid (EPA), or derivatives thereof for manufacturing of a medicinal product or a food stuff for the treatment and/or prevention of amyloidos-related diseases, such as Alzheimer's... Agent: Pronova Biopharma Norge As

20130011469 - Krill oil and carotenoid composition, associated method and delivery system: A medicine delivery system includes an inner capsule containing carotenoids and an outer capsule in which the inner capsule is contained within the outer capsule and the outer capsule containing a therapeutically effective amount of krill oil. In one example, the carotenoids comprise at least S, S′-astaxanthin derived from Haematococcus... Agent: U.s. Nutraceuticals, LLC D/b/a Valensa International

20130011470 - Pharmaceutical formulations of naproxen for soft gel encapsulation and combinations thereof: An NSAID formulation for encapsulation into a soft gel capsule with increased stability, concentration and bioavailability of the NSAID. The preferred NSAIDS are naproxen, ibprofen, indomethacin and diclofenac, which are provided in both an acidic and basic form in the fill formulation. The pH values of fill formulations may be... Agent: Accucaps Industries Limited

20130011471 - Stable pharmaceutical composition and methods of using same: The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent cardiovascular-related diseases.... Agent: Amarin Pharmaceuticals Ireland Limited

20130011472 - Stable pharmaceutical composition and methods of using same: The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent cardiovascular-related diseases.... Agent: Amarin Pharmaceuticals Ireland Limited

20130011474 - Modified and immediate release formulations of memantine: The present invention provides immediate release and modified release oral dosage forms. Specifically, the invention provides modified and immediate release pharmaceutical dosage forms containing memantine that exhibit an enhanced release profile and provide reliable absorption. The dosage forms may be used to treat mild, moderate or severe Alzheimer's disease or... Agent: Forest Laboratories Holdings Ltd.

20130011473 - Preparation method of the solid formulation of clopidogrel bisulfate: A solid formulation of clopidogrel bisulfate and its preparation method are disclosed. The formulation comprises clopidogrel bisulfate as active ingredient, colloidal silicon dioxide as anti-adherent/coating and the carriers selected from diluent, binder, glidant, disintegrant and/or lubricant.... Agent:

20130011475 - Stable compositions of famotidine and ibuprofen: Stable pharmaceutical compositions of famotidine and ibuprofen in a single unit dosage form are disclosed herein. The compositions comprise a famotidine core having a reduced or minimal surface area surrounded by a layer of ibuprofen. In some embodiments, the ibuprofen is in direct physical contact with the famotidine.... Agent:

20130011476 - Stable compositions of famotidine and ibuprofen: Stable pharmaceutical compositions of famotidine and ibuprofen in a single unit dosage form are disclosed herein. The compositions comprise a famotidine core having a reduced or minimal surface area surrounded by a layer of ibuprofen. In some embodiments, the ibuprofen is in direct physical contact with the famotidine.... Agent:

20130011477 - Stable pharmaceutical composition of imatinib: The present invention relates to a compressed film-coated tablet comprising imatinib its pharmaceutically acceptable salts there of in an amount of more than 80% based on the total weight of the finished dosage form.... Agent: Hetero Research Foundation

20130011478 - Pharmacologically optimized multimodal drug delivery system for nordihydroguiaretic acid (ndga): The present invention relates generally to compositions and methods for oral delivery of nordihydroguaiaretic acid (NDGA). More particularly, the present invention relates to pharmacologically optimized multimodal drug delivery systems for orally administered NDGA and methods for preparation and use thereof.... Agent: Napo Pharmaceuticals, Inc.

20130011479 - Double-layer pharmaceutical formulations containing opioid agonists and antagonists: Immediate-release formulations are described, consisting of double-layer tablets wherein one layers contains an opioid agonist and the other an opioid antagonist.... Agent: L. Molteni & C. Dei Fratelli Alitti Societa' Di Esercizio S.p.a

20130011480 - Cytotoxic therapy by proton flux modulation: Compositions and methods for treating cancer are described. Some of the methods include administering to a cancer patient in need thereof a substance, such as a carbonic anhydrase inhibitor, that at a therapeutic dose produces a metabolic acidosis in humans; and administering to the patient at least one of: (a)... Agent:

20130011482 - Dual component medicament delivery system: A medicament delivery system is disclosed. The system comprises a descending formulation for delivering the medicament and an ascending formulation to protect a patient being treated with the medicament from the side effects thereof.... Agent:

20130011483 - Formulations of mazindol: Formulations of mazindol having superior stability and methods of administering same are provided. The formulations may be immediate, enhanced, or otherwise delayed release formulations of mazindol.... Agent: Supernus Pharmaceuticals, Inc.

20130011481 - Pyrroloquinolinyl-pyrrolidine-2,5-dione formulations and methods for preparing and using same: The present invention provides pyrroloquinolinyl-pyrrole-2,5-dione formulations and methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of the formulations containing pyrroloquinolinyl-pyrrole-2,5-dione compounds.... Agent: Arqule, Inc.

20130011484 - Cannabinoid receptor binding agents, compositions, and methods: A composition comprising a cannabinoid receptor binding agent attached to a particle for the treatment of skin conditions. The particle may be a nanoparticle, such as nanocrystalline cellulose. The particle may further be modified with functional moieties. Drug delivery properties may be modified by coating the particles or using vesicles... Agent:

20130011485 - Magnetic nanomedicine for inhibiting/treating human prostate cancer: The present invention discloses a magnetic nanomedicine for inhibiting/treating human prostate cancer, which comprises a core containing a magnetic particle having a diameter of less than 10 nm; a shell made of a carboxylated polyaniline and encapsulating the core; and a medicine covalently linked to the shell and able to... Agent: Chang Gung University

20130011486 - Visual performance and/or macular pigmentation: Disclosed is a composition comprising MZ for use as a dietary supplement or food additive for oral consumption for improving the visual performance of a human subject.... Agent: Howard Foundation Holdings Limited

20130011487 - Fluorinated block co-polymers: A block co-polymer includes a water soluble carrier block; an amino acid-based or acrylic acid-based block; and the amino acid-based or acrylic acid-based block includes a fluorinated alkyl group or a fluorinated alkylene glycol group.... Agent: Empire Technology Development LLC

20130011488 - Systems, methods, and formulations for treating cancer: A method and compositions for treating cancer is described using at least two epigenetic modifiers. In various embodiments, hyperbaric oxygen therapy and glycolytic inhibition therapy are used as well.... Agent:

20130011489 - Anti-fungal compositions and associated methods: The present disclosure provides methods and compositions for treating fungal diseases of plants. In one embodiment, an anti-fungal aqueous composition can comprise: a nitrogen source material having a total nitrogen content in an amount of about 0.1 wt % to about 0.5 wt % of the total weight of the... Agent:

20130011491 - Antimicrobial textiles comprising peroxide: This invention pertains to method for imparting a durable antimicrobial activity to substrates, particularly textiles. An acetate-free metal and peroxide antimicrobial treatment formulation is prepared by adjusting the pH of a mixture of a metal salt in aqueous hydrogen peroxide to about 7.5. The substrate is treated with the composition... Agent: Quick-med Technologies, Inc.

20130011490 - High alcohol content foaming compositions with silicone-based surfactants: This invention relates to a “high lower alcohol content” (>40% v/v of a C1-4 alcohol) liquid composition able to be dispensed as a stable foam with the use of non-propellant foam dispensing devices from non-pressurized containers. The liquid compositions comprise an alcohol, C1-4 (>40% v/v), a silicone-based surfactant of at... Agent: Deb Worldwide Healthcare Inc.

20130011492 - Electrochemical deposition of noble metal and chitosan coating: A method of electrochemical deposition includes submerging a stainless steel surface of an object in a chitosan solution and applying a first electric potential between the submerged stainless steel surface and the chitosan solution for a predetermined time to form a chitosan surface coating. After rinsing and dehydrating, the chitosan... Agent: The Research Foundation Of State University Of New York

20130011493 - Plant disease controlling composition and method for controlling plant disease: The present invention provides a composition having an excellent controlling activity on plant disease. The composition comprising the compound represented by the formula (1) and one or more inorganic fungicidal compound selected from the group (A) shows an excellent controlling activity on a plant disease. Group (A): a group consisting... Agent: Sumitomo Chemical Company, Limited

20130011494 - Composition for treating decubitus ulcers in diabetic and non-diabetic patients: The various embodiments herein disclose a composition in the form of an ointment for treating decubitus ulcers in diabetic and non diabetic patients. The composition comprises of therapeutic agents, zinc oxide, vegetable oils and powdered talc. The therapeutic agents include salts of nystatin, tetracycline and neomycin, respectively. The vegetable oils... Agent:

20130011495 - Antifungal compounds and use thereof: The present invention relates to an antifungal composition including at least two compounds selected from among the group consisting of cysteine, salicylic acid, iron(II) sulfate and fosetyl-aluminum, as well as to a method for treating a plant, infected or not infected by a pathogen. Specifically, the present invention relates to... Agent:

20130011496 - Cancer testis antigens as biomarkers in non-small cell lung cancer: A cancer testis antigen biomarker useful to determine whether a non- small cell lung cancer tumor is likely to respond to neoadjuvant chemotherapy is provided. Methods of using the biomarker in the diagnosis, treatment and prognosis of non-small cell lung cancer also are provided.... Agent: Ludwig Institute For Cancer Research Ltd.

