| Development of diagnostic kit for the detection of chrysanthemum virus b -> Monitor Keywords |
|
Development of diagnostic kit for the detection of chrysanthemum virus bRelated Patent Categories: Chemistry: Molecular Biology And Microbiology, Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip, Involving Virus Or BacteriophageDevelopment of diagnostic kit for the detection of chrysanthemum virus b description/claimsThe Patent Description & Claims data below is from USPTO Patent Application 20070202494, Development of diagnostic kit for the detection of chrysanthemum virus b. Brief Patent Description - Full Patent Description - Patent Application Claims FIELD OF INVENTION [0001] The present invention relates to a primers useful for detection of Chrysanthemum virus B in plants. [0002] More particularly this invention relates to a method for detection of Chrysanthemum virus B in plants by using a primers useful for detection of Chrysanthemum virus B in plants. [0003] The present invention also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants. BACKGROUND OF INVENTION [0004] Chrysanthemum is one of the important cut flower worldwide. It ranks 3.sup.rd in world among the cut flowers. Chrysanthemum is commonly propagated vegetatively and this practice allows the viruses, once established in the plants to be perpetuated from generation to generation. Quality of germplasm and minimizing the infection of the viruses to different cultivars, proper diagnosis and control for viral diseases are not only desirable but also essential for improving crop productivity. [0005] Chrysanthemum virus B (CVB), a carlavirus has a narrow host range and distributed worldwide wherever Chrysanthemums are grown. It infects Chrysanthemum and about 10 other species in 5 dicotyledonous families (Brunt, A. A., Crabtree, K., Dallwitz, M. J., Gibbs, A. J., and Watson, L. (Edts) Viruses of Plants, CAB International, UK. Page No. 398-400). CVB is widespread throughout the country. During a survey of chrysanthemum cvs. all tested commercial stocks were found to show disease incidence ranging between 40% to 95% (Verma, N., Sharma, A., Ram, R., Hallan, V., Zaidi, A. A. and Garg, I.D. (2003) Detection, identification and incidence of Chrysanthemum B carlavirus in chrysanthemums in India. Crop Prot. 22, 425-429). At the Institute of Himalayan Bioresource Technology, Palampur chrysanthemum cultivars were collected from twenty eight geographical areas. Twenty eight isolates were cloned, sequenced and sequences were submitted to Genbank. Different primer pairs were designed (EMBL Nucleotide Sequence Accession Numbers: AJ566196, AJ566195, AJ609493, AJ609494, AJ609495, AJ609496, AJ609497, AJ609498, AJ609499, AJ609500) and used successfully for identification and characterization of an Indian isolates of CVB. This also shows wide spread occurrence of CVB in chrysanthemum being cultivated in different parts of country. [0006] CVB was first reported from Netherlands as a member of carlavirus group (Noordam, D. 1952 Virusziekten bij chrysant in Nedeland. With a summary: virus disease of Chrysanthemum morifolium in Netherlands. Tijdschrift over Plantenziekten. 58, 121-190). CVB infection results in loss of flower quality, mild leaf mottling, vein clearing or a combination of these is found (Hollings, M. and Stone, O. M. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Symptoms ranging from mosaic, malformation and slight to severe necrosis have also been reported (Hakkart, F. A. and Matt, D. Z. (1974) Variation of Chrysanthemum virus B. J. Plant Path. 80, 97-103). [0007] Traditional methods of diagnosis of plant viruses require bioassay through an indicator plant, symptom observation, host range determination, and particle morphology and vector relations. These processes are time consuming and require a lot of labour. However, progress in molecular biology, biochemistry and immunology has led to the development of new accurate, rapid and less labour-intensive methods of virus detection. There are various diagnostic techniques available in the field of viral diagnostics like precipitation tests, agglutination tests, fluorescent antibody test, enzyme linked immunosorbant assay, dot immunosorbant assay, tissue blotting assay, western blotting, nucleic acid hybridization with radio labeled and non radio-labeled probes and polymerase chain reaction based detection. [0008] Immunological techniques have been successfully used for the detection of CVB from Chrysanthemum morifolium (Raizada, R. K., Srivastava, K. M., Chandra, G. and Singh, B. P. (1989) Comparative evaluation of sero-diagnostic methods for detection of Chrysanthemum virus B in chrysanthemum. Indian J. Exp. Biol. 27, 1094-1096).Serological methods were used effectively for diagnosis of Chrysanthemum virus B (Zaidi, A. A., Ram, R., Zaidi, S. N. H. and Mukherjee, D. (1990) Diagnosis of viruses in some ornamental plants with special reference to serological methods: New Developments. Indian Rev. Life Sci. 13, 157-174). [0009] Enzyme linked immunosorbant assay (ELISA) and other modified form of ELISA have been extensively used for the detection of CVB from Chrysanthemum morifolium (Verma, N., Sharma, A., Ram, R., Hallan, V., Zaidi, A. A. and Garg, I. D. (2003) Detection, identification and incidence of Chrysanthemum B carlavirus in chrysanthemum in India. Crop Prot. 22, 425-429). It is highly effective in detecting the CVB from leaves. Using the DAS-ELISA, status of the viral disease was analyzed for 36 cultivars of Chrysanthemum morifolium. Some cultivars also exhibit mild leaf mottling, vein clearing or a combination of these (Hollings, M. and Stone, O. M. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Therefore, it is important to have reliable and quick diagnostics to diagnose the latent infection and for establishing the serological relationship between the isolates of the Chrysanthemum virus B. Similar to ELISA, Immunosorbant Electron Microscopy (ISEM) also revealed easy detection of CVB from leaves (Verma, N., Sharma, A., Ram, R., Hallan, V., Zaidi, A. A. and Garg, I. D. (2003) Detection, identification and incidence of Chrysanthemum B carlavirus in chrysanthemum in India. Crop Prot. 22, 425-429). Similar to ELISA, ISEM could detect the CVB from chrysanthemum leaves. [0010] During last decade, RT-PCR has been used with varying degree of modification for detection of viral genome in infected plants (Yamamoto, H., Kiguchi, T. and Ohya, T. (2001) 52.sup.nd Annual Report of the Society of Plant Protection of North Japan. 85-86). Partial sequence of the Chrysanthemum virus B has been worked out and it was 3.4 kb (Levay, K. E. and Zavriev, S. K. (1991) Nucleotide sequence and gene organisation of the 3'-terminal region of Chrysanthemum virus B genomic RNA. J. Gen. Virol. 72(10), 2333-7). At IHBT, Palampur approximately 5 Kb of the CVB genome has been sequenced (EMBL Nucleotide Sequence Accession Numbers: AJ617281, AJ617282, AJ617287, AJ585240, AJ704627, AJ580956, AJ633542, AJ633540, and AJ633629). On the basis of sequencing of various geographical isolates, three biological isolates have been identified including the earlier reported Russian isolate, which resembles one of the three isolates. OBJECTS OF THE INVENTION [0011] The main object of the present is to provide primers useful for detection of Chrysanthemum virus B in plants. [0012] Another object of the present invention is to provide a method for detection of Chrysanthemum virus B in plants by using designed primers useful for detection of Prunus necrotic ringspot virus in plants. [0013] Still another object of the present invention is to provide a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants. SUMMARY OF THE INVENTION [0014] The present invention relates to a method for detection of Chrysanthemum virus B in plants using desined primers of TABLE-US-00001 Sequence ID 1: Upstream primer ATGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT [0015] It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: [0016] a) polyclonal antibodies against Chrysanthemum virus B coat protein in plants; [0017] b) conjugate labeled with alkaline phosphatase; [0018] c) coating buffer; [0019] d) extraction buffer; [0020] e) ECI buffer; [0021] f) PNP buffer; [0022] g) Instruction manual. DETAILED DESCRIPTION OF THE INVENTION [0023] Specific sequence of CVB was detected in total RNA extract of infected plants by initially transcribing the viral RNA into cDNA and then amplifying by polymerase chain reaction. Like ELISA and ISEM, PCR also readily detects CVB in leaves. [0024] Thus DAS-ELISA, ISEM and RT-PCR are the suitable techniques to detect CVB infecting Chrysanthemum. RT-PCR and nucleic acid hybridization are sensitive tools to detect the virus but they require sophisticated instruments which are costly also. Till now ELISA have been used extensively used for diagnosis of virus infecting chrysanthemum and other plants, as these are quick, easy to perform, can be used even in field conditions and are cost effective. These can be exploited in the form of diagnostic kits. [0025] For the development of diagnostic kit coat protein gene of CVB submitted to EMBL data (Vide Accession No. AJ580956) was amplified using the especially designed primers having restriction enzyme sites compatible for directional and inframe cloning in pGex-2TK vector. Amplified product was cloned into pGex 2TK vector by transforming into BL21 competent cells. [0026] Cloned coat protein gene was induced in transformed E. coli cells grown in YT medium. Expression conditions were standardized against IPTG concentration, time of incubation, growth conditions and method of cell disruption. Culture was induced using 0.25 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG) final concentration at 0.5 OD.sub.600 for 3 hrs at 25.degree. C., along with disruption of cell using both lysozyme (10 mg/ml) and sonication (pulse on for 9.0 sec. and pulse off for 4 sec.) to give the maximum expressed recombinant coat protein yield in soluble form. Continue reading about Development of diagnostic kit for the detection of chrysanthemum virus b... Full patent description for Development of diagnostic kit for the detection of chrysanthemum virus b Brief Patent Description - Full Patent Description - Patent Application Claims Click on the above for other options relating to this Development of diagnostic kit for the detection of chrysanthemum virus b patent application. ### 1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored. 3. Each week you receive an email with patent applications related to your keywords. Start now! - Receive info on patent apps like Development of diagnostic kit for the detection of chrysanthemum virus b or other areas of interest. ### Previous Patent Application: Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue Next Patent Application: Device and method for maintaining a plurality of beads in suspension Industry Class: Chemistry: molecular biology and microbiology ### FreshPatents.com Support Thank you for viewing the Development of diagnostic kit for the detection of chrysanthemum virus b patent info. IP-related news and info Results in 0.12164 seconds Other interesting Feshpatents.com categories: Daimler Chrysler , DirecTV , Exxonmobil Chemical Company , Goodyear , Intel , Kyocera Wireless , 174 |
* Protect your Inventions * US Patent Office filing
PATENT INFO |
|