| Dna sequences encoding novel growth/differentiation factors -> Monitor Keywords |
|
|
 
Dna sequences encoding novel growth/differentiation factorsRelated Patent Categories: Drug, Bio-affecting And Body Treating Compositions, Dentifrices (includes Mouth Wash), Ferment Containing (e.g., Enzymes, Bacteria, Etc.)Dna sequences encoding novel growth/differentiation factors description/claimsThe Patent Description & Claims data below is from USPTO Patent Application 20070031351, Dna sequences encoding novel growth/differentiation factors. Brief Patent Description - Full Patent Description - Patent Application Claims
[0001] This application is a divisional application of U.S. Ser. No. 11/105,344 filed Apr. 14, 2005, which is a divisional application of U.S. Pat. No. 7,067,637 issued Jun. 27, 2006, which is a divisional application of Ser. No. 6,120,760 issued Sep. 19, 2000, which is a CIP of PCT/EP93/00350 filed Feb. 12, 1993. [0002] The present invention relates to DNA sequences encoding novel growth/differentiation factors of the TGF-.beta. family. In particular, it relates to novel DNA sequences encoding TGF-.beta.-like proteins, to the isolation of said DNA sequences, to expression plasmids containing said DNA, to microorganisms transformed by said expression plasmid, to the production of said protein by culturing said transformant, and to pharmaceutical compositions containing said protein. The TGF-.beta. family of growth factors comprising BMP, TGF, and Inhibin related proteins (Roberts and Sporn, Handbook of Experimental Pharmacology 95 (1990), 419-472) is of particular relevance in a wide range of medical treatments and applications. These factors are useful in processes relating to wound healing and tissue repair. Furthermore, several members of the TGF-.beta. family are tissue inductive, especially osteo-inductive, and consequently play a crucial role in inducing cartilage and bone development. [0003] Wozney, Progress in Growth Factor Research 1 (1989), 267-280 and Vale et al., Handbook of Experimental Pharmacology 95 (1990), 211-248 describe different growth factors such as those relating to the BMP (bone morphogenetic proteins) and the Inhibin group. The members of these groups share significant structural similarity. The precursor of the protein is composed of an aminoterminal signal sequence, a propeptide and a carboxyterminal sequence of about 110 amino acids, which is subsequently cleaved from the precursor and represents the mature protein. Furthermore, their members are defined by virtue of amino acid sequence homology. The mature protein contains the most conserved sequences, especially seven cysteine residues which are conserved among the family members. The TGF-.beta.-like proteins are multifunctional, hormonally active growth factors. They also share related biological activities such as chemotactic attraction of cells, promoting cell differentiation and their tissue-inducing capacity, such as cartilage- and bone-inducing capacity. U.S. Pat. No. 5,013,649 discloses DNA sequences encoding osteo-inductive proteins termed BMP-2 proteins (bone morphogenetic protein), and U.S. patent applications Ser. Nos. 179 101 and 179 197 disclose the BMP proteins BMP-1 and BMP-3. Furthermore, many cell types are able to synthesize TGF-.beta.-like proteins and virtually all cells possess TGF-.beta. receptors. [0004] Taken together, these proteins show differences in their structure, leading to considerable variation in their detailed biological function. Furthermore, they are found in a wide variety of different tissues and developmental stages. Consequently, they might possess differences concerning their function in detail, for instance the required cellular physiological environment, their lifespan, their targets, their requirement for accessory factors, and their resistance to degradation. Thus, although numerous proteins exhibiting tissue-inductive, especially osteo-inductive potential are described, their natural role in the organism and, more importantly, their medical relevance must still be elucidated in detail. The occurrence of still-unknown members of the TGF-.beta. family relevant for osteogenesis or differentiation/induction of other tissues is strongly suspected. However, a major problem in the isolation of these new TGF-.beta.