20130011497 - Method of treatment and screening method: A method for the treatment of a proliferative disease comprising providing a E2F-1 protein which is arginine-methylation defective or administering a substance which reduces the expression and/or activity of PRMT5. The invention also provides antibodies, screening methods and kits.... Agent:

20130011498 - Method of using beta-hydroxy-beta-methylbutyrate for reducing tumor growth rate: The present invention relates to methods for the prevention and treatment of chronic inflammatory diseases, cancer, and involuntary weight loss. In the practice of the present invention patients are enterally administered HMB alone or alternatively in combination with eicosapentaenoic (20:5 ω-3), FOS, carnitine and mixtures thereof. HMB may be added... Agent: Abbott Laboratories

20130011499 - Herbal medicinal composition and extract thereof for inhibiting growth of cancer cells: The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae fructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2SO4, and Atractylodis Rhizoma. The residual examples are described... Agent:

20130011500 - Ginger extract for inhibiting the fat-storage function of adipocytes and a medication thereof: In the present invention, a ginger extract for inhibiting the fat-storage function of adipocytes and a medication thereof is disclosed, wherein the ginger extract is obtained form Alpinia galangal and Zingiber zerumbet.... Agent:

20130011501 - Anti-fever botanical composition and uses thereof: According to at least one aspect of the present invention, a botanical anti-fever composition is provided. In at least one embodiment, the botanical composition comprises a therapeutically effective amount of admixture of parts or extracts of at least one plant species from each of genus Baptista and genus Swertia. In... Agent: Micro-dose Life Sciences LLC

20130011502 - Composition for a dietary supplement for the treatment of hemorrhoids: A composition for a dietary supplement for use in treating hemorrhoids (external or internal) includes: 30%-60% Indian Barberry by weight; 20%-40% Kurchi seeds by weight; 0.3%-1% Margosa tree leaves by weight; and 20%-50% Inulin by weight.... Agent:

20130011503 - Herbal medicinal composition and extract thereof for inhibiting growth of cancer cells: The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae fructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2SO4, and Atractylodis Rhizoma. The residual examples are described... Agent:

20130011504 - Method for treatment of esophageal spasm: The present invention relates to methods of treating esophageal spasms using botulinum toxins.... Agent: Allergan, Inc.

20130004414 - Devices and methods for reducing radiolysis of radioisotopes: Disclosed are microfluidic devices and kits for containing radioisotopes. The devices and kits comprises at least one confining geometry having a cross-section dimension below the beta(+) or beta(−) range of a radioisotope, when containing the radioisotope configured in such a way that that neighboring segments of the confining geometries are... Agent: General Electric Company

20130004416 - Dual variable domain immunoglobulin and uses thereof: The present invention relates to engineered multivalent and multispecific binding proteins, methods of making, and specifically to their uses in the prevention and/or treatment of acute and chronic inflammatory and other diseases.... Agent: Abbott Laboratories

20130004415 - Joint-homing peptides and uses thereof: The present invention provides peptides that home to a joint of an animal, wherein said peptide comprises an amino acid motif selected from the group consisting of NQR and ADK. Also provided are methods of treating a subject having an arthritic joint, comprising the step of administering to said subject... Agent:

20130004417 - Gold coated lanthanide nanoparticles: The present invention is directed α-particle emitting nanoparticles that comprise a lanthanide phosphate sequestration shell enclosing an α-emitting-radioisotope-doped lanthanide phosphate core such that the shell allows at least some of the α emissions from the α-emitting radioisotope to pass therethrough and prevents at least some radioactive decay products of the... Agent: The Curators Of The University Of Missouri

20130004418 - Infiltration solution for treating an enamel lesion: The invention relates to an infiltration solution of a radiopaque metal compound for treating an enamel lesion, to a kit for dental application, and to the use thereof for preventing and/or treating (sealing) carious enamel lesions.... Agent: Ernst Muhlbauer Gmbh & Co. Kg

20130004419 - Carbonylporphyrins and uses thereof: The present invention is directed to low toxicity boronated compounds and methods for their use in the treatment, visualization, and diagnosis of tumors. More specifically, the present invention is directed to low toxicity carborane-containing porphyrin compounds with halide, amine, or nitro groups and methods for their use particularly in boron... Agent: Brookhaven Science Associates, LLC

20130004420 - Hypervalent radioactive astatine or iodine compounds, and preparation methods thereof: The present invention relates to a compound having formula (I): wherein: X is in particular 125I Or 211At; R1 and R′1 are independently from each other chosen preferably from the group consisting of electron-withdrawing groups and alkyl groups; R2 is chosen from the group consisting of: H, alkyl groups, functional... Agent:

20130004421 - Radiolabeled affibody molecules: The invention provides a radiolabeled affibody molecule comprising a fragment of an IgG-binding domain of protein A from Staphylococcus aureus, a bifunctional linker, and a radiolabel comprising 18F or 76Br, wherein the bifunctional linker links the fragment and the radiolabel. The affibody molecule binds with high affinity to select receptors,... Agent: The United States Of America, As Represented By The Secretary, Dept. Of Health & Human Services

20130004422 - Benzothiazole derivative compounds, compositions and uses: This invention provides benzothiazole derivative compounds, compositions comprising such compounds, methods of preparing such compounds, and methods of using such compounds for detecting amyloid deposit(s) and for diagnosing a disease, disorder or condition characterized by amyloid deposit(s).... Agent: University Of Pittsburgh - Of The Commonwealth System Of Higher Education

20130004426 - Adenosine derivative formulations for medical imaging: A stable composition useful for myocardial perfusion imaging contains one or more 2-alkynyladenosine derivatives; and a solvent which is made up of water and hydroxypropyl-β-cyclodextrin.... Agent: Forest Laboratories Holdings Ltd.

20130004425 - Biomineral and metal binding liposomes, their synthesis, and methods of use thereof: Drug carriers, methods of synthesizing, and methods of use thereof are provided.... Agent:

20130004424 - Methods for determining agents targeting mena isoforms and uses thereof for diagnosis and treatment of metastatic tumors: The present invention relates to methods of determining agents that inhibit Mena+ or MenaINV/+, and uses of agents that bind to and/or inhibit Mena+ or MenaINV/+ for diagnosis and treatment of metastatic tumors.... Agent:

20130004423 - Polyazamacrocyclic compound, and a production method and a biomedical use therefor: According to the present invention, a novel polyazamacrocyclic compound which is used as a bifunctional chelating agent (BFC) can be synthesized selectively and in high yield. The novel polyazamacrocyclic compound synthesized by this method chelates with metals and thus can be conjugated with bioactive molecules such as peptides, and can... Agent:

20130004427 - Targeted dendrimer-drug conjugates: The invention provides for dendrimer conjugates useful for liver-specific delivery of therapeutic agents. The therapeutic agent is associated to the dendrimer through a enzyme-cleavable covalent linkage.... Agent: The Regents Of The University Of Michigan

20130004432 - Monoclonal antibodies that bind b7h6 and uses thereof: Disclosed are monoclonal antibodies that specifically bind to the B7 family member B7H6, including antibodies capable of inhibiting the interaction of B7H6 with NKp30. Also disclosed are anti-B7H6 antibody-drug conjugates comprising an anti-B7H6 monoclonal antibody conjugated to a therapeutic agent. The anti-B7H6 antibodies and antibody-drug conjugates are useful in methods... Agent:

20130004431 - Transport agents for crossing the blood-brain barrier and into brain cancer cells and methods of use thereof: The present invention discloses methods and materials for delivering a cargo compound into a brain cancer cell and/or across the blood-brain barrier. Delivery of the cargo compound is accomplished by the use of protein transport peptides derived from Neisseria outer membrane proteins, such as Laz. The invention also provides synthetic... Agent: The Board Of Trustees Of The University Of Illinois

20130004428 - Diazabicyclononyl oxadiazole compounds and their use as nicotinic acetylcholine receptor modulators: This invention relates to diazabicyclononyl oxadiazolyl derivatives, which are found to-be modulators of the nicotinic acetylcholine receptors. Due to their pharmacological profile the compounds of the invention may be useful for the treatment of diseases or disorders as diverse as those related to the cholinergic system of the central nervous... Agent: Neurosearch A/s

20130004433 - Preparation of stabilised x-ray diagnostic composition: The invention relates to a process for the preparation of a diagnostic X-ray composition. The composition comprises a non-ionic X-ray contrast agent in a pharmaceutically acceptable carrier. More particularly, the invention relates to a process for secondary production of X-ray compositions comprising X-ray contrast agents with a high dissolution temperature.... Agent: Ge Healthcare As

20130004430 - Fluorescent photoprobe for the imaging of endothelin receptors: The present invention relates to an endothelin receptor antagonist conjugate of the formula (I) wherein R2 is an alkoxy group and one of R1 and R3 represents an alkoxy group and the other represents a group of the formula: (OCH2CH2)n—NH—X, wherein n is an integer of 1 to 100 and... Agent:

20130004429 - Use of a neurofilament peptide for the treatment of glioma: The present invention provides a new drug to treat malignant glioma, which is the most prevalent type of primary tumor of the central nervous system (CNS). The present invention indeed shows that the isolated NFL-TBS40-63 peptide is highly specific for glioma cells, in which it triggers apoptosis. It is therefore... Agent: Medicale (inserm), And The Royal Institution For The Advancement Of

20130004434 - Gastroretentive, extended release composition of therapeutic agent: A gastroretentive, extended release composition which floats and swells at acidic pH prevalent in the stomach. The composition includes a pH dependent graft copolymer, a gellable polymer, a therapeutic agent, a gas generating system and pharmaceutically acceptable ingredients. The disclosed composition is useful to deliver the therapeutic agent within the... Agent:

20130004435 - Azeotrope-like compositions comprising 1-chloro-3,3,3-trifluoropropene: The present invention relates, in part, to ternary azeotropic compositions and mixtures including chlorotrifluoropropene, methanol, and a third component selected from isohexane, trans-1,2-dichloroethylene, and petroleum ether. The present invention further relates to ternary azeotropic compositions and mixtures including chlorotrifluoropropene, cyclopentane, and a alcohol selected from methanol, ethanol, and isopropanol.... Agent: Honeywell International Inc.

