| Cng2b: a novel human cyclic nucleotide-gated ion channel -> Monitor Keywords |
|
Cng2b: a novel human cyclic nucleotide-gated ion channelRelated Patent Categories: Chemistry: Molecular Biology And Microbiology, Measuring Or Testing Process Involving Enzymes Or Micro-organisms; Composition Or Test Strip Therefore; Processes Of Forming Such Composition Or Test Strip, Involving Nucleic AcidCng2b: a novel human cyclic nucleotide-gated ion channel description/claimsThe Patent Description & Claims data below is from USPTO Patent Application 20060240465, Cng2b: a novel human cyclic nucleotide-gated ion channel. Brief Patent Description - Full Patent Description - Patent Application Claims CROSS-REFERENCES TO RELATED APPLICATIONS [0001] The present application claims priority to U.S. Ser. No. 60/226,253, filed Aug. 17, 2000, herein incorporated by reference in its entirety. STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT [0002] Not applicable. FIELD OF THE INVENTION [0003] The invention provides isolated nucleic acid and amino acid sequences of CNG2B, antibodies to CNG2B, methods of detecting CNG2B, and methods of screening for modulators of cyclic nucleotide-gated cation channels using biologically active CNG2B. The invention further provides, in a computer system, a method of screening for mutations of human CNG2B genes as well as a method for identifying a three-dimensional structure of human CNG2B polypeptides. BACKGROUND OF THE INVENTION [0004] Cyclic nucleotide gated cation channels (CNG) are a class of non-selective cation channels that are opened by direct binding of cyclic nucleotides such as cGMP and cAMP. CNG channels are highly permeable to Na.sup.+ and Ca.sup.2+ and their activation leads to depolarization and increases in internal Ca.sup.2+ concentrations. These channels can link changes in cytoplasmic cyclic nucleotide levels to changes in cellular excitability, secretion of neurotransmitters and the stimulation of calcium-dependent pathways. [0005] CNG family channel proteins are multimers and can be formed by at least two functionally distinct classes of subunits. The two classes of subunits, alpha and beta, share a common motif of 6 transmembrane domains, a pore motif and a cytoplasmic cyclic nucleotide binding domain (Finn et al., Annu. Rev. Physiol. 58:395-426:1996). CNG alpha subunits can form functional channels as homomultimers, i.e., all subunits contributing to the channel pore are identical. Beta subunits, in contrast, can only form functional channels when expressed with an alpha subunit. These heteromultimeric channels show functional properties consistent with native CNG channels (Gerstner, et al., J. Neurosci. 20(4):1324-1332, 2000; Finn, et al, Annu. Rev. Physiol. 58:395-426, 1996). For example, coexpression of alpha and beta subunits occurs in retinal rod cells where the alpha subunit CNGA1 forms a heteromultimer with the beta subunit CNGB1 (CNG4) (Gerstner, et al., J. Neurosci. 20(4):1324-1332, Feb. 15, 2000). [0006] CNG channels are important for sensory signal transduction in retinal and olfactory and taste bud cells in response to primary sensory stimuli such as light and aerosolized or dissolved molecules (Ding, C, et al., Am. J. Physiol. 272 (Cell Physiol. 41): C1335-C1344, 1997). In photoreceptor cells, CNG channels are open in darkness due to a high basal concentration of cGMP. This causes a tonic depolarization of the membrane and constitutive neurotransmitter release. Upon stimulation by light, cGMP levels drop, closing the CNG channels. This in turn causes a hyperpolarization of the membrane, a drop in the internal Ca.sup.2+ concentration, and a decrease in the release of neurotransmitter (Finn, et al., Annu. Rev. Physiol. 58:395-426, 1996). [0007] CNG channels have been found in a number of tissues, suggesting that these channels may link a variety of stimuli to changes in membrane potential and cytoplasmic calcium levels (Ding, et al., Am. J. Physiol. 272 (Cell Physiol. 41):C1335-C1344, 1997; Kingston P, Synapse 32:1-12, 1999). For instance, retinal and olfactory CNG channels are expressed in various parts of the brain (Ding, et al., Am. J. Physiol. 272 (Cell Physiol. 41):C1335-C1344, 1997; Kingston P, Synapse 32:1-12, 1999). Because these channels are highly permeable to Ca.sup.2+, they may stimulate Ca.sup.2+-dependent pathways that have significant effects on neuronal activity. More directly, they may contribute to neuronal activity by providing excitatory depolarizations. CNG channels may also interact with other second messenger systems such as the Nitric Oxide-pathway to provide the longer lasting changes that are important mechanisms in learning and memory (Kingston, Synapse 32:1-12, 1999). CNG channels have been found in the testis, and through the regulation of the internal Ca.sup.2+ concentration, may be involved in chemotaxis of sperm (Weyand, et al., Nature 368:859-863, 1994). Expression of CNG channels has also been noted in heart, aorta and kidney, where they may play a role in the regulation of heart rate, blood pressure and electrolyte transport, respectively (Finn et al., Ann. Rev. Physiol. 