-like proteins is that their functions cannot yet be described precisely enough for the design of a discriminative bioassay. On the other hand, the expected nucleotide sequence homology to known members of the family would be too low to allow for screening by classical nucleic acid hybridization techniques. Nevertheless, the further isolation and characterization of new TGF-.beta.-like proteins is urgently needed in order to get hold of the whole set of induction and differentiation proteins meeting all desired medical requirements. These factors might find useful medical applications in defect healing and treatments of degenerative disorders of bone and/or other tissues like, for example, kidney and liver. [0005] Thus, the technical problem underlying the present invention essentially is to provide DNA sequences coding for new members of the TGF-.beta. protein family having mitogenic and/or differentiation-inductive, e.g. osteo-inductive potential. [0006] The solution to the above technical problem is achieved by providing the embodiments characterized in claims 1 to 17. Other features and advantages of the invention will be apparent from the description of the preferred embodiments and the drawings. The sequence listings and drawings will now briefly be described. [0007] SEQ ID NO. 1 shows the nucleotide sequence of MP-52, i.e. the embryo derived sequence corresponding to the mature peptide and most of the sequence coding for the propeptide of MP-52. [0008] Some of the propeptide sequence at the 5'-end of MP-52 has not been characterized so far. [0009] SEQ ID NO. 2 shows the nucleotide sequence of MP-121, i.e. the liver derived sequence corresponding to the mature peptide, the sequence coding for the propeptide of MP-121, and sequences 5' and 3' to the coding region. [0010] The start codon begins with nucleotide 128 of SEQ ID NO.2. The sequence coding for the mature MP121 polypeptide begins with nucleotide 836 of SEQ ID NO. 2. The stop codon begins with nucleotide 1184 of SEQ ID NO. 2. The sequence coding for the precursor protein has a length of 1056 bp. The sequence coding for the propeptide has a length of 708 bp and the sequence coding for the mature peptide has a length of 348 bp. [0011] SEQ ID NO. 3 shows the amino acid sequence of MP-52 as deduced from SEQ ID NO. 1. [0012] SEQ ID NO. 4 shows the amino acid sequence of MP-121 as deduced from sequence SEQ ID NO.2. The sequence of the mature polypeptide begins with amino acid 237 of SEQ ID NO. 4. The precursor protein has a length of 352 amino acids. The propeptide and the mature peptide have a length of 236 and 116 amino acids, respectively. [0013] SEQ ID NO. 5 shows a part of the nucleotide sequence of the liver derived sequence of MP-121. [0014] SEQ ID NO. 6 shows a part of the nucleotide sequence of the embryo derived sequence of MP-52. [0015] The shorter DNA-sequences SEQ ID NO. 5 and 6 can be useful for example for isolation of further members of the TGF-.beta.-protein family. [0016] FIG. 1 shows an alignment of the amino acid sequences of MP-52 and MP-121 starting from the first of the seven conserved cysteines with some related proteins. 1a shows the alignment of MP-52 with some members of the BMP protein family (SEQ ID NOS: 22-27); 1b shows the alignment of MP-121 with some members of the Inhibin protein family SEQID NOS: 28-31). * indicates that the amino acid is the same in all proteins compared; + indicates that the amino acid is the same in at least one of the proteins compared with MP-52 (FIG. 1a) or MP-121 (FIG. 1b). [0017] FIG. 2 shows the nucleotide sequences of the oligonucleotide primer as used in the present invention and an alignment of these sequences with known members of the TGF-.beta. family (SEQ ID NOS: 32-53). M means A or C; S means C or G; R means A or G; and K means G or T. 2a depicts the sequence of the primer OD (SEQ ID NOS: 32); 2b shows the sequence of the primer OID (SEQ ID NOS: 42). [0018] The present invention relates to novel TGF-.beta.