20130004436 - Compositions and methods of treating and preventing lung cancer and lymphangioleiomyomatosis: Compositions and methods for treating and preventing cancer, particularly lung cancer, lymphangioleiomyomatosis and asthma are provided.... Agent:

20130004438 - Cosmetic composition comprising a supramolecular compound capable of establishing hydrogen bonds, and a particular additional ingredient: The present invention relates to a cosmetic composition comprising, in a cosmetically acceptable medium, (i) a supramolecular compound that may be obtained by reaction between: —at least one oil bearing at least one nucleophilic reactive function chosen from OH and NH2, and —at least one junction group capable of establishing... Agent: L'oreal

20130004439 - Lipo-phosphated or lipo-sulphated compound, compositions comprising it and topical uses thereof: e

20130004441 - Non-aqueous structured compositions: Disclosed are non-aqueous compositions capable of forming a gel structure, comprising (a) a low molecular mass N-acyl glutamic acid diamide having a straight-chain alkyl group; (b) a low molecular mass N-acyl glutamic acid diamide having a branched-chain alkyl group; (c) at least one gel-promoting solvent which includes a substituted hydrocarbyl... Agent: Loreal

20130004437 - Novel compound: The invention relates to novel polyglycerol based UV-filters as well as to topical compositions comprising such novel polyglycerol based UV-filters. Furthermore, the invention relates to the use of such novel polyglycerol based UV-filters to enhance the solubility of butyl methoxydibenzoylmethane or bis-ethylhexyloxyphenol methoxyphenyl triazine in cosmetic oils.... Agent:

20130004440 - Photostable sunscreen composition: The present invention relates to photostable sunscreen compositions comprising sunscreens, more particularly to a liquid composition in emulsion or microemulsion format comprising dibenzoylmethane sunscreens. An object of the present invention is to provide photostable compositions comprising dibenzoylmethane sunscreens, wherein the stabilization is brought about by using readily available and inexpensive... Agent:

20130004442 - Structured non-aqueous gel-form carrier composition: Disclosed are non-aqueous carrier compositions capable of forming a gel structure, having a low molecular mass N-acyl glutamic acid diamide having a straight-chain alkyl group, a low molecular mass N-acyl glutamic acid diamide having a branched-chain alkyl group, at least one gel-promoting solvent, and at least one high molecular mass... Agent: L'oreal

20130004443 - Sunscreen formulations: Disclosed are stable sunscreen compositions and corresponding methods for their use that are effective in protecting skin from UVA and UVB radiation. The composition uses a combination of ingredients to effectively and stably solubilize sunscreen agents to create a stable formulation.... Agent:

20130004444 - Composition containing at least one c7 sugar for alopecia treatment, cosmetic treatment of hair and nails, and care of hair, eyelashes, or nails: The present invention relates to a composition including at least one C7 sugar, or derivative from esterification of said sugar, and a pharmaceutically acceptable carrier for treating alopecia. The present invention also relates to a method for cosmetically treating hair and nails, said method being intended to stimulate the growth... Agent: Laboratories Expanscience

20130004445 - Organosiloxanes containing ester derivatives of ascorbic acid: Organosiloxanes containing ester derivatives of ascorbic acid are disclosed having the formula (R3SiO)nR(3-n)Si—X-A wherein R is an alkyl group containing 1 to 6 carbon atoms, n is 1 to 3 inclusive, X is a divalent organic linking group, A is an ester derivative of ascorbic acid. A method of making... Agent:

20130004446 - Long-wearing non-aqueous structured color cosmetic: Disclosed are non-aqueous compositions capable of forming a gel structure, containing: (a) a low molecular mass N-acyl glutamic acid diamide having a straight-chain alkyl group; (b) a low molecular mass N-acyl glutamic acid diamide having a branched-chain alkyl group; (c) at least one gel-promoting solvent; (d) at least one film... Agent: L'oreal

20130004447 - 2,4-disubstituted pyridines as perfuming ingredients: in the form of any one of its stereoisomers or a mixture thereof, wherein R1 represents a C1-3 alkyl group; R2 represents a C4-9 linear alkyl group; and the compound has between 10 and 15 carbon atoms. These compounds are useful for imparting odors of the green and/or pyrazine type.... Agent: Firmenich Sa

20130004448 - Method for preparing a recyclable polyamide powder: The present invention relates to a method for preparing a recyclable polyimide powder, said method including the following consecutive steps: a) a step of adding 0.01 to 5 wt % of at least one antioxidant in powder form to a mixture including 20 to 95 wt % of polyamide powder... Agent:

20130004449 - Conditioner and conditioning shampoo compound containing pentaerythritol ester: The invention relates to a cosmetic preparation containing (a) esters of fatty acids having 6 to 12 carbon atoms with pentaerythritol and (b) silicones.... Agent: CognisIPManagement Gmbh

20130004450 - Protein-acrylate copolymer and hair conditioning product comprising said polymer: A protein-acrylate copolymer contains at least one nitrogen containing acrylic monomer. The nitrogen containing acrylic monomer preferably contains a tertiary or quaternary amine group, and particularly a quaternary amine group. The protein-acrylate copolymer can be produced by reacting hydrolysed protein with at least one nitrogen containing acrylic monomer, preferably by... Agent: Croda International PLC

20130004451 - Personal care composition: A multi-phase personal care composition comprising at least two visually distinct phases in physical contact with one another characterised in that at least one phase comprises polyacrylate-1 crosspolymer and one phase is a conditioning gel phase.... Agent:

20130004454 - Polyurethane block copolymer based on poly siloxane tenside for membranes: Oligo- or polyurethane compounds of the formula (I) wherein k and n independently are numbers from 1 to 100, m is from the range 1-100, (X) is a block of formula (II) and (Y) is a block of the formula (III), (A) is a residue of an aliphatic or aromatic... Agent: Polymers Crc Ltd.

20130004452 - Formulations containing an ionic mineral-ion exchange resin complex and uses thereof: A process for preparing a formulation comprising a complex comprising an effective amount of ferrous iron bound to a pharmaceutically acceptable cationic resin and at least one pharmaceutically acceptable carrier is described. Such a formulation may optionally include other desirable dietary supplements including, e.g., vitamins, omega fatty acids, and/or fluoride.... Agent: Tris Pharma, Inc.

20130004455 - Poly(organophosphazene) composition for biomaterials: Provided are a use of chemically-crosslinkable, poly(organophosphazene)s for biomaterials, chemically-crosslinkable poly(organophosphazene)s with a physiologically active substance covalently-bonded thereto, a use thereof for biomaterials, and a process for preparing the same. The chemical crosslinkings can be made by UV irradiation, and/or a crosslinker, and/or an additive, and/or an enzyme, and/or a... Agent: Korea Institute Of Science And Technology

20130004453 - Nylon-3 co-polymers and synthetic lung surfactant compositions containing same: Non-natural oligomers have recently shown promise as functional analogues of lung surfactant proteins Band C (SP-B and SP-C), two helical and amphiphilic proteins that are clitical for normal respiration. The generation of non-natural mimics of SP-B and SP-C has previously been restlicted to step-by-step, sequence-specific synthesis, which results in discrete... Agent:

20130004456 - Composition of tumor-associated peptides and related anti-cancer vaccine for the treatment of glioblastoma (gbm) and other cancers: The present invention relates to immunotherapeutic peptides and their use in immunotherapy, in particular the immunotherapy of cancer. The present invention discloses tumor-associated T-helper cell peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions which stimulate anti-tumor immune responses. In... Agent: Immatics Biotechnologies Gmbh

20130004457 - Hepatitis c virus inhibitors: The present disclosure relates to compounds, compositions and methods for the treatment of hepatitis C virus (HCV) infection. Also disclosed are pharmaceutical compositions containing such compounds and methods for using these compounds in the treatment of HCV infection.... Agent: Bristol-myers Squibb Company

20130004458 - Small molecule inhibitors of retroviral assembly and maturation: Chemical compounds that disrupt retroviral assembly and maturation are presented herein. More particularly, this disclosure provides small molecule compounds that disrupt the formation and maturation of virus particles and methods of using such small molecules to treat HIV-1 infection.... Agent: New York Blood Center, Inc.

20130004459 - Methods, pharmaceutical compositions and kits for use in the treatment of adult t-cell leukemia/lymphoma: The present invention relates to methods, pharmaceutical compositions and kits for use in the treatment of Adult T-cell leukemia/lymphoma. More particularly, the present invention relates to a combination of an interferon, an arsenic compound and a reverse transcriptase inhibitor for the treatment of Adult T-cell leukemia/lymphoma.... Agent:

20130004460 - Silylated biomolecules: The invention concerns: a silylated biomolecule having the following formula (I): the process for the preparation of a silylated biomolecule of formula (I), the use of a silylated biomolecule of formula (I) to functionalize the surface of a support, a process for the preparation of a hydrogel by use of... Agent:

20130004462 - Modified factor viii and factor ix genes and vectors for gene therapy: The present invention relates to a modified and optimized Factor VIII or Factor IX nucleic acid for inclusion in a chimeric virus vector. Use of such vector can be used for treatment of hemophilia.... Agent:

20130004461 - Subfamily e simian adenoviruses a1321, a1325, a1295, a1309, a1316 and a1322 and uses thereof: Recombinant vectors comprise simian adenovirus A1321 (SAdV-A1321), SAdV-A1325, SAdV-A1295, SAdV-A1309, SAdV-A1316, and/or SAdV-A1322 sequences and a heterologous gene under the control of regulatory sequences. A cell line which expresses simian adenovirus SAdV-A1321, SAdV-A1325, SAdV-A1295, SAdV-A1309, SAdV-A1316, and/or SAdV-A1322 gene(s) is also disclosed. Methods of using the vectors and cell lines... Agent: The Trustees Of The University Of Pannsylvania

20130004471 - Gene therapy vectors for adrenoleukodystrophy and adrenomyeloneuropathy: The present invention provides compositions comprising retroviral vectors, transduced cells, and methods of using the same for gene therapy. In particular, the present invention relates to lentiviral vectors and cells transduced with those vectors to provide gene therapy to subjects having an adrenoleukodystrophy and/or adrenomyeloneuropathy.... Agent: Bluebird Bio, Inc.