1996, 58:395-426). The fill scope of CNG channel function is not yet entirely understood, but it is clear that they play a key role in many physiological processes. SUMMARY OF THE INVENTION [0008] The current invention provides the first isolation and characterization of human CNG2B, a novel subunit of a cyclic nucleotide gated cation channel. The present invention provides both the nucleotide and amino acid sequence of CNG2B, as well as methods of assaying for modulators of CNG2B, antibodies to CNG2B, and methods of detecting CNG2B nucleic acids and proteins. [0009] In one aspect, the present invention provides an isolated nucleic acid encoding a polypeptide comprising a subunit of a cation channel, the polypeptide: (i) forming, with at least one CNG alpha subunit, a cation channel having the characteristic of cyclic nucleotide-gating or nitric oxide gating; and (ii) comprising an amino acid sequence having at least 95% identity to SEQ ID NO:1. [0010] In another aspect, the present invention provides an isolated nucleic acid encoding a CNG2B polypeptide, the nucleic acid specifically hybridizing under stringent conditions to a nucleic acid comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3. [0011] In another aspect, the present invention provides an isolated nucleic acid encoding a CNG2B polypeptide, the nucleic acid comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:2 or SEQ ID NO:3. [0012] In one embodiment, the nucleic acid encodes a polypeptide comprising an amino acid sequence of SEQ ID NO:1. In another embodiment, the nucleic acid comprises a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3. [0013] In another embodiment, the nucleic acid is amplified by primers that selectively hybridize under stringent hybridization conditions to the same sequence as the primers selected from the group consisting of: TABLE-US-00001 (SEQ ID NO:4) GCAGATCTTTCAGAACTGTGAGGCCA (SEQ ID NO:5) CCTGCCCTCTTCATCTTTGGAAGTTC (SEQ ID NO:6) GCCAACATCAAGAGCCTAGGTTATTC (SEQ ID NO:7) GGATGATCTACAGACCAAGTTTGCTCG (SEQ ID NO:8) ATGAGCCAGGACACCAAAGTGAAGAC (SEQ ID NO:9) GTTGATGATGCTGATCTCCCCAAAG (SEQ ID NO:10) GGATGATGAGGTTATACATGACTGGG (SEQ ID NO:11) AGGCTAGCAACTTCCTGGCCTTGGAT (SEQ ID NO:12) GCGAAAGCTTCCACCATGAGCCAGGACACCAAAGTG and (SEQ ID NO:13) CATGTCTAGAATGGGGATGGGGTCACTCTGGACCT. [0014] In another embodiment, the nucleic acid selectively hybridizes under moderately stringent hybridization conditions to a nucleic acid comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3. In another aspect, the present invention provides an isolated nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid encoding an amino acid sequence of SEQ ID NO:1. [0015] In another aspect, the present invention provides a method of detecting a nucleic acid, the method comprising contacting the nucleic acid with an isolated nucleic acid, as described above. [0016] In another aspect, the present invention provides expression vectors comprising the nucleic acids of the invention, and host cells comprising such expression vectors. [0017] In another aspect, the present invention provides an isolated polypeptide comprising a subunit of a cation channel, the polypeptide: (i) forming, with at least one CNG alpha subunit, a cation channel having the characteristic of cyclic nucleotide-gating; and (ii) comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:1. [0018] In one embodiment, the polypeptide specifically binds to antibodies generated against a polypeptide comprising an amino acid sequence of SEQ ID NO:1. In another embodiment, the polypeptide comprises an alpha subunit of a homomeric cyclic nucleotide gated cation channel. In another embodiment, the polypeptide comprises an alpha subunit of a heteromeric cyclic nucleotide gated cation channel. In another embodiment, the polypeptide has a molecular weight of between about 61 kD to about 71 kD. In another embodiment, the polypeptide has an amino acid sequence of human CNG2B. In another embodiment, the polypeptide has an amino acid sequence of SEQ ID NO:1. [0019] In another aspect, the present invention provides an antibody that specifically binds to any of the CNG2B polypeptides described herein. Continue reading about Cng2b: a novel human cyclic nucleotide-gated ion channel... Full patent description for Cng2b: a novel human cyclic nucleotide-gated ion channel Brief Patent Description - Full Patent Description - Patent Application Claims Click on the above for other options relating to this Cng2b: a novel human cyclic nucleotide-gated ion channel patent application. ### 1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored. 3. Each week you receive an email with patent applications related to your keywords. Start now! - Receive info on patent apps like Cng2b: a novel human cyclic nucleotide-gated ion channel or other areas of interest. ### Previous Patent Application: Clinically intelligent diagnostic devices and methods Next Patent Application: Compositions and methods employing 5' phosphate-dependent nucleic acid exonucleases Industry Class: Chemistry: molecular biology and microbiology ### FreshPatents.com Support Thank you for viewing the Cng2b: a novel human cyclic nucleotide-gated ion channel patent info. IP-related news and info Results in 0.64337 seconds Other interesting Feshpatents.com categories: Accenture , Agouron Pharmaceuticals , Amgen , AT&T , Bausch & Lomb , Callaway Golf 174 |
* Protect your Inventions * US Patent Office filing
PATENT INFO |
|