-like proteins and provides DNA sequences contained in the corresponding genes. Such sequences include nucleotide sequences comprising the sequence TABLE-US-00001 (SEQ ID NO: 7) ATGAACTCCATGGACCCCGAGTCCACA and (SEQ ID NO: 8) CTTCTCAAGGCCAACACAGCTGCAGGCACC [0019] and in particular sequences as illustrated in SEQ ID Nos. 1 and 2, allelic derivatives of said sequences and DNA sequences degenerated as a result of the genetic code for said sequences. They also include DNA sequences hybridizing under stringent conditions with the DNA sequences mentioned above and containing the following amino acid sequences: TABLE-US-00002 (SEQ ID NO: 9) Met-Asn-Ser-Met-Asp-Pro-Glu-Ser-Thr or (SEQ ID NO: 10) Leu-Leu-Lys-Ala-Asn-Thr-Ala-Ala-Gly-Thr. [0020] Although said allelic, degenerate and hybridizing sequences may have structural divergencies due to naturally occurring mutations, such as small deletions or substitutions, they will usually still exhibit essentially the same useful properties, allowing their use in basically the same medical applications. [0021] According to the present invention, the term "hybridization" means conventional hybridization conditions, preferably conditions with a salt concentration of 6.times.SSC at 62.degree. to 66.degree. C. followed by a one-hour wash with 0.6.times.SSC, 0.1% SDS at 62.degree. to 66.degree. C. The term "hybridization" preferably refers to stringent hybridization conditions with a salt concentration of 4.times.SSC at 62.degree.-66.degree. C. followed by a one-hour wash with 0.1.times.SSC, 0.1% SDS at 62.degree.-66.degree. C. [0022] Important biological activities of the encoded proteins, preferably MP-52, comprise a mitogenic and osteo-inductive potential and can be determined in assays according to Seyedin et al., PNAS 82 (1985), 2267-2271 or Sampath and Reddi, PNAS 78 (1981), 7599-7603. [0023] The biological properties of the proteins according to the invention, preferably MP-121, may be determined, e.g., by means of the assays according to Wrana et al. (Cell 71, 1003-1014 (1992)), Ling et al. (Proc. Natl. Acad. of Science, 82, 7217-7221 (1985)), Takuwa et al. (Am. J. Physiol., 257, E797-E803 (1989)), Fann and Patterson (Proc. Natl. Acad. of Science, 91, 43-47 (1994)), Broxmeyer et al. (Proc. Natl. Acad. of Science, 85, 9052-9056 (1988)), Green et al. (Cell, 71, 731-739 (1992)), Partridge et al. (Endocrinology, 108, 213-219 (1981)) or Roberts et al. (PNAS 78, 5339-5343 (1981)). [0024] Preferred embodiments of the present invention are DNA sequences as defined above and obtainable from vertebrates, preferably mammals such as pig or cow and from rodents such as rat or mouse, and in particular from primates such as humans. Continue reading about Dna sequences encoding novel growth/differentiation factors... Full patent description for Dna sequences encoding novel growth/differentiation factors Brief Patent Description - Full Patent Description - Patent Application Claims Click on the above for other options relating to this Dna sequences encoding novel growth/differentiation factors patent application. ###  How KEYWORD MONITOR works... a FREE service from FreshPatents1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored. 3. Each week you receive an email with patent applications related to your keywords. Start now! - Receive info on patent apps like Dna sequences encoding novel growth/differentiation factors or other areas of interest. ### Previous Patent Application: Screening method for identification of compounds suitable for treatment of oral cavity malodor associated with consumption of garlic Next Patent Application: Beta-carotene modulation of gene expression Industry Class: Drug, bio-affecting and body treating compositions ### FreshPatents.com Support Thank you for viewing the Dna sequences encoding novel growth/differentiation factors patent info. IP-related news and info Results in 0.12072 seconds Other interesting Feshpatents.com categories: Canon USA , Celera Genomics , Cephalon, Inc. , Cingular Wireless , Clorox , Colgate-Palmolive , Corning , Cymer , 174 |
 * Protect your Inventions * US Patent Office filing 
PATENT INFO |
|