20130004472 - Means and methods for improving the development and maturation of eggs and/or sperm in fish using hormones produced by transplanted cells: Methods and/or hormone-producing cells for improving the development and/or maturation of eggs and/or sperm in fish using hormone administration. The methods may comprise providing the fish with cells producing the hormone. Preferred hormones are fertility hormones such as luteinizing hormone (LH), follicle-stimulating hormone (FSH) or chorionic gonadotropin (CG) or a... Agent:

20130004470 - P27 and p21 in gene therapies: The expansion of a population of stem cells or progenitor cells, or precursors thereof, may be accomplished by disrupting or inhibiting p21cip1/waf1 and/or p27, cyclin dependent kinase inhibitors. In the absence of p27 activity, progenitor cells move into the cell cycle and proliferate; whereas in the absence of p21 activity,... Agent: The General Hospital Corporation

20130004463 - Dna damage repair promoter for oral application, and elastase activity inhibitor for oral application: e

20130004475 - Agent for increasing bifidobacteria and reducing the decrease of bifidobacteria in large intestine: The present invention provides a means and a method for effectively increasing Bifidobacteria in the large intestine. Specifically, the present invention relates to an agent for increasing Bifidobacteria and/or reducing the decrease of Bifidobacteria in the large intestine, which comprises spores of Bacillus subtilis and a means of delivering the... Agent:

20130004465 - Adherent cells from placenta and use of same in disease treatment: Methods for treating conditions by administration of placenta derived adherent stromal cells to a subject in thereof are provided. Such conditions include skeletal muscle defects, neuropathic pain, and myocardial infarction. Also provided are methods wherein the adherent stromal cells administered are cultured under 2 dimensional or 3 dimensional growth conditions.... Agent:

20130004469 - Engineered lumenized vascular networks and support matrix: Disclosed herein are capillary fabrication devices comprising living cells within a support medium. Culture of the cells produces viable lumenized capillary networks with natural or pre-determined geometries and ECM and basement membrane associated with the capillary networks. The capillary networks and the ECM and basement membrane detachable from the capillary... Agent: Indiana University Research And Technology Corporation

20130004468 - Methods of expanding myeloid cell populations and uses thereof: The present disclosure relates to a method of expanding myeloid progenitor cells by culturing an initial population of cells in a medium comprising a mixture of cytokines and growth factors that promote growth and expansion of the myeloid progenitor cells. The expanded cell population provides a source of cells as... Agent: Cellerant Therapeutics, Inc.

20130004464 - Multipotent adult stem cell population: The present invention relates to the identification, isolation, expansion and characterization of a specific type of adult stem cell. These adult stem cells are characterised in that they naturally express many of the markers of totipotency, which have hitherto generally been limited to embryonic cell populations. The cells of the... Agent:

20130004467 - Myelination of congenitally dysmyelinated forebrains using oligodendrocyte progenitor cells: One form of the present invention is directed to a method of remyelinating demyelinated axons by treating the demyelinated axons with oligodendrocyte progenitor cells under conditions which permit remyelination of the axons. Another aspect of the present invention relates to a method of treating a subject having a condition mediated... Agent: University Of Rochester

20130004466 - Myogenic differentiation of stem cells and and uses thereof: Disclosed are methods of differentiating stem cells into muscle cells by growing the cells in a myogenic culture medium. The differentiated cells can be used as a source of cells for transplantation in a patient in need thereof.... Agent:

20130004473 - Methods and biomarkers for the detection of dengue hemorrhagic fever: The present invention provides methods for detecting, analyzing, and identifying biomolecules used to identifying patient with dengue-like symptom who are at risk of DHF. The inventive method comprises detecting in a sample from a subject dengue infected patient one or more biomarkers selected from the group consisting of IL-10, fibrinogen,... Agent: The Board Of Regents Of The University Of Texas System

20130004474 - Soluble physiological chitosan formulations combined with platelet-rich plasma (prp) for tissue repair: The present disclosure relates to an activated polymer composition for use in repairing tissue of a patient comprising platelet-rich plasma (PRP), a chitosan solution, a salt such as NaCl or glycerol phosphate, and an activator such as at least one of CaCI2 and a mixture of thrombin/CaCI2.... Agent: Corporation De L'ecole Polytechnique De Montreal

20130004476 - Chimeric polypeptides and their use in bacterial decolonization: The present invention relates to chimeric polypeptides comprising a first portion, which comprises a bacteriocin cell wall-binding domain (CBD) and a second portion, which comprises an enzymatic active domain (EAD) selected from the lytic domain of a bacteriophage lysin, a bacteriocin and a bacterial autolysin. Provided are such chimeric polypeptides... Agent: Hyglos Invest Gmbh

20130004477 - Methods for treating inflammation and oxidative stress related diseases: This invention provides compositions and methods for treating inflammation related diseases. Particularly, the present invention provides methods and compositions of administering thiocyanate to treat inflammation related diseases, such as cystic fibrosis, lung disease, lung cancer, asthma, bronchitis, pancreatic disease, digestive track disease, diabetes, neurological disorder, cardio-vascular disease, atherosclerosis, arthritis, nephritis,... Agent:

20130004478 - Procoagulant peptides and their derivatives and uses therefor: The present invention is directed to a hemostatic or tissue sealing material having (a) a peptide having a sequence SEQ ID NO: 1 or an amino acid analog sequence thereof, and (b) a scaffold for said peptide or amino acid analogue sequence. The scaffold is preferably hemostatic, such as a... Agent:

20130004479 - Enzymatic peracid generation formulation: Disclosed herein are multi-component formulations for enzymatically producing aqueous solutions of peroxycarboxylic acids suitable for use in, e.g., disinfectant and/or bleaching applications. The multi-component peroxycarboxylic acid formulations comprise at least one carbohydrate esterase family 7 enzyme having perhydrolytic activity.... Agent:

20130004480 - Cd20 binding molecules for the treatment of copd: Use of CD20 binding molecules, such as anti-CD20 antibodies, for the treatment of chronic obstructive pulmonary disease (COPD).... Agent:

20130004484 - Anti-c-met antibody formulations: Provided herein are pharmaceutical formulations comprising a one-armed, anti-c-met antibody and uses of the same.... Agent: Genentech, Inc.

20130004488 - Anti-cancer agent delivery vehicles capable of improved loading: There is provided a conjugate of a delivery agent containing a chemical moiety and at least one flavonoid. The flavonoid exists in a monomeric form or dimeric form before conjugation and remains in the monomeric form or dimeric form after conjugation. Preferably, the conjugate comprises two flavonoids. The delivery agent... Agent: Agency For Science, Technology And Research

20130004481 - Anticancer therapy: The invention describes anti-cancer therapies comprising using dual Aurora kinase/MEK inhibitors as described herein.... Agent: Boehringer Ingelheim International Gmbh

20130004485 - Humanized and chimeric anti-properdin antibodies: An isolated anti-properdin antibody or antigen binding portion thereof includes a heavy chain variable domain including the 3CDRs in SEQ ID NO: 1 and light chain variable domain including the 3 CDRS in SEQ ID NO: 9.... Agent:

20130004483 - Medical methods and agents for use therein: The present invention provides an immunomodulatory agent for use in the local treatment of tumours, wherein the treatment comprises patient-specific optimisation of the dose of the immunomodulatory agent to identify the maximum therapeutic dose that does not induce an increase in the number of local regulatory T cells (Treg cells)... Agent: Alligator Bioscience Ab

20130004482 - Methods of treating breast cancer with anthracycline therapy: The application describes methods for screening subjects with breast cancer to determine if the breast cancer will be responsive to a breast cancer therapy including an anthracycline. The application also describes methods for treating subjects with breast cancer by screening them for the likelihood of the effectiveness of treating the... Agent: Washington University

20130004487 - Scd40l and placental growth factor (pigf) as biochemical marker combinations in cardiovascular diseases: The invention relates to novel markers of vascular inflammation and combinations thereof as diagnostic and prognostic tools in patients with cardiovascular diseases. The markers also act as tools that facilitate the selection of active ingredients for the treatment of such diseases, and finally act as starting points for the treatment... Agent: Siemens Healthcare Diagnostics Products Gmbh.

20130004486 - Treatment of vascularized pigment epithelial detachment with anti-vegf therapy: Methods for treating vascularized pigment epithelial detachment using anti-VEGF agents are disclosed.... Agent: Genentech, Inc.

20130004489 - Activin-actriia antagonists and uses for treating multiple myeloma: In certain aspects, the present invention provides compositions and methods for promoting bone growth and increasing bone density, as well as for the treatment of multiple myeloma.... Agent: Acceleron Pharma, Inc.

20130004491 - Antibodies against phosphorylcholine in combination therapy with biologic agents: Antibodies against PC, PC conjugate or bioactive components and/or fragments thereof for use in combination therapy with one or more biologic agents and/or stem cells are disclosed, as well as compositions comprising the antibodies in combination with one or more biologic agents and/or stem cells. Also disclosed are PC conjugates,... Agent:

20130004490 - Delivery of transthyretin across the blood-brain barrier as a treatment for alzheimer's disease: The invention provides a composition comprising transthyretin and an ICAM-1 targeting agent, wherein the transthyretin and ICAM-1 targeting agent are coupled together, as well as methods of preparing such compositions. The invention further provides a diabody capable of binding specifically to ICAM-1 and transthyretin. The invention also provides a method... Agent: Of Health And Human Services

20130004492 - Fgfr extracellular domain acidic region muteins: Fibroblast growth factor receptor (FGFR) extracellular domain (ECD) acidic region muteins that have been engineered to exhibit decreased tissue binding by increasing the number of acidic amino acid residues within the D1-D2 linker region are provided. Polynucleotides encoding FGFR ECD acidic region muteins are also provided. Methods of making FGFR... Agent: Five Prime Therapeutic Inc.

20130004495 - Anti-ngf antibodies for the treatment of various disorders: The present invention relates generally to methods of using anti-NGF antibodies in the treatment of various NGF-related disorders, including pain, asthma, arthritis and psoriasis. The methods are effective in treating these disorders in a patient without having a significant adverse effect on the immune system of the patient.... Agent: Genentech, Inc.

20130004493 - Epithelial membrane protein-2 (emp2) and proliferative vitroretinopathy (pvr): Methods of preventing retinal detachment associated with proliferative vitreoretinopathy are provided by administering agents which antagonize the activity or function of EMP2 to subjects at risk of the detachment.... Agent: The Regents Of The University Of California

20130004494 - Inhibition of p21 and use thereof for inducing tissue regeneration: The present invention embraces a method for inducing tissue regeneration using a p21 inhibitor as well as a bio-compatible tissue engineering product containing a p21 inhibitor.... Agent:

20130004496 - Monoclonal antibodies specific to hemagglutinin and neuraminidase from influenza virus h5-subtype or n1-subtype and uses thereof: Monoclonal antibodies and related binding proteins that bind specifically to the envelope glycoprotein of H5 subtypes or neuraminidase glycoprotein of N1 subtypes of avian influenza virus (AIV) are provided. The monoclonal antibodies and related binding proteins are useful for the detection of H5 and N1 subtypes of AIV, including H5N1... Agent: Temasek Life Sciences Laboratory Limited

20130004497 - Monoclonal antibodies specific to hemagglutinin and neuraminidase from influenza virus h5-subtype or n1-subtype and uses thereof: Monoclonal antibodies and related binding proteins that bind specifically to the envelope glycoprotein of H5 subtypes or neuraminidase glycoprotein of N1 subtypes of avian influenza virus (AIV) are provided. The monoclonal antibodies and related binding proteins are useful for the detection of H5 and N1 subtypes of AIV, including H5N1... Agent: Temasek Life Sciences Laboratory Limited

20130004498 - Dosing for treatment with anti-egfl7 antibodies: The present invention concerns dosing of anti-EGFL7 antibodies for cancer therapy.... Agent: Genentech, Inc.

20130004500 - Antibody against serotype a lipopolysaccharide of pseudomonas aeruginosa: Provided is a novel antibody having an excellent antibacterial activity against P. aeruginosa. By using plasmablasts obtained from cystic fibrosis patients with chronic P. aeruginosa pulmonary infection as starting materials, antibodies which bind to LPS of a P. aeruginosa strain of serotype A and which have excellent antibacterial activities in... Agent: Meiji Seika Pharma Co., Ltd.

20130004499 - Antibody against serotype e lipopolysaccharide of pseudomonas aeruginosa: Provided is a novel antibody having an excellent antibacterial activity against P. aeruginosa. By using plasmablasts obtained from cystic fibrosis patients with chronic P. aeruginosa pulmonary infection as starting materials, antibodies which bind to LPS of a P. aeruginosa strain of serotype E and which have excellent antibacterial activities in... Agent: Meiji Seika Pharma Co., Ltd.

20130004501 - Human il-23 antigen binding proteins: Antigen binding proteins that bind to human IL-23 protein are provided. Nucleic acids encoding the antigen binding protein, vectors, and cells encoding the same as well as use of IL-23 antigen binding proteins for diagnostic and therapeutic purposes are also provided.... Agent: Amgen Inc.

20130004502 - Influenza targets: The present invention relates to a pharmaceutical composition comprising an inhibitor of influenza virus replication. Yet another aspect is a screening method for identification of new targets for the prevention, alleviation or/and treatment of influenza.... Agent: Max-planck-gesellschaft Zur Foerderung Der Wissenschaften E.v.

20130004503 - Engineered anti-tslp antibody: The invention relates to binding compounds that specifically bind to human TSLP, as well as uses thereof, e.g., in the treatment of inflammatory disorders.... Agent: Schering Corporation

20130004504 - Method of modulating phenylalanine hydroxylase structure and function: A method of affecting a multimeric protein comprising an equilibrium of assembly states, each assembly having a plurality of units, wherein each of the units comprises a first complementary surface and a second complementary surface and wherein the first complementary surface of one unit is associated with the second complementary... Agent: Fox Chase Cancer Center

20130004505 - Human monoclonal antibodies derived from human b cells and having neutralizing activity against influenza a viruses: The present invention relates to human monoclonal antibodies derived from human B cells present in the blood of patients who had recovered from infection with influenza A viruses, wherein the monoclonal antibodies have neutralizing activity against influenza A viruses. The anti-influenza A virus monoclonal antibody of the present invention has... Agent: Celltrion, Inc.

20130004509 - Braf mutations conferring resistance to braf inhibitors: The present invention relates to methods, compositions and kits concerning resistance to treatment with an anti-cancer agent, specifically an inhibitor of BRAF. In particular embodiments, the invention concerns mutations in a BRAF sequence that confer resistance to a BRAF inhibitor. Identification of such mutations in a BRAF sequence allows the... Agent:

20130004508 - Engineered anti-tslp antibody: The invention relates to binding compounds that specifically bind to human TSLP, as well as uses thereof, e.g., in the treatment of inflammatory disorders.... Agent: Schering Corporation

20130004506 - Method for treating pathologies associated with hypoxia using mif inhibitors: Methods are provided for treating pathologies associated with hypoxia with an MIF inhibitor. Methods are also provided for treating a subject having, or at risk for pulmonary hypertension, with an MIF inhibitor. Methods are also provided for treating a subject having, or at risk from, a CNS disorder associated with... Agent:

20130004507 - Methods of administering anti-tnfalpha antibodies: Methods of treating disorders in which TFNα activity is detrimental via biweekly, subcutaneous administration of human antibodies, preferably recombinant human antibodies, that specifically bind to human tumor necrosis factor α (hTNFα) are disclosed. The antibody may be administered with or without methotrexate. These antibodies have high affinity for hTNFα (e.g.,... Agent: Abbott Biotechnology Ltd.

20130004510 - Vaccine: Compositions and methods for the treatment or prevention of Gram-negative bacterial strain infection are provided herein. Methods for the manufacture of said compositions are also provided herein.... Agent:

20130004513 - Agents for treating disease: Provided are methods of screening to identify molecules capable of binding to CD4 and capable of activating CD4+CD25+ regulatory T cells. Further provided are antibodies and antibody fragments capable of activating CD4+CD25+ regulatory T cells and methods and uses involving the antibodies and fragments thereof.... Agent:

20130004511 - Composition comprising inhibitors of irs-1 and of vegf: Compositions comprising an inhibitor of IRS-1 and an inhibitor of the VEGF pathway, which compositions rare useful for treating an angiogenic disease. The specification also relates to kits comprising an inhibitor of IRS-1 and an inhibitor of the VEGF pathway, as well as methods of treating angiogenic diseases using such... Agent: Gene Signal International Sa

20130004518 - Cyclic amine bace-1 inhibitors having a benzamide substituent: Also disclosed are pharmaceutical compositions and methods of treating cognitive or neurodegenerative diseases comprising the compounds of formula I in combination with a β-secretase inhibitor other than those of formula I, an HMG-CoA reductase inhibitor, a gamma-secretase inhibitor, a non-steroidal anti-inflammatory agent, an N-methyl-D-aspartate receptor antagonist, a cholinesterase inhibitor or... Agent: Merck, Sharp & Dohme Corp.

20130004517 - Disc-1 pathway activators in the control of neurogenesis: The invention relates to methods of treating neurological disorders in a subject, by activating a DISC1 pathway. Methods of promoting neurogenesis in adult neural progenitor cells, enhancing nerve generation and treating GSK3 disorders as well as related compositions are also provided.... Agent: Massachusetts Institute Of Technology

20130004516 - Drug for inflammatory bowel disease: Anti-CD81 antibody displays not only a remission induction effect, but also a long-term remission maintenance effect on inflammatory bowel disease when administered in a single dose, and is therefore effective as a drug for maintaining remission from inflammatory bowel disease. Moreover, anti-CD81 antibody is effective as a drug for the... Agent: Dainippon Sumitomo Pharma Co., Ltd.

20130004515 - Methods for treating reperfusion injuries: The present invention relates to treating a tissue in a mammal from the effects of reperfusion using flagellin... Agent: Cleveland Biolabs, Inc.

20130004512 - Nucleic acid molecules encoding bank1 splice variants: The present invention relates to a new splice variant of BANK1, the use of SNPs in BANK1 for diagnostics and the use of antagonists to modulate BANK1 and/or the BANK1 pathway.... Agent: Merck Serono Sa

20130004514 - Therapeutic antibodies: The present invention concerns human antibodies recognising the human C5a receptor. By binding to C5aR the antibodies inhibit C5a signalling, whereby the pro-inflammatory signal is inhibited. Based on the role of C5a and its receptor in stimulation of inflammation the invention further relates to therapeutic use of said human anti-C5aR... Agent: Novo Nordisk A/s

20130004520 - Methods and materials related to hair pigmentation and cancer: This document relates to methods and materials for determining whether or not a horse contains a Grey allele. For example, diagnostic methods such as nucleic acid-based detection methods and materials such as nucleic acid probes and primer pairs that can be used to determine whether or not a horse contains... Agent: Melica Hb

20130004519 - Smoci, tenascin-c and brain cancers: The present invention relates to a method for treating brain cancer in a subject by administering to said subject a therapeutically effective amount of a modulator of the interaction between SPARC related modular calcium binding 1 (SMOC1) and tenascin-C, for example a specific antibody or a siRNA. The present invention... Agent:

20130004521 - Targeting cancer stem cells: Provided is a method of determining the level of resistance or sensitivity of cancer stem cells to a death receptor agonist. The method includes detecting the level of IAP in one or more DR5/DDX3/IAP complexes in or from the cancer stem cells. Also provided is a method of killing cancer... Agent: The Uab Research Foundation

20130004522 - Phototriggered nanoparticles for cell and tissue targeting: The present invention relates, in part, to a novel and simple particulate system that targets and binds any tissue selectively upon light illumination. The particulate system can be used for targeted delivery of substances to predefined cells or tissues in an individual.... Agent:

20130004523 - Therapeutic compositions and methods for delivery of active agents cleavably linked to nanoparticles: Various embodiments of the present invention pertain to therapeutic compositions that comprise: (1) an active agent (e.g., paclitaxel); and (2) a nanoparticle (e.g., gold nanoparticle). In such embodiments, the active agent is covalently linked to the nanoparticle through a cleavable linker (e.g., a linker containing a hydrazone species). Other embodiments... Agent: William Marsh Rice University

20130004524 - Conjugated proteins: The present invention relates to modified therapeutic proteins, such as e.g. coagula-tion factors. In particular, the present invention relates to conjugated Factor VIII molecules such as e.g. FVII, FVIII, or FIX comprising a hydrophobic side group.... Agent: Novo Nordisk A/s

20130004525 - Inactivating pathogens with oxidizing agents for vaccine production: The present disclosure provides methods for producing a vaccine composition containing a pathogen that is rendered noninfectious by exposure to hydrogen peroxide. The methods disclosed herein are suitable for the preparation of vaccines for a wide variety of pathogens, including viruses, bacteria and parasites. The disclosure also provides vaccine compositions... Agent: Oregon Health And Science University

20130004526 - Utilization of dialkylfumarates: The present invention relates to the use of certain dialkyl fumarates for the preparation of pharmaceutical preparations for use in transplantation medicine or for the therapy of autoimmune diseases and said compositions in the form of micro-tablets or pellets. For this purpose, the dialkyl fumarates may also he used in... Agent: Biogen Idec International Gmbh

20130004527 - Contiguous overlapping peptides for treatment of ragweed pollen allergy: Contiguous overlapping peptides (COPs) for the treatment of allergic patients by Specific Immunotherapy (SIT) are provided from the sequence of the major allergen of ragweed pollen Amb a 1. Such peptides while providing all potential T cell epitopes are devoid of the three-dimensional structure of the original allergen, therefore reducing... Agent: Anergis S.a.

20130004528 - Direct analysis of antigen-specific immune response: Provided herein are methods for the determination of antigen-specific CD4+ T cell phenotype and/or frequency, which is useful for detecting or monitoring immune function, directing immunotherapy to the use of those epitopes or antigen fragments that elicit an allergic reaction (e.g., as measured by detection of a Th2 response) and/or... Agent: Benaroya Research Institute

20130004529 - Vaccines and methods for using the same: Improved anti-HIV immunogens and nucleic acid molecules that encode them are disclosed. Immunogens disclosed include those having consensus sequences for HIV Subtype A Envelope protein, those having consensus sequences for HIV Subtype B Envelope protein, those having consensus sequences for HIV Subtype C Envelope protein, those having consensus sequences for... Agent:

20130004531 - Immunogens from uropathogenic escherichia coli: Disclosed herein are various polypeptides that can be included in immunogenic compositions specific for pathogenic E. coli strains. The polypeptides have cellular locations which render them accessible to the immune system. The genes encoding the polypeptides were initially identified as being present in uropathogenic strain 536 but absent from non-pathogenic... Agent: Novartis Vaccines And Diagnostics Srl

20130004530 - Vaccine composition: Neisserial immunogenic compositions and vaccines, their manufacture and methods for the use of such compositions in medicine are provided herein.... Agent:

20130004532 - Process for manufacturing vaccines: The present application discloses an improved method for conducting saccharide—protein conjugation reactions using carbodiimide condensation chemistry. Depending on the nature of the saccharide or protein carrier involved, the quality of the conjugate may be improved by adding one of the reaction components slowly to the reaction mixture. Immunogenic compositions are... Agent:

20130004533 - Platelet-derived growth factor-bb production promotor, and mesenchymal stem cell production accelerator, stem cell stabilizer and dermal regenerator comprising the same: An agent comprising one or more components selected from among cowberry derivatives, mangosteen derivatives, scutellaria root derivatives, inositol and inositol phosphate, as an active ingredient, is a novel agent that can effectively promote production of platelet-derived growth factor-BB (PDGF-BB), which contributes to production of mesenchymal stem cells and stabilization of... Agent: Shiseido Company, Ltd.

20130004534 - Inactivation of reverse transcriptases by azido-diarylpyrimidines: Azido-diarylpyrimidine (azido-DAPY) compounds, and compositions containing such compounds, are provided. In addition, methods of using azido-diarylpyrimidines to inactivate reverse transcriptases, prepare inactivated viruses, and treat or prevent viral infections are also provided.... Agent:

20130004535 - Multiple vaccination including serogroup c meningococcus: Various improvements to vaccines that include a serogroup C meningococcal conjugate antigen, including: (a) co-administration with acellular B. pertussis antigen; (b) co-administration with an inactivated poliovirus antigen; (c) supply in a kit together with a separate pneumococcal conjugate component, which may be in a liquid form; and (d) use in... Agent:

20130004536 - Multiple vaccination including serogroup c meningococcus: Various improvements to vaccines that include a serogroup C meningococcal conjugate antigen, including: (a) co-administration with acellular B. pertussis antigen; (b) co-administration with an inactivated poliovirus antigen; (c) supply in a kit together with a separate pneumococcal conjugate component, which may be in a liquid form; and (d) use in... Agent:

20130004537 - Bacterium comprising a regulated rfah nucleic acid: The present invention encompasses a recombinant bacterium comprising a regulated rfaH nucleic acid, as well as a vaccine comprising said recombinant bacterium. Other embodiments of the present invention encompass a recombinant bacterium comprising a regulated rfaH nucleic acid and a regulated rfc nucleic acid, while additional embodiments encompass a recombinant... Agent: The Arizona Board Of Regents For And On Behalf Of Arizona State University

20130004538 - Methods and compositions for modulating an immune response with immunogenic oligonucleotides: This document relates to compositions and methods for modulating an immune response. For example, compositions of immunostimulatory CpG oligonucleotides derived from retroviral genomes are provided.... Agent:

20130004539 - Methods for preventing and treating staphylococcus aureus colonization, infection, and disease: The invention provided herein relates to a method of preventing a Staphylococcus aureus colonization and/or infection by administering a Streptococcus pneumoniae strain, antigen thereof, or homologous staphylococcal antigen. The invention further relates to a method of treating a disease associated with a Staphylococcus aureus colonization and/or infection by administering a... Agent:

20130004540 - Bifidobacterium strain: Bifidobacterium strain AH121A is significantly immunomodulatory following oral consumption. The strain is useful as an immunomodulatory biotherapeutic agent.... Agent:

20130004551 - Biotinylated hexadecasaccharides, preparation and use thereof: The invention concerns novel biotinylated hexadecasaccharides of general formula (I) wherein: Biot is a biotin derivative; R, R1 and R2, represent independently of one another a C1-C6 alkoxy or and —OSO3; R3 represents a C1-C6 alkoxy or an —OSO3, or R3 constitutes a —O—CH2— bridge; Pe represents a saccharide concatenation;... Agent: Sanofi

20130004549 - Cell support and bone regeneration material: e

20130004542 - Composition: The invention provides a composition for inhalation comprising a pharmaceutically acceptable glassy matrix and at least one bioactive material within the matrix, wherein the glassy matrix comprises a metal ion salt, wherein the composition is substantially free of polyols and is in the form of a powder and wherein the... Agent:

20130004543 - Fibronectin: growth factor chimeras: Isolated protein complexes are provided comprising growth factors such as IGF-I, IGF-II, EGF, bFGF, or KGF and fibronectin, or at least domains thereof that enable binding to and activation of both a growth factor receptor, and an integrin receptor-binding domain of fibronectin. These protein complexes include synthetic proteins where the... Agent: Queensland University Of Technology

20130004546 - Hydrogel of microspheres: In particular, the invention relates to a composition comprising a gel of at least one first biodegradable polymer forming a first agent for filling soft tissues in an animal, and a suspension in this gel of microspheres with an average diameter between 5 and 50 micrometres, said microspheres comprising 50... Agent: Biopharmex Holding Limited

20130004548 - Medical devices having pharmacological active agent releasing material: An embodiment of the present invention relates to a therapeutically active composition for the treatment of arteriosclerosis, and a pharmacological active agent-releasing medical device, the efficiency of which is increased by combination with a compound that releases alkaline-earth metal ions.... Agent:

20130004547 - Oral vaccines produced and administered using edible micro-organisms including lactic acid bacterial strains: The invention provides for anti-pathogen vaccines produced in recombinant bacteria and/or transgenic plants and administered through standard vaccine introduction methods or oral administration. In one embodiment, the vaccine is administered through the consumption of the edible plant as food, or the bacteria administered orally. The present invention also provides a... Agent: Vaxgene Corporation

20130004541 - Polymer nanofiber scaffold for a heparin / fibrin based growth factor delivery system: A growth factor delivery scaffold combines a heparin/fibrin-based delivery system (HBDS) with a backbone based on polymer nanofibers for tissue (e.g., tendon and ligament) repair. The scaffold has improved surgical handling properties compared to the gelatinous consistency of the prior art HBDS system and retains the capability for delivering mesenchymal... Agent: Washington University In St. Louis

20130004545 - Slow release pharmaceutical compositions of iloperidone: A slow release pharmaceutical composition comprising iloperidone or its active metabolites and a slow release agent is described. Also disclosed is slow release pharmaceutical composition comprising iloperidone or its active metabolites, wherein the slow release composition is a combination of a controlled release composition and an immediate release composition.... Agent: Lupin Limited

20130004550 - Sustained-release solid preparation for oral use: It is intended to avoid dose dumping of a drug and improve the dissolution properties of the drug in the lower gastrointestinal tract, and thereby provide a sustained-release matrix preparation for oral administration that reliably exhibits its main pharmacological effect when orally administered once or twice a day. The present... Agent: Daiichi Sankyo Company, Limited

20130004544 - Synthetic antibacterial clay compositions and method of using same: The present invention is directed to synthetic bactericidal compositions having clay like properties and a method of using these compositions to topically treat bactenally-caused skin infections and skin diseases. The compositions within the scope of the invention compnse a bactericidal effective amount of a reducing agent, such as pyπte, marcasite,... Agent:

20130004556 - Chewable foams for cosmetic products: The invention relates to novel chewable foams which are useful in the oral care sector and which are based on polyurethane-polyureas, to a method for the production of these novel chewable foams, and also to use thereof.... Agent: Bayer Materialscience Ag

20130004555 - Cosmetic compositions comprising esters based on 2-propylheptanol: The invention relates to the use of esters of 2-propylheptanol with benzoic acid and/or benzoic acid derivatives in cosmetic and/or pharmaceutical preparations. The compounds are distinguished by their particularly light sensory impression.... Agent: CognisIPManagement Gmbh

20130004554 - Microalgae-derived compositions for improving the health and appearance of skin: Provided herein are microalgal skin care compositions and methods of improving the health and appearance of skin. Also provided are methods of using polysaccharides for applications such as topical personal care products, cosmetics, and wrinkle reduction compositions. The invention also provides novel decolorized microalgal compositions useful for improving the health... Agent: Solazyme, Inc.

20130004553 - O/w emulsion composition: An O/W emulsion composition which is excellent in UV protection ability, formulation stability, and feeling in use. The O/W emulsion composition includes the following components (a) and (b): (a) organic UV absorbers comprising the following components (a1), (a2), and (a3): (a1) octocrylene, (a2) ethylhexyl methoxycinnamate, (a3) 4-t-butyl-4′-methoxydibenzoylmethane; and (b) a... Agent: Shiseido Company, Ltd.

20130004552 - Water dispersible nonwoven fabric material: Non-woven multi-layered fabric materials which include two external layers made of continuous filaments of a water-soluble or water dispersible polymer having an internal layer of a water-absorbent, flushable material are provided. Methods for making such non-woven multi-layered fabric materials, are also provided.... Agent: Suominen Corporation

20130004557 - Antimicrobial resin compositions: Methods for making antimicrobial resins and for forming coatings comprising antimicrobial resins on substrate surfaces are disclosed. The methods involve providing a mixture comprising about 15 weight % to about 80 weight % of a hydrophilic acrylic oligomer, about 10 weight % to about 80 weight % of a multifunctional... Agent: Baxter International Inc.

20130004558 - Polymer composition and molded articles shaped of the same: The present invention relates to a molded article which is shaped of a polymer composition comprising 100 parts by weight of an olefin-based polymer, and 0.01 to 100 parts by weight of a C10-90 saturated chain hydrocarbon and/or liquid paraffin and 0.01 to 200 parts by weight of a releasable... Agent: Sumitomo Chemical Company, Limited

20130004559 - Flat self-curling permeable sheet membrane: A flat self-curling permeable sheet membrane containing a matrix formed of crosslinked biopolymeric fibers. The matrix self-curls into a predetermined shape upon absorption of an aqueous fluid and is permeable to molecules having molecular weights not greater than 1×106 daltons. Also disclosed is a method of preparing such a flat... Agent: Collagen Matrix, Inc.

20130004560 - Polymer nanofilm coatings: Disclosed herein are nanofilm coatings for implantable medical devices comprising a diblock or triblock copolymer (PEO-PMMA or PMOXA-PDMS-PMOXA, respectively). Such nanofilms, may be used, for example, as amphiphilic supports for therapeutic agents. These materials are conducive towards the formation of active substrates for a suite of biological and medical applications.... Agent: Northwestern University

20130004562 - Process for preparing purified nucleic acid and the use thereof: The invention relates to a nucleic acid preparation with a content of below 1% protein, preferably below 0.1% protein, free of ethidium bromide, phenol, cesium chloride and detergents based on octyl phenol poly(ethylene glycol ether)n and with a content of below 1 EU/mg DNA of endotoxins. Said preparation is suitable... Agent: Roche Diagnostics Gmbh

20130004561 - Therapies for preventing or suppressing clostridium difficile infection: The present invention provides an antibody composition comprising ovine antibodies, for use in the prevention or treatment of C. difficile infection wherein the antibodies bind to a C. difficile toxin, and wherein said prevention or treatment is by oral delivery of the antibody composition. Also provided is a pharmaceutical composition... Agent:

20130004564 - Antimicrobial peptides: The present invention relates to novel peptides having antimicrobial activity, and compositions containing the same.... Agent: Centre National De La Recherche Scientifique

20130004566 - Methods of treating hypertriglyceridemia: In various embodiments, the present invention provides methods of treating and/or preventing cardiovascular-related disease and, in particular, a method of blood lipid therapy comprising administering to a subject in need thereof a pharmaceutical composition comprising eicosapentaenoic acid or a derivative thereof... Agent: Amarin Pharmaceuticals Ireland Limited

20130004567 - Methods of treating hypertriglyceridemia: In various embodiments, the present invention provides methods of treating and/or preventing cardiovascular-related disease and, in particular, a method of blood lipid therapy comprising administering to a subject in need thereof a pharmaceutical composition comprising eicosapentaenoic acid or a derivative thereof.... Agent: Amarin Pharmaceuticals Ireland Limited

20130004568 - Methods of treating hypertriglyceridemia: In various embodiments, the present invention provides methods of treating and/or preventing cardiovascular-related disease and, in particular, a method of blood lipid therapy comprising administering to a subject in need thereof a pharmaceutical composition comprising eicosapentaenoic acid or a derivative thereof.... Agent: Amarin Pharmaceuticals Ireland Limited

20130004563 - Multiparticulate s-adenosylmethionine compositions and related methods: Multiparticulate compositions having S-adenosylmethionine an active ingredient are disclosed. The multiparticulates have spheroidal core comprising S-adenosylmethionine, microcrystalline cellulose, and hydroxypropyl methylcellulose; a sub-coat comprising hydroxypropyl methyl cellulose on the spheroidal core; and an enteric coat on the sub-coated spheroidal core. The average diameter of the particulates is about 0.1-3 mm.... Agent:

20130004569 - Oral antimicrobial pharmaceutical compositions: The present invention relates to oral pharmaceutical compositions with controlled and/or programmed release containing at least one active ingredient having antimicrobial and/or anti-infectious activity for the treatment of infections of the large intestine, in particular the colon.... Agent: Cosmo Technologies Limited

20130004565 - Proteolytic enzyme formulations: Preferred embodiments of the present invention relate to proteolytic enzyme formulations. More specifically, several embodiments relate to a proteolytic formulation to facilitate digestion, metabolism, degradation of target compounds, and systemic enzymatic action. Embodiments for improving oxygenation and reducing plaque are also provided.... Agent:

20130004570 - Nutritional supplement for use under physiologically stressful conditions: In one embodiment of the present invention, a pharmaceutically-acceptable single-dosage formulation consists essentially of about 500 mg of vitamin C; about 400 IUs of vitamin D3; about 125 IUs of vitamin E; about 25 mg of vitamin B1; about 3.4 mg of vitamin B2; about 35 mg of niacin; about... Agent: Vertical Pharmaceuticals, Inc.

20130004571 - Orally effective methylphenidate extended release powder and aqueous suspension product: An oral methylphenidate powder which is reconstitutable into a final oral aqueous sustained release formulation containing at least about 50%, or at least about 80% by weight water based on the total weight of the suspension, is provided. The powder is a blend containing a combination of an uncoated methylphenidate-ion... Agent: Tris Pharma, Inc.

20130004572 - Stable pharmaceutical composition and methods of using same: The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent cardiovascular-related diseases.... Agent: Amarin Pharmaceuticals Ireland Limited

20130004573 - Controlled release compositions comprising a combination of isosorbide dinitrate and hydralazine hydrochloride: The invention relates to a controlled release composition comprising a combination of isosorbide dinitrate and hydralazine, such as hydralazine hydrochloride, that in operation delivers the drug in a pulsed or multi-modal manner for the treatment of angina, ischaemic heart disease, arterial hypertension and related disease conditions. Preferably, the isosorbide dinitrate... Agent: Alkermes Pharma Ireland Limited

20130004574 - Combination pharmaceutical composition and methods of treating functional diseases or conditions of gastrointensinal tract: The present invention provides a method of treating a disease or condition of functional etiology of the gastrointestinal tract, said method comprising administering to a patient in need thereof a combination pharmaceutical composition comprising a) an activated-potentiated form of an antibody to a histamine, b) an activated-potentiated form of an... Agent:

20130004575 - Controlled release formulations using intelligent polymers: A controlled release pharmaceutical composition comprises (a) topiramate or a pharmaceutically acceptable salt thereof, (b) a first intelligent polymer component; and (c) a second intelligent polymer component having opposite wettability characteristics to the first intelligent polymer component. The polymer components are effective for controlled release of the pharmaceutically active substance... Agent: Valeant International (barbados) Srl

20130004576 - Rifaximin powder, process for preparing the same and controlled release compositions containing said rifaximin useful for obtaining a long-lasting effect: The present invention describes rifaximin powder and to a process for preparing the same. The invention relates also to a pharmaceutical composition in solid form comprising said rifaximin, pharmaceutically acceptable excipients and optionally other ingredients. The compositions according to the invention are suitable for oral administration and are characterized by... Agent: Alfa Wassermann S.p.a.

20130004577 - Coated tablet: A main object of the present invention is to provide a novel coated tablet which contains a drug having a guanidino group and does not suffer an obvious color change even when packed in a one-dose pack together with a drug having a (5-methyl-2-oxo-1,3-dioxol-4-yl)methyl (DMDO) group. The present invention provides... Agent: Nippon Shinyaku

20130004578 - Solid pharmaceutical dosage formulation: The present invention provides a pharmaceutical dosage formulation, and more particularly, a pharmaceutical dosage formulation comprising an HIV protease inhibitor.... Agent: Abbvie Inc.

20130004579 - Use of plant lectins to target leukocytes: The present invention provides compositions and methods for targeting an antigen to leukocytes, delivering an antigen to leukocytes, increasing antigen uptake by leukocytes, and/or enhancing an immune response. In some embodiments, compositions and methods of the present invention comprise a conjugate comprising an antigen and a plant lectin or a... Agent:

20130004580 - Divalent cation/talc containing compositions and methods for treating and/or preventing enzymatic irritation: Compositions and methods for treating and/or preventing conditions such as diaper rash and atopic dermatitis are disclosed. The compositions and methods are particularly useful in the treatment and prevention of diaper rash and diaper dermatitis caused by the prolonged contact of human skin with body waste. The methods employ the... Agent:

20130004581 - Controlling uptake by cells: Methods and devices for causing uptake of materials by cells, temporary using local chemical environment modification. The modification may be caused chemically by reducing pH. The uptake method is passive and does not require bioactivity of the cells.... Agent: Ramot At Tel-aviv University Ltd.

20130004582 - Composition and method to alleviate joint pain: Beneficial and synergistic effects for alleviating joint pain and symptoms of osteoarthritis and/or rheumatoid arthritis have been found with krill oil and/or marine oil in combination with other active constituents, including astaxanthin and polymeric hyaluronic acid or sodium hyaluronate (hyaluronan) in an oral dosage form.... Agent: U.s. Nutraceuticals, LLC D/b/a Valensa International

20130004583 - Cell homogenate from stem cells derived from growing deer antlers, a method of obtaining it and its use: The subject of the present invention is a bioactive cell homogenate produced from cells belonging to the MIC-1 stem cell line derived from growing deer antlers (Cervidae) deposited at the DSMZ under the accession DSM ACC2854, a method of producing and using it. The present invention also encompasses a pharmaceutical... Agent:

20130004584 - Anti-inflammatory, radioprotective, and longevity enhancing capabilities of ceriumoxide nanoparticles: The present invention provides cerium oxide nanoparticles for use both in therapeutic compositions in vivo and in research in vitro. The cerium oxide nanoparticles are of known range of sizes having biological properties that are reproducible and beneficial. Pharmaceutical and other compositions are provided, as are methods of treatment.... Agent:

20130004587 - Bioactive acid agrichemical compositions and use thereof: Bioactive agrichemical concentrates and compositions having improved bioactivity comprising combinations of acid solutions and conventional bioactive agrichemical actives or formulations.... Agent: Sciessent LLC

20130004586 - Biologically efficacious compositions, articles of manufacture and processes for producing and/or using same: Compositions, solid polymeric compositions, and/or articles of manufacture are provided that can include a polymer matrix having a plurality of ion-exchange particles distributed therein. Products by process are provided that can include prior to solidifying the polymeric precursors, blending the precursors with ion-exchange particles to form a mixture, and solidifying... Agent:

20130004585 - Method of manufacturing antimicrobial implants of polyetheretherketone: Methods of fabricating implantable medical devices, preferably with PEEK, having antimicrobial properties, are disclosed. The antimicrobial effect is produced by incorporating ceramic particles containing antimicrobial metal cations into molten PEEK resin, which is subsequently allowed to cool and set in its final shape achieved by injection molding, cutting and machining... Agent: Difusion Technologies, Inc.

20130004588 - Divalent cation containing compositions and methods for treating and/or preventing enzymatic irritation: Compositions and methods for treating and/or preventing conditions such as diaper rash and atopic dermatitis are disclosed. The compositions and methods are particularly useful in the treatment and prevention of diaper rash and diaper dermatitis caused by the prolonged contact of human skin with body waste. The methods employ the... Agent:

20130004589 - Divalent cation/anion pair containing compositions and methods for treating and/or preventing enzymatic irritation: Compositions and methods for treating and/or preventing conditions such as diaper rash and atopic dermatitis are disclosed. The compositions and methods are particularly useful in the treatment and prevention of diaper rash and diaper dermatitis caused by the prolonged contact of human skin with body waste. The methods employ the... Agent:

20130004590 - Zinc oxide/acid containing compositions and methods for treating and/or preventing enzymatic irritation: Compositions and methods for treating and/or preventing conditions such as diaper rash and atopic dermatitis are disclosed. The compositions and methods are particularly useful in the treatment and prevention of diaper rash and diaper dermatitis caused by the prolonged contact of human skin with body waste. The methods employ the... Agent:

20130004591 - Formulation for relief of cold and flu symptoms: A nutritional composition or functional food composition is provided comprising homeopathic ingredients for relieving the symptoms of colds and/or flus, in combination with traditional herbal and nutraceutical ingredients, and are efficacious as antipathogens. The formulation includes ingredients balanced in a synergistic manner to elicit complementary effects which both reduce the... Agent:

20130004592 - Pharmaceutical compositions for parenteral administration: The invention comprises various aqueous PEG-carbohydrate-lipid based formulations of pharmaceutical active ingredients including compositions for intravenous injections. This invention relates to methods and compositions for improving solubility and the safety profile of pharmaceutical compounds. More particularly, the present invention relates to employing PEG-carbohydrate-lipid conjugates for formulating drug compositions having increased... Agent:

20130004593 - Container, use, dialyzer or preparation unit as well as method of manufacturing a concentrate: The present invention relates to a container comprising at least a dry concentrate, wherein the dry concentrate is designed such that it forms at least one acid liquid concentrate, or a part of an acid liquid concentrate, which is suitable for manufacturing at least on dialysis solution, on its dissolving... Agent: Fresenius Medical Care Deutschland Gmbh

20130004594 - Oral rehydration composition: Disclosed are oral rehydration compositions with sucrose, or alternatively fructose and glucose in a 1:1 ratio. The composition further comprises an osmolarity of below 250 mOsm/L, and sodium below 75 meq/L. Further disclosed are methods of treatment using the same.... Agent: Drip Drop, Inc.

20130004595 - Compositions and methods for treating skin conditions: Provided are skin treatment compositions comprising an Oenothera biennis oil in an amount of about 1% v/v to about 30% v/v, a vitamin B12 in an amount of about 0.07% m/v to about 1.0% m/v, and a vitamin E in an amount of about 4% m/v to about 12% m/v.... Agent:

20130004597 - Herbal medicinal composition and extract thereof for inhibiting growth of cancer cells: The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae fructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2SO4, and Atractylodis Rhizoma. The residual examples are described... Agent:

20130004596 - Pharmaceutical composition for treating diabetes containing quamoclit angulata extract: The present invention relates to a pharmaceutical composition for treating diabetes and its complications, containing a Quamoclit angulata extract, and more particularly to a Quamoclit angulata extract, a pharmaceutical composition for preventing or treating diabetes and its complications, a pharmaceutical composition for preventing or delaying aging, and a pharmaceutical composition... Agent: Korea Research Institute Of Bioscience And Biotechnology

20130004598 - Herbal preparation for anemia and a manufacture method thereof: A herbal extract for anemia is obtained by a process including steps of drying, by providing a herbal material comprising dry mulberry and dry Acanthopanax senticosus in a weight ratio of 2:1 to 1:2, with the water content of the herbal material lower than 10%; extracting, by soaking the herbal... Agent:

20130004599 - Formulation for transdermal delivery to promote sleep: A topically administered composition to promote sleep, comprising Valeriana officinalis, alpha lipoic acid, at least one natural herb, Dead Sea mineral salts, and, a cream or gel carrier material suitable for topical application.... Agent: Masada Health & Beauty Corporation

20130004600 - Animal repellent composition: A liquid animal repellent composition having a liquid phase and an oil phase, the composition having oleoresins of capsicum, black pepper and rosemary along with surfactants and preservatives. A pH adjuster is also utilized.... Agent:

20130004601 - Appetite regulating dietary supplement: A dietary supplement for regulating the appetite of an individual is described. The dietary supplement comprises at least one mechanical satiety regulator, and at least one chemical satiety inducer, and may additionally comprise at least one thermogen, and/or at least one side effect remover. The dietary supplement induces satiety based... Agent:

20130004602 - Lotion composition and fibrous structure comprising same: A lotion composition containing a microcrystalline wax, a fibrous structure containing such lotion composition and a method for making such fibrous structure and/or lotion composition are provided.... Agent:

20130004603 - Wasp, hornet, and yellowjacket spray repellant and nest pesticide: Methods for killing insects and a nest are disclosed. The methods may be used to disrupt a colony of nest-dwelling insects. The insects may include wasps, hornets, and yellowjackets.... Agent: Sterling International Inc.

20130004604 - Dark chocolate delivery system for a combination of dietary supplements and pharmaceuticals: An edible, chewable dark chocolate candy for the oral delivery of dietary supplements and pharmaceutical compounds. The-chocolate formed or molded solid candy contains at least one active ingredient that is blended with the chocolate candy during conching of the chocolate candy. A method for manufacturing the chewable chocolate candy is... Agent: Hero Nutritional Products LLC

20130004605 - Herbal medicinal composition and extract thereof for inhibiting growth of cancer cells: The present invention relates to herbal medicinal compositions and extracts thereof for inhibiting growth of cancer cells. One of the examples described in the present invention comprises Forsythiae (ructus, Menthae Herba, Gardeniae Fructus, Scutellariae Radix, Lophatheri Folium, Glycyrrhizae Radix, Rhei Rhizoma, Na2SO4, and Atractylodis Rhizoma. The residual examples are described... Agent: