Chemistry: molecular biology and microbiology patents - Monitor Patents Logo icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents

USPTO Class 435  |  Browse by Industry: Previous - Next | All     monitor keywords
06/2009 | Recent  |  15: Apr | Mar | Feb | Jan | 14: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | 13: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | 12: Dec | Nov | Oct | Sep | Aug | July | June | May | April | Mar | Feb | Jan | 11: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | 10: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan |  | 09: Dec | Nov | Oct | Sep | Aug | Jl | Jn | May | Apr | Mar | Fb | Jn |  | 2008 | 2007 |

Chemistry: molecular biology and microbiology June invention type 06/09

Below are recently published patent applications awaiting approval from the USPTO. Recent week's RSS XML file available below.
Listing for abstract view: USPTO application #, Title, Abstract excerpt,Patent Agent. Listing format for list view: USPTO National Class full category number, title of the patent application.
06/25/2009 > patent applications in patent subcategories. invention type

20090162830 - Reagents and methods for classifying leukocytes: A reagent for classification of leukocytes includes (a) at least two cationic surfactants; (b) at least one organic compound bearing a hydrophobic group and an anionic group; (c) a buffer for adjusting pH into a range of approximately 2-8. Also disclosed is a method for classifying leukocytes with the reagent.... Agent: Mindray C/o Stoel Rives LLP

20090162831 - human parvovirus: The present invention relates to the discovery of a new human parvovirus, methods of detecting the parvovirus and diagnosing parvovirus infection, methods of treating or preventing parvovirus infection, and methods for identifying anti-parvoviral compounds.... Agent: Townsend And Townsend And Crew, LLP

20090162832 - Functional viral vectors for the overexpression or extinction of particular genes in plants, and applications: The invention relates to the use of genes which, in plants, encode proteins with a functional diversity in terms of silencing, comprising the selection of the gene with the level of effectiveness in order to construct a plant viral vector having the function of overexpressing or silencing particular genes.... Agent: Nixon & Vanderhye, PC

20090162834 - Molecular sequence of swine retrovirus and methods of use: Purified nucleic acid which can specifically hybridize with the sequence of swine retroviruses.... Agent: Choate, Hall & Stewart LLP

20090162833 - Test device for rapid diagnostics: Devices for detecting analytes or analogues thereof in a biological sample are disclosed. The device includes a solid support. The solid support has several juxtaposed zones. The sample is able to migrate from a sample receiving zone towards a detection zone. The analyte, if present, is detected in the detection... Agent: Knobbe Martens Olson & Bear LLP

20090162845 - Affinity tag nucleic acid and protein compositions, and processes for using same: The present invention concerns compositions and processes that use affinity tags for isolating, and detecting or quantifying analytes, including nucleic acids, proteins and polypeptides. Compositions include nucleic acid compositions and protein compositions with affinity binding pairs, including metal binding peptides and immobilized metals, or peptide affinity groups.... Agent: Enzo Biochem, Inc.

20090162852 - Baalc expression as a diagnostic marker for acute leukemia: Overexpression of the gene, BAALC, in biological samples from a patient is prognostic for tumor aggressiveness and unfavorable patient outcome. The present invention provides polynucleotide primers and probes for assaying for overexpression of BAALC transcripts. Kits containing the primers and probes are also provided. Also provided are antibodies for assaying... Agent: Calfee Halter & Griswold, LLP

20090162864 - Biological substance detection cartridge,biological substance detection apparatus, and biological substance detection method: A biological substance detection cartridge, including: a reaction vessel for reacting a probe with a specific biological substance included in a sample solution, the reaction vessel having a region for fixing the probe for detecting the biological substance; a porous membrane facing the inside of the reaction vessel; a gas-liquid... Agent: Harness, Dickey & Pierce, P.L.C

20090162865 - Breast cancer related protein, gene encoding the same, and method of diagnosing breast cancer using the protein and gene: An isolated protein having an amino acid sequence of SEQ ID No. 4 and having an activity inducing apoptosis, and a gene encoding the same are provided. Also, a microarray having a substrate on which the gene or fragment thereof is immobilized is provided. Also, a method of diagnosing breast... Agent: Cantor Colburn, LLP

20090162842 - Circulating mrna as diagnostic markers: Methods and kits are provided for diagnosing, monitoring, or predicting the conditions of pre-eclampsia, fetal chromosomal aneuploidy, and pre-term labor in a pregnant woman, as well as for detecting pregnancy in a woman, by quantitatively measuring in the maternal blood the amount of one or more mRNA species encoding human... Agent: Townsend And Townsend And Crew, LLP

20090162866 - Compositions and methods for obtaining nucleic acids from sputum: The present invention relates to compositions and methods for preserving and extracting nucleic acids from saliva. The compositions include a chelating agent, a denaturing agent, buffers to maintain the pH of the composition within ranges desirable for DNA and/or RNA. The compositions may also include a reducing agent and/or antimicrobial... Agent: Lahive & Cockfield, LLP Floor 30, Suite 3000

20090162859 - Compositions, methods and systems for inferring canine breeds for genetic traits and verifying parentage of canine animals: Methods and systems are provided for managing companion animal subjects in order to maximize their individual health and potential performance and to maximize profits obtained in breeding and marketing the companion animal subjects. The methods and systems draw an inference of a phenotype for a genetic trait of a companion... Agent: King & Spalding

20090162851 - Detection of nucleic acids by type specific hybrid capture method: Target-specific hybrid capture (TSHC) provides a nucleic acid detection method that is not only rapid and sensitive, but is also highly specific and capable of discriminating highly homologous nucleic acid target sequences. The method produces DNA-RNA hybrids which can be detected by a variety of methods.... Agent: Baker Donelson Bearman, Caldwell & Berkowitz, PC

20090162862 - Device and method for the automated and reproducible production of cell or tissue samples that are to be analyzed and are arranged on object supports: An automatically operating apparatus designed as a table-top apparatus for the reproducible production of cell or tissue samples to be examined and arranged on specimen slides comprises, located its center, a rotatably supported, advance device having arranged on its periphery a plurality of modular processing stations at a distance from... Agent: Lowe Hauptman Ham & Berner, LLP

20090162839 - Diagnosis and prognosis of cancer based on telomere length as measured on cytological specimens: The present invention concerns a quantitative in situ assessment of mean telomere length, particularly in relation to nuclear area, for the diagnosis and/or prognosis of cancer. In particular aspects, the methods and compositions regard diagnosis and/or prognosis of bladder cancer, urothelial cancer, lung cancer, and lymphoma.... Agent: Fulbright & Jaworski, LLP

20090162838 - Fluorescence resonance energy transfer enzyme substrates: Disclosed are compounds of formula (I) wherein D1 is a first dye moiety whose fluorescence properties may be modulated so as to be suitable as a donor or an acceptor in an energy transfer arrangement; D2 is a second dye moiety suitable as an acceptor or a donor in an... Agent: Ge Healthcare, Inc.

20090162844 - Identification and characterization of racemases, definition of protein signatures, and a test for detecting d-amino acid and for screening molecules capable of inhibiting the activity of racemase, especially proline racemase: This invention provides identification and characterization of racemases and definition of protein signatures of these racemases. This invention also provides identification of nucleic acid molecules encoding a peptide consisting of a motif characteristic of the protein signatures, and to the peptides consisting of these motifs. Antibodies specific for the peptides... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090162849 - Identification of a jak2 mutation in polycythemia vera: The present invention concerns the V617F variant of the protein-tyrosine kinase JAK2, said variant being responsible for Vaquez Polyglobulia. The invention also relates to a first intention diagnostic method for erythrocytosis and thrombocytosis allowing their association with myeloproliferative disorders, or to the detection of the JAK2 V617F variant in myeloproliferative... Agent: Foley And Lardner LLP Suite 500

20090162855 - Identification of genetic variants associated with increased severity of pulmonary disease: A method of determining a genetic component contributing to the severity of a pulmonary disease in a patient comprises determining the presence or absence of one or more single nucleotide polymorphisms (SNPs) in the Endothelin Receptor A (EDNRA) gene or the Interleukin-8 (IL-8) gene of the patient. The SNPs are... Agent: Hahn Loeser & Parks, LLP

20090162843 - Identification of hpv16 lineage group: A method for identification of an HPV16 lineage group in a sample, comprising contacting such nucleic acid simultaneously with three probes, each probe being capable of specific hybridization across positions 143 and 145 of a HPV 16 genome.... Agent: Smithkline Beecham Corporation Corporate Intellectual Property-us, Uw2220

20090162861 - Method for suppressing a fret signal, fret signal suppressor agents and use in a method for multiplexing biological events: The invention relates to a method for suppressing the FRET emitted by a reaction medium containing a pair of fluorescent FRET partner conjugates specific for a biological event, characterized in that a FRET signal killer which does not disturb said biological event is introduced into this medium.... Agent: Millen, White, Zelano & Branigan, P.C.

20090162860 - Method of nucleic acid sequence detection and nucleic acid sequence detection substrate: According to an aspect of the present invention, a pair of oligonucleotide strands are anchored onto the surface of a substrate by immobilizing one of the ends thereof onto the substrate. Each of the immobilized oligonucleotide strands is bound to a target nucleic acid sequence (single-stranded) having complementary sequences thereto... Agent: Oliff & Berridge, PLC

20090162841 - Method of selecting a desired protein from a library: Described is an improved method of selecting a member of a specific binding pair (sbp) having a desired specify, preferably an antibody, from a library expressing said member of a sbp, preferably a phage-display antibody library.... Agent: Klauber & Jackson

20090162840 - Methods and compositions for use in analyte detection using proximity probes: Methods and compositions for detecting an analyte in a sample are provided. In practicing the subject methods, a sample is combined with at least a pair of proximity probes that each include an analyte binding domain and a nucleic acid domain. The resultant mixture is then contacted with a pair... Agent: Stanford University Office Of Technology Licensing Bozicevic, Field & Francis LLP

20090162853 - Methods and devices for cellular analysis: Embodiments of the present invention are directed to improved methods and devices for analyzing a cell, aggregated cells, or a solid tumor. Such methods and devices are, for example, useful in the field of pathology and can provide improved cell processing and analytical results.... Agent: Venable LLP

20090162854 - Methods and kits for diagnosis of schizophrenia: The present invention provides methods and kits for the diagnosis of schizophrenia, which employ mitochondrial complex I as a peripheral biological marker for schizophrenia. In an embodiment of the invention, the present invention provides a method for diagnosing schizophrenia in a subject by determining the level of m-RNA or protein... Agent: Pearl Cohen Zedek Latzer, LLP

20090162867 - Mutational profiles in hiv-1 reverse transcriptase correlated with phenotypic drug resistance: The invention provides novel mutations, mutation combinations or mutational profiles of HIV-1 reverse transcriptase and/or protease genes correlated with phenotypic resistance to HIV drugs. More particularly, the present invention relates to the use of genotypic characterization of a target population of HIV and the subsequent correlation of this information to... Agent: Philip S. Johnson Johnson & Johnson

20090162848 - Noxin, a novel stress-induced gene involved in cell cycle and apoptosis: The invention also provides for methods for protecting a cell from stress damage by enhancing the expression noxin, methods for decreasing cell death by enhancing the expression of noxin, methods for inducing cell death by decreasing noxin activity, methods for inducing cell cycle arrest by increasing noxin, and methods for... Agent: Ropes & Gray LLP

20090162850 - Nucleic acid and corresponding protein entitled 125p5c8 useful in treatment and detection of cancer: A novel gene (designated 125P5C8) and its encoded protein, and variants thereof, are described wherein 125P5C8 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 125P5C8 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 125P5C8 gene... Agent: Agensys C/o Morrison & Foerster LLP

20090162863 - Nucleic acid detection probe: It is intended to provide a nucleic acid detection probe that is designed with a high degree of flexibility. The present invention provides a nucleic acid detection probe used in nucleic acid detection, wherein the amount of a particular target gene present in a sample is examined by simultaneously hybridizing,... Agent: Stanley P. Fisher Reed Smith LLP

20090162858 - Orthogonal chemical inducer of dimerization: A method for identifying a molecule as being able to bind a protein target in a cell, comprising (a) covalently bonding the molecule to trimethoprim (TMP) to form a screening molecule, (b) introducing the screening molecule into the cell which (A) expresses (i) a first fusion protein comprising a binding... Agent: Cooper & Dunham, LLP

20090162857 - Pharmaceutical compositions and methods for delivering nucleic acids into cells: The present invention relates to methods of delivering nucleic acids into cells using a nucleic acid binding molecule containing a multimeric or spacer-incorporated protein transduction domain (PTD). The invention also relates to novel compositions that contain a nucleic acid complexed or conjugated with a nucleic acid binding molecule. The nucleic... Agent: Sterne, Kessler, Goldstein & Fox P.l.l.c.

20090162836 - Prognostic and diagnostic markers for cell proliferative disorders of the breast tissues: The present invention relates to prognostic and diagnostic markers for cell proliferative disorders of the breast tissues. The present invention therefore provides methods and nucleic acids for the analysis of biological samples for features associated with the development of breast cell proliferative disorders. Furthermore, the invention provides for prognosis of... Agent: Davis Wright Tremaine, LLP/seattle

20090162847 - Rapid detection of the \"high-virulent\" st-17 clone of group b streptococcus: The present invention relates to polynucleotides enabling the rapid, simple and specific detection of Group B Streptococcus highly-virulent ST-17 clones. The present invention also relates to the polypeptides encoded by said polynucleotides, as well as to antibodies directed or raised against said polypeptides. The present invention also relates to kits... Agent: Oblon, Spivak, Mcclelland Maier & Neustadt, P.C.

20090162856 - Rna detection method: It is an object of the present invention to provide a method for rapid, convenient, and highly sensitive detection of trace RNA wherein a risk of contamination is low. The present invention provides a method for amplification of nucleic acid which comprises the steps of: (i) allowing a reverse transcriptase... Agent: Birch Stewart Kolasch & Birch

20090162846 - Senp1 as a marker for cancer: The present invention provides methods of detecting cancer cells by detecting the quantity of SENP1 and/or telomerase in a sample.... Agent: Townsend And Townsend And Crew, LLP

20090162868 - Gene markers and utilization of the same: [Means for Solving Problems]Genes whose expression levels were increased because of rejection and whose expression levels were decreased because of immunosuppressive agents have been identified as gene markers. By using the expression level of one of these gene markers as an indicator, it becomes possible to diagnose rejection, evaluate the... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090162869 - Membrane molecule expressed specifically in activated plasmacytoid dendritic cell: e

20090162873 - Gene encoding a multidrug-resistance human p-glycoprotein homologue on chromosome 7p15-21 and uses thereof: The invention relates to an MDR family P-glycoprotein located on human chromosome 7p15-21, polynucleotide sequences encoding this P-glycoprotein and fragments thereof. This gene is utilized in methods for assessing cancer cell s susceptibility to therapies directed against multidrug resistance, and for the design of diagnostic and therapeutic methods relating to... Agent: Wolf Greenfield & Sacks, P.C.

20090162874 - Method for screening anticancer substances, set or kit for implementing said method: e

20090162875 - Peptide diagnostic agent for lyme disease: The present invention relates, e.g., to an isolated peptide consisting of the sequence MKKDDQIAAAIALRGMA (SEQ ID NO:1) or an active variant thereof, wherein the peptide or active variant can bind specifically to an antibody induced by a causative agent of Lyme disease (a pathogenic Borrelia), e.g. in a sample from... Agent: Venable LLP

20090162870 - Fatty acid synthase in liver disease: Methods and compositions for detecting elevated fatty acid synthase (FAS) expression in the liver of a subject are disclosed. The detection may be of expression in liver cells per se or in a bodily fluid of a subject. Also disclosed are methods for identifying the presence or absence of liver... Agent: Patentique PLLC

20090162871 - Mutants of the factor vii-activating protease and detection methods using specific antibodies: Mutants of the DNA sequence coding for the protease (FSAP) which activates blood clotting factor VII and single-chain plasminogen activators, the mutants comprising a G/C base exchange at nucleotide position 1177 and/or a G/A base exchange at nucleotide position 1601, are described. The corresponding protease has a Glu/Gln exchange at... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090162872 - Competitive receptor binding assay for detecting beta-glucans having immunomodulatory activity in a human cell: The present invention provides a method for detecting a beta-glucan having immunomodulatory activity in a human cell, which uses a test cell line that stably expresses human dectin-1 molecule on the cell surface and does not express other glucan receptors and a specific amount of a marker beta-glucan that specifically... Agent: Husch Blackwell Sanders LLP

20090162876 - Myeloperoxidase assays: The present invention relates to methods and kits for determining autoantibodies to myeloperoxidase or a myeloperoxidase fragment and myeloperoxidase or a myeloperoxidase fragment in a test sample.... Agent: Paul D. Yasger Abbott Laboratories

20090162877 - Methods to identify protein arginine deiminase 4 inhibitors: In accordance with one embodiment of the present disclosure, a method to identify a protein arginine deiminase 4 inhibitor is disclosed. The method includes performing a competitive assay in which a potential inhibitor compound competes with rhodamine-conjugated fluoroamidine to bind to protein arginine deiminase 4. Fluorescence is measured to determine... Agent: Dority & Manning, P.A.

20090162878 - Methods and compositions for detecting and quantifying sappb: The present invention provides methods (assays) for detecting and/or quantifying sAPPβ, a secreted β-secretase (BACE1) cleavage fragment of the β-amyloid precursor protein (APP), in a biological sample. One such method includes contacting a biological sample with a first antibody that selectively binds to a BACE1 cleavage site on sAPPβ and... Agent: Baker Botts L.L.P.

20090162879 - Measuring device, measuring apparatus, and measuring method: A measuring device (100a) includes a base body (101) constituting: a sample holding portion (102) configured to hold a test sample containing urea and a material to be detected; and a sample supply port (103) through which the test sample is supplied to the sample holding portion (102). The base... Agent: Mcdermott Will & Emery LLP

20090162880 - Thromboplastin reagent with long-term stability: The present invention is in the area of coagulation analysis and relates to a reagent which is based on recombinant or native tissue factor and phospholipids and which can be stabilized by adding a polyphenol.... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090162881 - Method of measuring adenine nucleotide: A high sensitivity electrochemistry type method for measuring adenine nucleotide which has a convenient and further miniaturized measuring device structure; is low in consumptive power; and does not require a treatment operation for substances that cause turbidity is provided. A method for measuring adenine nucleotide, which comprises a step A... Agent: Pearne & Gordon LLP

20090162882 - Methods for determining proteins and protein-bound compounds comprising enzymatic modification: The present invention relates to a method for quantifying a non-proteinaceous corn pound bound to one or more carrier proteins in a sample comprising the steps of: i) separating complexes of said non-proteinaceous compound bound to said one or more carrier proteins from the non-proteinaceous compound that is not bound... Agent: Seed Intellectual Property Law Group PLLC

20090162883 - Alzheimer's disease secretase, app substrates thereof, and uses thereof: The present invention provides the enzyme and enzymatic procedures for cleaving the β secretase cleavage site of the APP protein and associated nucleic acids, peptides, vectors, cells and cell isolates and assays. An enzyme that cleaves the α-secretase site of APP also is provided. The invention further provides a modified... Agent: Marshall, Gerstein & Borun LLP

20090162884 - Method of disulfide crosslink forming in vitro protein synthesis: It is an objective of the present invention to provide a method of synthesizing a protein having disulfide bonds using a reconstituted protein synthesizing system in a convenient manner with high efficiency. It has been found that a protein having the activity can be obtained and synthesized with good efficiency... Agent: Birch Stewart Kolasch & Birch

20090162889 - Gene reporter assay, kit, and cells for determining the presence and/or the level of a molecule that activates signal transduction activity of a cell surface protein: The present invention relates to a commercializable cell and to a gene reporter assay method and a kit which use this cell to determine the presence and/or the level of a molecule that activates signal transduction activity of a cell surface protein. This cell is treated in such a manner... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090162890 - Identifying therapeutic compounds based on their physical-chemical properties: The present invention is directed to rapid and efficient methods of identifying therapeutic compounds by allowing only the most favorable molecules initially selected based on their physical-chemical profile falling within a range predefined by the physical-chemical/biological relationship of a previously tested small subset of compounds of same core structure to... Agent: Morrison & Foerster LLP

20090162887 - Particle analysis in an acoustic cytometer: The present invention is a method and apparatus for acoustically manipulating one or more particles.... Agent: Woodcock Washburn LLP

20090162888 - Sample control for correction of sample matrix effects in analytical detection methods: Methods and systems are described suitable to determine the effects of sample matrix on the detection of a label so as to allow correction for these sample matrix effects when using the label in an analytical detection technique. The method is particularly advantageous for use in a disposable molecular diagnosis... Agent: Philips Intellectual Property & Standards

20090162886 - Screening method of glutathione-increasing substance: As a means for treating diseases such as neurodegenerative diseases, malignant tumors and infectious diseases, a method for screening a substance increasing glutathione is provided. According to this method, by contacting a test substance with a cell expressing a GTRAP3-18 protein, a substance decreasing the amount of expression of the... Agent: Wenderoth, Lind & Ponack, L.L.P.

20090162885 - Systems and methods for measuring fluid properties: A fluid property measurement system for measuring free stream particulates comprises a fluid movement device positioned within a fluid container which is configured to cause fluid flow within the fluid container along a fluid flow path when a fluid is present. A constricted region along the fluid flow path generates... Agent: Thorpe North & Western, LLP.

20090162891 - Effective monitoring system or anthrax, smallpox, or other pathogens: A device and method for detecting anthrax or other pathogens are disclosed. Individual self-contained monitoring devices of a monitoring system can be portable or stationary (e.g. installed in air ducts or plumbing of buildings) and can be part of a network of devices. Monitoring devices may be used for the... Agent: Townsend And Townsend And Crew, LLP

20090162892 - Fermentative production of fine chemicals: a2) liquefying the millbase in an aqueous liquid in the presence of at least one starch-liquefying enzyme, followed by saccharification using at least one saccharifying enzyme, where at least some of the millbase is liquefied by continuous or batchwise addition to the aqueous liquid.... Agent: Connolly Bove Lodge & Hutz, LLP

20090162893 - Alcohol dehydrogenase for the stereoselective production of hydroxy compounds: The invention relates to a DNA molecule encoding an NADP-dependent alcohol dehydrogenase, to a vector containing at least one copy of the DNA sequence, and to prokaryotic or eukaryotic host cells that are transformed or transfected with said DNA sequence. The invention also relates to the NADP-dependent alcohol dehydrogenase as... Agent: Schwegman, Lundberg & Woessner, P.A.

20090162898 - High copy number self-replicating plasmids in pseudomonas: Provided herein are improved copy number plasmids, particularly those plasmids capable of replication in a bacterial cell. The improved copy number plasmid contain a deletion, insertion, or substitution in the replication control region, particularly a Pseudomonas-specific replication control region, that results in an increase in plasmid copy number in comparison... Agent: Alston & Bird LLP Dow Global Technologies, Inc.

20090162899 - Mannitol induced promoter systems in bacterial host cells: The present invention provides methods for producing recombinant peptides in a bacterial host utilizing a mannitol, arabitol, glucitol, or glycerol-inducible promoter, wherein the host bacterial cell that produces the peptide has been rendered incapable of degrading or metabolizing mannitol, arabitol, or glucitol, or derivatives or analogues thereof. The present invention... Agent: Alston & Bird LLP Dow Global Technologies, Inc.

20090162894 - Nitrile hydratase: The present invention provides: a protein having an improved nitrile hydratase activity, whereby heat resistance has been improved when compared with a wild-type nitrile hydratase activity, wherein the amino acid sequence of a nitrile hydratase is modified; a gene DNA encoding the above protein; a recombinant vector having the above... Agent: Darby & Darby P.C.

20090162896 - Production of recombinant collagen like proteins: The present invention is directed to a yeast cell for producing a recombinant collagen like protein. The present invention is further directed to a kit of parts or a co-expression system for use in the production of such a protein and to a method of producing said recombinant protein and... Agent: Jenkins, Wilson, Taylor & Hunt, P. A.

20090162897 - Promoter sequences: The present invention relates to methods for producing polypeptides or nucleic acids, in particular antisense RNA and hairpin RNA in filamentous fungi. The present invention also relates to isolated Penicillium promoter sequences and to nucleic acid constructs, vectors, and host cells comprising the promoter sequences operably linked to nucleic acid... Agent: Mark S. Graham, Esq. Luedeka, Neely & Graham, P.C.

20090162895 - Ribulose, 1,5-bisphosphate carboxylase/oxygenase polypeptides and related polynucleotides: The present invention relates to novel ribulose-1,5-bisphosphate carboxylase/oxygenase polypeptides and the polynucleotides that encode them. The invention also provides related host cells and methods.... Agent: Dechert, LLP

20090162902 - Antibody with protein a selectivity: Monoclonal antibodies, and antigen binding fragments thereof, which bind to Protein A of Staphylococcus aureus are provided.... Agent: 3m Innovative Properties Company

20090162900 - Expression vector, methods for the production of heterologous gene products and for the selection of recombinant cells producing high levels of such of such products: n

20090162901 - Inducible eukaryotic expression system: Compositions and methods for the inducible expression of genes in eukaryotic cells are provided. Expression of a nucleotide sequence of interest encoding a protein of interest is controlled by a regulatory fusion protein that consists of a transcription blocking domain and a ligand-binding domain. When a cognate ligand for the... Agent: Regeneron Pharmaceuticals, Inc

20090162903 - Nucleic acid amplification method: An object to be achieved by the present invention is to provide a nucleic acid amplification method by which a nucleic acid can be amplified using oligonucleotide primers and DNA polymerase. The present invention provides a nucleic acid amplification method which comprises performing incubation of a reaction solution containing at... Agent: Birch Stewart Kolasch & Birch

20090162837 - Inactivated fcv vaccines: The present invention relates to improved inactivated feline calicivirus (FCV) vaccines. The invention also provides a process for producing stabilized inactivated FCV, and the use of such stabilized inactivated FCV, in the production of FCV immunogenic compositions. The invention further provides methods of inducing an immune response in an animal... Agent: Judy Jarecki-black, Esq. Merial Limited

20090162835 - Novel methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries: Methods useful in constructing libraries that collectively display and/or express members of diverse families of peptides, polypeptides or proteins and the libraries produced using those methods. Methods of screening those libraries and the peptides, polypeptides or proteins identified by such screens.... Agent: Lowrie, Lando & Anastasi, LLP

20090162905 - Method for purification of hyaluronic acid salt: A partially purified product of a hyaluronic acid salt obtained from a culture of a microorganism capable of producing hyaluronic acid, preferably a microorganism belonging to the genus Streptcoccus, is brought into contact with a solution containing a salt and a hydrophilic organic solvent, thereby transferring to a liquid phase,... Agent: Omori & Yaguchi Usa, LLC 8 Penn Center

20090162904 - Transgenic plants and methods for controlling bolting in sugar beet: This invention relates to the field of sugar beet bolting and flowering control, specifically methods and transgenic sugar beet plants for suppressing the vernalization response. In particular, the present invention includes sugar beet plants and methods for modulating sugar beet vernalization by over expression of an FLC gene or by... Agent: Syngenta Biotechnology, Inc. Patent Department

20090162906 - Nitrilases and methods for making and using them: The invention provides nitrilases and methods for making and using them, and in one aspect, provides methods for producing enantiomerically pure α-substituted carboxylic acids, such as, for example, α-amino acids and α-hydroxy acids. In one aspect, methods of the invention combine an aldehyde or ketone with a cyanide and ammonia... Agent: Verenium C/o Mofo S.d.

20090162907 - Method for producing l-glutamic acid by fermentation accompanied by precipitation: A microorganism which can metabolize a carbon source at a specific pH in a liquid medium containing L-glutamic acid at a saturation concentration and the carbon source, and has ability to accumulate L-glutamic acid in an amount exceeding the amount corresponding to the saturation concentration in the liquid medium at... Agent: Oblon, Spivak, Mcclelland Maier & Neustadt, P.C.

20090162908 - Method for producing an l-amino acid using a bacterium of the enterobacteriaceae family: The present invention provides a method for producing an L-amino acid from ethanol using a bacterium of the Enterobacteriaceae family, wherein the bacterium has been modified to enhance the expression of the ydbK gene.... Agent: Cermak & Kenealy LLP Acs LLC

20090162909 - Ketoreductase polypeptides for the production of azetidinone: The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to synthesize a variety of... Agent: Dechert, LLP

20090162910 - Method for mass production of primary metabolites, strain for mass production of primary metabolites, and method for preparation thereof: The present invention relates to a method for mass production of other primary metabolites by inhibiting a specific metabolite of metabolism in microorganisms, a transformant for mass production of other primary metabolites plasmid clone by modifying a specific gene relating to the metabolism, and a method for preparation thereof. The... Agent: Alston & Bird LLP

20090162911 - Strain for butanol production: Using screening of transposon random insertion mutants, genes involved in a complex that is a three-component proton motive force-dependent multidrug efflux system were found to be involved in E. coli cell response to butanol. Reduced production of the AcrA and/or AcrB proteins of the complex confers increased butanol tolerance. E.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center

20090162912 - Process for continuous solvent production: A continuous process for production of solvents, particularly acetone-butanol-ethanol (ABE) using fermentation of solventogenic microorganisms and gas stripping is provided. The solventogenic microorganisms are inoculated in a nutrient medium containing assimilable carbohydrates (substrate) and optional other additives. Control of the solventogenic microorganism concentration in the fermentor (cell concentration) and the... Agent: Leydig Voit & Mayer, Ltd

20090162914 - Bio-recycling of carbon dioxide emitted from power plants: The invention provides a method to decrease emission of carbon dioxide from combustion of fossil fuels or other hydrocarbons and to enhance the efficiency of methane production from anaerobic biodigesters. The invention involves feeding carbon dioxide from the exhaust gas of hydrocarbon fuel combustion to an anaerobic biodigester where biomass... Agent: Hugh Mctavish Mctavish Patent Firm

20090162913 - Ferulate esterase producing strains for the enhancement of biogas production: Compositions of ferulate esterase producing bacterial strains or functional mutants thereof and methods of using ferulate esterase producing bacterial strains as silage inoculants for the enhancement of biogas production are disclosed. Ferulate esterase producing bacterial strains of Lactobacillus, including Lactobacillus buchneri, or functional mutants thereof are used as silage inoculants... Agent: Mckee, Voorhees & Sease, P.L.C Attn: Pioneer Hi-bred

20090162915 - Peptidylarginine deiminase 6: A nucleotide acid sequence is provided encoding a peptidylarginine deiminase 6. The gene is found to be expressed in gonads only and may be used as target for male and female contraception. Its encoded protein can be used to screen for small molecular weight modulators of the enzyme activity.... Agent: Organon Usa, Inc. C/o Schering-plough Corporation

20090162916 - Cellobiohydrolase i enzymes: Provided herein is an isolated Cel7A polypeptide comprising mutations in the catalytic domain of the polypeptide relative to the catalytic domain of a wild type Cel7A polypeptide, wherein the mutations reduce N-linked glycosylation of the isolated polypeptide relative to the wild type polypeptide. Also provided herein is an isolated Cel7A... Agent: Paul J White, Patent Counsel National Renewable Energy Laboratory (nrel)

20090162917 - Subtilism carlsberg proteins with reduced immunogencity: The present invention provides methods for the identification of CD4+ T-cell epitopes in subtilisin Carlsberg proteins. The present invention also provides for the production of altered peptides which, when incorporated into a wild-type subtilisin Carlsberg protein produce an altered immunogenic response, preferably a low immunogenic response in humans. In particular,... Agent: Kamrin T. Macknight Genencor International, Inc.

20090162918 - Circovirus sequences associated with piglet weight loss disease (pwd): The genome sequences and the nucleotide sequences coding for the PWD circovirus polypeptides, such as the circovirus structural and non-structural polypeptides, vectors including the sequences, and cells and animals transformed by the vectors are provided. Methods for detecting the nucleic acids or polypeptides, and kits for diagnosing infection by a... Agent: Bingham Mccutchen LLP

20090162919 - Methods for concentrating microalgae: The present invention provides commercially viable, large-scale methods for concentrating microalgae with an average diameter of about 20 μm or less. The methods find use in concentrating microalgae with an average diameter of about 5 μm or less, for example, Nannochloropsis.... Agent: Townsend And Townsend And Crew, LLP

20090162920 - Modular continuous production of micro-organisms: Process for the growing of micro-organism in an open and continuous system further being characterized by means for creating within said system a habitat in which natural, diverse and heterogeneous emicrobial communities can autonomously react and adapt to a changing environment... Agent: Darby & Darby P.C.

20090162921 - Method of detoxifying a harmful compound: The detoxification method characterized by comprising converting at least one member selected from the group comprising arsenic, antimony and selenium into a harmless substance produced in a food chain system by using the food chain system. The method of detoxifying a harmful compound as described above is characterized by comprising... Agent: Hamre, Schumann, Mueller & Larson, P.C.

20090162922 - Diesel exhaust gas scrubbing method for carbon dioxide removal: Systems and methods for removing carbon dioxide from gas, e.g., diesel exhaust gas, are provided. The systems involve uptake of carbon dioxide by algae in water to which the gas is exposed.... Agent: Knobbe Martens Olson & Bear LLP

20090162923 - Methods and compositions for digestion of organic waste: The present invention relates to a process wherein organic material derived from plant and animal material is processed to recover nutritional elements. In particular, there is provided a process for releasing nutritional elements from plant and animal material comprising the steps of treating the material with one or more enzymes... Agent: Foley Hoag, LLP Patent Group, World Trade Center West

20090162924 - Compositions and methods for obtaining nucleic acids from sputum: The present invention relates to compositions and methods for preserving and extracting nucleic acids from saliva. The compositions include a chelating agent, a denaturing agent, buffers to maintain the pH of the composition within ranges desirable for DNA and/or RNA. The compositions may also include a reducing agent and/or antimicrobial... Agent: Lahive & Cockfield, LLP Floor 30, Suite 3000

20090162925 - Cell/tissue mass selecting apparatus and dividing mechanism thereof: A selecting apparatus for selecting cell/tissue mass includes a base, a feeding mechanism and a dividing mechanism. The base has a platform for placing the cell/tissue mass. The feeding mechanism, disposed on the base, moves relative to the platform. The dividing mechanism, disposed on the feeding mechanism, includes a first... Agent: Quintero Law Office, PC

20090162926 - Photon reducing agents for fluorescence assays: The present invention provides a method for reducing undesirable light emission from a sample using at least one photon producing agent and at least one photon reducing agent (e.g. dye-based photon reducing agents). The present invention further provides a method for reducing undesirable light emission from a sample (e.g. a... Agent: Invitrogen Corporation C/o Intellevate

20090162927 - Nanotubes and nanowires based electronic devices and method of fabrication thereof: An electronic device is presented comprising at least one electrically conductive element coupled to an elongated carbon or inorganic semiconductor based nanostructure, by a biological binder.... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090162928 - Integrated sample processing devices: Sample processing devices may include compression structures that provide for the transfer of force from a platen to a platform such as a thermal block on which the sample processing device is located during processing. The sample processing devices may include a fill reservoir structure with various features such as... Agent: 3m Innovative Properties Company

20090162929 - Nucleic acid amplification apparatus and thermal cycler: A thermal cycler is provided that may be used as a nucleic acid amplification apparatus. The cycler has at least three temperature zones that can be set at different temperatures, the temperature zones including a first temperature zone, an intermediate zone, and a second temperature zone. The cycler has a... Agent: Canon U.s.a. Inc. Intellectual Property Division

20090162930 - Active grip filter plug for sample collection devices: A system for collecting a biological sample includes a collection device comprising a cylindrical body having a bore extending there through and a filter membrane disposed at one end thereof; a filter plug having an insert configured for insertion into the bore; a collar concentrically mounted about the exterior surface... Agent: VistaIPLaw Group LLP

20090162931 - Recombinant monoclonal antibodies and corresponding antigens for colon and pancreatic cancers: The present invention provides for recombinant monoclonal antibodies that bind to human colorectal and pancreatic carcinoma-associated antigens, along with nucleic acid sequences encoding the antibody chains, and the amino acid sequences corresponding to the nucleic acids, and uses for these antibodies, nucleic acids and amino acids.... Agent: Nixon Peabody, LLP

20090162932 - Polypeptide having an activity to support proliferation or survival of hematopoietic stem cell or hematopoietic progenitor cell, and dna coding for the same: A gene encoding a polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells is isolated by comparing expressed genes between cells which support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells and cells which do not support the proliferation... Agent: Foley And Lardner LLP Suite 500

20090162933 - Epha2 and hyperproliferative cell disorders: The present invention relates to methods and compositions designed for the treatment, management, or prevention of a non-neoplastic hyperproliferative cell or excessive cell accumulation disorders, particularly those involving hyperproliferation of epithelial or endothelial cells. In one embodiment, the methods of the invention comprise the administration of an effective amount of... Agent: Medimmune, LLC Jonathan Klein-evans

20090162934 - Multiple mesodermal lineage differentiation potentials for adipose tissue-derived stromal cells and uses thereof: The invention relates to methods and compositions for the differentiation of stromal cells from adipose tissue into hematopoietic supporting stromal cells and myocytes of both the skeletal and smooth muscle type. The cells produced by the methods are useful in providing a source of fully differentiated and functional cells for... Agent: Seed Intellectual Property Law Group PLLC

20090162935 - Vaccinia virus host range genes to increase the titer of avipoxviruses: The invention concerns an Avipoxvirus comprising in the viral genome a Vaccinia virus host range gene or a homologue of said host range gene. The invention further relates to cells, preferably avian cells, comprising a Vaccinia virus host range gene or a homologue of said host range gene. Moreover, the... Agent: Law Office Of Salvatore Arrigo

20090162937 - Compositions and methods comprising the use of cell surface displayed homing endonucleases: According to particular exemplary aspects, DNA target site binding and cleavage properties of native, variant or modified homing endonucleases (HE) (e.g., LAGLIDAG (LHE), HNH, His-Cys Box, GIY-YIG, I-SspI-type, and fusions, muteins or variants thereof) in solution are recapitulated on the cell surface (e.g., as assessed by flow cytometric analysis) to... Agent: Davis Wright Tremaine, LLP/seattle

20090162936 - Method for transfer of gene into fat cell or progenitor fat cell: A method for transferring a gene into a fat cell or progenitor fat cell comprising the step of infecting the fat cell or progenitor cell with a retrovirus vector having a foreign gene in the presence of a substance having both of a retrovirus-binding site and a target cell-binding site... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

06/18/2009 > patent applications in patent subcategories. invention type

20090155760 - Method of cell injection into biotissue and apparatus therefor: A method of injecting cells into a biological tissue comprising thrusting injection needle (200) under microvibration into tissue (5) secured by suction to tissue suction means (210) and effecting injection of a cell suspension into the tissue through the needle. There is also provided an apparatus for cell injection into... Agent: Millen, White, Zelano & Branigan, P.C.

20090155763 - Compositions and methods for prolonging survival of platelets: The present invention provides modified platelets having a reduced platelet clearance and methods for reducing platelet clearance. Also provided are compositions for the preservation of platelets. The invention also provides methods for making a pharmaceutical composition containing the modified platelets and for administering the pharmaceutical composition to a mammal to... Agent: Foley & Lardner LLP

20090155762 - Device and method for separating and discharging plasma: The invention concerns plasma separation on a microliter scale. The method/system according to the invention is able to provide plasma in the range of several microliters within a very short time as it is required, for example, in modern analyses by carrier-bound test elements. Plasma separation and plasma release is... Agent: Roche Diagnostics Operations Inc.

20090155761 - Method for producing reticulocyte lysate and uses thereof: Methods for producing substantially pure porcine reticulocyte lysate are provided. In one embodiment, the methods include inducing a reduction in the hematocrit of a pig to a level of between about 20% and about 25%; extracting at least a portion of blood from the pig; isolating a fraction of the... Agent: David P. Lentini

20090155764 - White blood cell differentiation reagent and method: A reagent for four-part differentiation of white blood cells is provided. In one embodiment the reagent has an osmolarity below 50 mOsm/kg H2O. A method for differentiating white blood cells using the reagent is also provided. The disclosure provides for a rapid lysis of red blood cells and four-part differentiation... Agent: Mindray C/o Stoel Rives LLP

20090155765 - White blood cell differentiation reagent and method: A thermal cycler for automatic performance of the polymerase chain reaction is provided. The thermal cycler comprises a heater control that provides close temperature control of the reaction.... Agent: Kilyk & Bowersox, P.l.l.c.

20090155767 - Methods for a predictive diagnostic test for tamoxifen: A method for determining the likelihood that a therapy involving administration of tamoxifen to a patient afflicted with an estrogen receptor positive breast cancer will provide a therapeutic benefit to the patient which comprises determining the level of expression of epidermal growth factor receptor present within a non-nuclear compartment in... Agent: Cooper & Dunham, LLP

20090155766 - Methods for detecting estrone by mass spectrometry: Provided are methods for determining the amount of estrone in a sample using mass spectrometry. The methods generally involve ionizing estrone in a sample and detecting and quantifying the amount of the ion to determine the amount of estrone in the sample.... Agent: Foley & Lardner LLP

20090155769 - Detection method for ljungan virus: The present invention relates to a method for specifically detecting Ljungan virus (LV). In particular, the present invention relates to a method of detecting LV using quantitative real-time reverse transcriptase PCR. The present invention also provides kits for performing the method of the invention.... Agent: Kohn & Associates, PLLC

20090155774 - Fluorescence resonance energy transfer screening assay for the identification of hiv-1 envelope glycoprotein-medicated cell: This invention provides: agents determined to be capable of specifically inhibiting the fusion of a macrophage-tropic primary isolate of HIV-1 to a CD4+ cell, but not a T cell-tropic isolate of HIV-1 to a CD4+ cell; and agents determined to be capable of specifically inhibiting the fusion of a T... Agent: Cooper & Dunham LLP

20090155771 - Hepatitis b virus dna polymerase and surface antigen variants and methods of using same: The present invention relates generally to viral variants exhibiting reduced sensitivity to agents and in particular nucleoside analogues. More particularly, the present invention is directed to hepatitis B virus variants exhibiting complete or partial resistance to nucleoside analogues. The variants may also comprise corresponding mutations affecting immunological interactivity to viral... Agent: Nixon & Vanderhye, PC

20090155773 - High-risk human papillomavirus detection: This invention provides compositions and methods for detecting HPV in a sample. This invention also provides related kits, systems, and computers.... Agent: Roche Molecular Systems, Inc. Patent Law Department

20090155770 - Implantable devices for fiber optic based detection of nosocomial infection: Disclosed are methods and devices for continuous in vivo monitoring of a potential infection site. Disclosed devices may be utilized to alert patients and/or health care providers to the presence of a pathogen at an early stage of a hospital acquired infection, thereby providing for earlier intervention and improved recovery... Agent: Dority & Manning, P.A.

20090155772 - Method for detecting nanbv associated seroconversion: The present invention relates to recombinant expression vectors which express segments of deoxyribonucleic acid that encode recombinant HIV and HCV antigens. These recombinant expression vectors are transformed into host cells and used in a method to express large quantities of these antigens. The invention also provides compositions containing certain of... Agent: Joseph E. Mueth, Esq.

20090155768 - Reporter plasmid phage packaging system for detection of bacteria: The invention is related to a transducing particle that comprises a bacteriophage coat and a DNA core that comprises plasmid DNA comprising: a) a host-specific bacteriophage packaging site wherein the packaging site is substantially in isolation from sequences naturally occurring adjacent thereto in the bacteriophage genome, b) a reporter gene,... Agent: Knobbe, Martens, Olson & Bear, LLP

20090155793 - Apparatus for high throughput sequencing of nucleic acids: A scalable reaction and detection system for automated high throughput sequencing of nucleic acids involving a combination of chemical processes and observation processes independent of the chemistry processes. Discrete functional units may be configured in a manner that allows the system to interchangeably utilize different sequencing reaction components in conjunction... Agent: Townsend And Townsend And Crew, LLP

20090155779 - Aptamers that bind to prion protein: Compositions are provided in the form of nucleotide aptamerss that are capapble of binding PrP, and in some embodiments, differentially binding PrP isoforms. Also provided are methods for identifying PrP in a sample, and in some embodiments, either selectively removing PrP or PrP isoforms from a sample, or inactivating them... Agent: Calfee Halter & Griswold, LLP

20090155784 - Assessment of asthma and allergen-dependent gene expression: The present invention provides methods for the assessment, diagnosis, or prognosis of asthma including methods for providing an assessment, diagnosis, or prognosis comprising the step of exposing a sample derived from a patient to an allergen in vitro. The present invention also provides methods for selecting, as well as evaluating... Agent: Wyeth Patent Law Group

20090155808 - Automated system for isolating, amplifying and detecting a target nucleic acid sequence: A system and method for preparing and testing of targeted nucleic acids is presented. The system integrates a pipetter, extractor, assay reader, and other components, including a selectively compliant articulated robot arm (SCARA). This synergistic integration of previously separate diagnostic tools creates a system and method whereby a minimum of... Agent: David W. Highet Becton, Dickinson And Company

20090155795 - Baseless nucleotide analogues and uses thereof: A method of detecting a target nucleic acid.... Agent: Morgan, Lewis & Bockius, LLP

20090155800 - Biosensor having nano wire and manufacturing method thereof: There is provided a biosensor capable of increasing a detecting sensitivity of a target substance by using a nano wire having excellent electrical characteristics and by immobilizing a receptor of the target substance to be detected on a substrate which is disposed between a nano wire and another nano wire... Agent: Venable LLP

20090155807 - C-met mutations in lung cancer: The invention provides methods and compositions useful for detecting mutations in c-met in lung cancer cells.... Agent: Genentech, Inc.

20090155775 - Cloned dna polymerases from thermotoga and mutants thereof: The invention relates to a substantially pure thermostable DNA polymerase from Thermotoga (Tne and Tma) and mutants thereof. The Tne DNA polymerase has a molecular weight of about 100 kilodaltons and is more thermostable than Taq DNA polymerase. The mutant DNA polymerase has at least one mutation selected from the... Agent: Invitrogen Corporation C/o Intellevate

20090155794 - Cloning multiple control sequences into chromosomes or into artificial centromeres: Artificially synthesizing 29 homozygous cystic fibrosis core panel controls demonstrates placing multiple homozygous mutant sequences on the same single control DNA sequence to streamline quality control by minimizing extra control assays, time, and costly formatted test materials and testing all controls during every test. Any rare or unavailable reported DNA... Agent: Brouse Mcdowell Lpa

20090155786 - Compositions and methods for detecting markers of cancer: Disclosed herein are compositions and methods for detecting one or more markers indicative of cancer. In one instance the marker is one or more methylated genes, such as SFRPs. In another instance the marker is an altered protein, such as p53.... Agent: Burns & Levinson, LLP

20090155805 - Copy number alterations that predict metastatic capability of human breast cancer: Disclosed in this specification is a method of defining chromosome regions of prognostic value by summarizing the significance of all SNPs (single nucleotide polymorphism) in a predetermined section of a chromosome to define chromosome regions of prognostic value. Based on the SNPs in specified genes, a more accurate prognosis for... Agent: Hiscock & Barclay, LLP

20090155790 - Crab-pii directed diagnostics for neoplastic disease: Disclosed are methods for diagnosing cancer in a test cell sample or fluid sample by detecting an increase in the level of expression of CRAB-PII in the test cell sample or fluid sample as compared to the level of expression of CRAB-PII in a control cell sample or fluid sample... Agent: Wilmerhale/boston

20090155804 - Disease pathway-based method to generate biomarker panels tailored to specific therapeutics for individualized treatments: The increased efficacy and reduced unwanted side effects of drugs can be insured by treating only responsive patients. In an embodiment of the invention, signaling pathways that a particular drug interferes with, are derive together with predictive biomarkers and dynamic biomarker that can read the activity of these pathways before... Agent: Fliesler Meyer LLP

20090155776 - Fetal methylation markers: This application describes the discovery that, in a pregnant woman, certain genes (such as RASSF1A, APC, CASP8, RARB, SCGB3A1, DAB2IP, PTPN6, THY1, TMEFF2, and PYCARD) originated from a fetus are highly methylated, whereas the same genes of maternal origin are unmethylated. This discovery allows the easy detection of one or... Agent: Townsend And Townsend And Crew, LLP

20090155788 - Gene expression markers for inflammatory bowel disease: The present invention provides for a method of detecting the presence of inflammatory bowel disease in gastrointestinal tissues or cells of a mammal by detecting decreased expression of Indian Hedgehog (Ihh) and/or increased expression of Defensin A5 (DefA5) and/or Defensin A6 (DefA6) in the tissues or cells of the mammal... Agent: Goodwin Procter LLP Attn: Patent Administrator

20090155789 - Genes from the 20q13 amplicon and their uses: The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases.... Agent: Weaver Austin Villeneuve & Sampson LLP

20090155806 - Genomic sequence of the 5-lipoxygenase-activating protein (flap), polymorphic markers thereof and methods for detection of asthma: The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases involving the leukotriene pathway such as asthma. The invention provides means to determine the predisposition of individuals to diseases involving the... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association

20090155781 - High throughput genome sequencing on dna arrays: The present invention is directed to methods and compositions for acquiring nucleotide sequence information of target sequences using adaptors interspersed in target polynucleotides. The sequence information can be new, e.g. sequencing unknown nucleic acids, re-sequencing, or genotyping. The invention preferably includes methods for inserting a plurality of adaptors at spaced... Agent: Morgan, Lewis & Bockius, LLP

20090155782 - Homoeologous region determining method by homo junction fingerprint method, homoeologous region determining device, and gene screening method: To provide a method for efficiently searching for a recessive disease gene without needing any pedigree analysis. In a homoeologous region determining method, the following steps are conducted. It is determined whether or not the base constituting a polymorphic marker of a sample DNA of diploid or higher polyploidy is... Agent: Day Pitney LLP

20090155796 - Marker for cancer prognosis and methods related thereto: The present invention is related to the novel discovery that HIF-2α, but not HIF-1α, selectively regulates adenosine A2A receptor in endothelial cells, thereby revealing a unique and hitherto unknown pathway by which HIF-2α can regulate angiogenesis independent of HIF-1α. This discovery allows for design of new diagnostic tools and novel... Agent: Sheridan Ross PC

20090155778 - Mental disorder-related gene and use of the same: Disclosed is useful means for the therapy or diagnosis of a mental disorder. A method for screening for a compound which is effective for a mental disorder, comprising the steps of (1) providing a cell capable of expressing a gene (target gene) selected from the group consisting of a gene... Agent: Edwards Angell Palmer & Dodge LLP

20090155791 - Method for detecting methylation status by using methylation-independent primers: A reliable and highly sensitive method is provided for detecting methylation status of CpG-containing nucleic acids by nucleic acid amplification and melting curve analysis of amplification products. The methods and compositions employs a novel design of primers. CpG-containing methylation-independent oligonucleotide primers, wherein both unmethylated and methylated alleles of a CpG-containing... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090155783 - Method of preparing a biological specimen slide: A method of preparing a slide of a biological specimen, including the steps of (a) providing a slide containing a biological specimen and a cover slip, (b) placing a liquid non-evaporating sealing compound such as mineral oil at spaced locations around an area on the slide and (c) placing the... Agent: Vysis, Inc Patent Department

20090155801 - Method of sequencing dna: The present invention provides a method of identifying a base at a target position in a sample nucleic acid sequence, said method comprising: subjecting a primer hybridised to said sample nucleic acid immediately adjacent to the target position, to a polymerase primer extension reaction in the presence of a nucleotide,... Agent: Dorsey & Whitney LLP Intellectual Property Department

20090155780 - Methods for determining genetic haplotypes and dna mapping: Improved methods of genetic haplotyping and DNA sequencing and mapping, including methods for making amplified ssDNA, methods for allele determination, and a DNA barcoding strategy based on direct imaging of individual DNA molecules and localization of multiple sequence motifs or polymorphic sites on a single DNA molecule.... Agent: Richard Aron Osman

20090155799 - Methods for diagnosing pancreatic cancer using reg4 protein: REG4, a new member of REG family was identified as a biomarker of pancreatic adenocarcinoma. The present invention provides sandwich ELISA to detect serum REG4 in patients with resectable pancreatic cancers i.e. PDACs. The present invention also provides a method for diagnosing a pancreatic cancer using REG4 as a serological... Agent: Townsend And Townsend And Crew, LLP

20090155797 - Methods for generating enhanced antibody-producing cell lines with improved growth characteristics: The use of mismatch repair (MMR) defective antibody producer cells offers a method to generate subclone variants with elevated protein production such as antibodies. Using MMR defective cells and animals, new cell lines and animal varieties with novel and useful properties such as enhanced protein production can be generated more... Agent: Woodcock Washburn LLP

20090155777 - Methods for performing direct enzymatic reactions involving nucleic acid molecules: Methods for performing a direct enzymatic reaction involving a nucleic acid molecule include performing the enzymatic reaction directly using a biological specimen in a reaction mixture containing a zwitterionic buffer and/or a non-reducing carbohydrate to prevent the biological specimen from inhibiting the enzymatic reaction, in which a nucleic acid molecule... Agent: The Nath Law Group

20090155803 - Methods for tissue analysis: This invention relates to methods of analyzing a tissue sample from a subject. In particular the invention combines morphological staining and/or immunohistochemistry (IHC) with fluorescence in situ hybridization (FISH) within the same section of a tissue sample. The analysis can be automated or manual. The invention also relates to kits... Agent: Goodwin Procter LLP Attn: Patent Administrator

20090155802 - Mutant dna polymerases with improved pyrophasphorolysis activated polymerization (pap) ability: Disclosed are mutant DNA polymerases having improved extension rates relative to a corresponding, unmodified polymerase. The mutant polymerases are useful in a variety of disclosed primer extension methods. Also disclosed are related compositions, including recombinant nucleic acids, vectors, and host cells, which are useful, e.g., for production of the mutant... Agent: Townsend And Townsend And Crew, LLP

20090155787 - Mutations in the bcr-abl tyrosine kinase associated with resistance to sti-571: The invention described herein relates to novel genes and their encoded proteins, termed Mutants Associated with Resistance to STI-571 (e.g., T315I Bcr-Abl), and to diagnostic and therapeutic methods and compositions useful in the management of various cancers that express MARS. The invention further provides methods for identifying molecules that bind... Agent: Kenyon & Kenyon LLP

20090155792 - Predictors of long-term mortality following coronary artery bypass graft surgery: The present invention relates, in general, to perioperative depression and, in particular, to methods of identifying individuals at risk of perioperative depression.... Agent: Nixon & Vanderhye, PC

20090155785 - Real-time colorimetric screening inhibitors of endonuclease with gold nanoparticle substrate: The invention provides methods for screening a compound for its effect on endonuclease activity. The methods comprise providing a compound to be screened utilizing a gold nanoparticle aggregate as the substrate for the endonuclease. The gold nanoparticle aggregate is formed by the hybridization of oligonucleotides attached to the nanoparticles, with... Agent: Gregory T. Pletta Nanosphere, Inc.

20090155809 - Subtractive single label comparative hybridization: Provided are methods of determining differences between nucleic acids in a test sample and a reference sample. In certain embodiments the methods are used for detecting and mapping chromosomal or genetic abnormalities associated with various diseases or with predisposition to various diseases, or to detecting the phenomena of large scale... Agent: Foley & Lardner LLP

20090155798 - Tle3 as a marker for chemotherapy: Methods of using TLE3 as a marker for predicting the likelihood that a patient's cancer will respond to chemotherapy. Methods of using TLE3 as a marker for selecting a chemotherapy for a cancer.... Agent: Choate, Hall & Stewart LLP

20090155812 - Apolipoprotein fingerprinting technique and methods related thereto: A method for determining the concentration and modifications of apolipoprotein in biological samples including plasma, serum, and lipoprotein fractions, by obtaining a sample from a patient, adding a specific volume of an internal standard to the sample, applying the sample to a surface-enhanced, Protein G-coated, antibody-bound chip and removing unbound... Agent: Kaplan Ward & Patel LLC

20090155811 - Lateral flow immunoassay with encapsulated detection modality: A lateral flow immunoassay featuring encapsulated metal particles. The encapsulated particles may use SERS nanotags as the detection modality. The use of encapsulated particles as a detection modality, in particular encapsulated SERS tags increases the sensitivity of an LFI prepared for visual reading and introduces the ability to obtain substantially... Agent: David W. Highet, Vp And ChiefIPCounsel Becton, Dickinson And Company

20090155813 - Methods and devices for diagnosis of appendicitis: A method is provided for diagnosing appendicitis in a patient that includes identifying at least one symptom of appendicitis in the patient and identifying the presence of at least one molecule differentially associated with appendicitis in a fluid or tissue sample of said patient. MRP-8/14 and haptoglobin are examples of... Agent: Greenlee Winner And Sullivan P C

20090155810 - Methods for producing members of specific binding pairs: A member of a specific binding pair (sbp) is identified by expressing DNA encoding a genetically diverse population of such sbp members in recombinant host cells in which the sbp members are displayed in functional form at the surface of a secreted recombinant genetic display package (rgdp) containing DNA encoding... Agent: Howrey LLP - East

20090155819 - Mammalian t1r3 sweet taste receptors: The present invention provides isolated nucleic acid and amino acid sequences of sweet taste receptors, the receptors comprising consisting of a monomer or homodimer of a T1R3 G-protein coupled receptor polypeptide, antibodies to such receptors, methods of detecting such nucleic acids and receptors, and methods of screening for modulators of... Agent: Fenwick & West LLP

20090155818 - Measuring receptor homodimerization: The invention provides methods and kits for detecting and/or measuring receptor homodimers on a cell surface membrane. In one aspect, the methods employ pairs of probes comprising binding compounds and a cleaving probe, such that at least one binding compound binds specifically to the same epitope of a membrane-bound analyte... Agent: Monogram/fenwick

20090155821 - Antibody-dependent cellular cytotoxicity assay: Methods for detecting antibody dependent cellular cytotoxicity (ADCC) are described herein. The methods are label-free, and can be performed in real time on adherent cells. The methods can include, for example, (a) monitoring the impedance between electrodes on a non-conducting substrate that supports the growth of target cells in an... Agent: Fish & Richardson P.C.

20090155820 - Asc as a marker for colorectal cancer: The present invention relates to the diagnosis of colorectal cancer. It discloses the use of protein ASC (apoptosis-associated speck-like protein containing a caspase-associated recruitment domain) in the diagnosis of colorectal cancer. It relates to a method for diagnosis of colorectal cancer from a liquid sample, derived from an individual by... Agent: Roche Diagnostics Operations Inc.

20090155814 - Proteins in type 2 diabetes: The present invention relates to the use of naturally occurring compounds and derivatives thereof as markers for predisposition of diabetes related diseases. The invention also relates to a pharmaceutical composition for treatment of diabetes related diseases.... Agent: Birch Stewart Kolasch & Birch

20090155816 - Biosensor having nano wire for detecting food additive mono sodium glutamate and manufacturing method thereof: There is provided a biosensor capable of increasing a detecting sensitivity of a target substance of glutamate, by using a nano wire having excellent electrical characteristics and by immobilizing a receptor of glutamate to be detected on a substrate which is disposed between a nano wire and another nano wire... Agent: Venable LLP

20090155815 - Crystal structure of the carboxyl transferase domain of human acetyl-coa carboxylase 2 protein (acc2 ct) and uses thereof: A crystallized human ACC2 CT protein as well as a description of the X-ray diffraction pattern of the crystal are disclosed. The diffraction pattern allows the three dimensional structure of human ACC2 CT to be determined at atomic resolution so that ligand binding sites on human ACC2 CT can be... Agent: Philip S. Johnson Johnson & Johnson

20090155817 - Genetic products differentially expressed in tumors and the use thereof: The invention relates to the identification of genetic products expressed in association with tumors and to coding nucleic acids for the expressed products. An embodiment of the invention also relates to the therapy and diagnosis of disease in which the genetic products are aberrantly expressed in association with tumors, proteins,... Agent: Mcandrews Held & Malloy, Ltd

20090155823 - Automated immunoassay apparatus: An automated immunoassay apparatus is disclosed comprising a single optical reading device (2a, 2b) for reading two microtitre plates (9, 14). A first microtitre plate (9) is loaded into an upper plate holder (8) which is linearly translated at a fixed height. A second microtitre plate (14) is loaded into... Agent: Diederiks & Whitelaw, PLC

20090155825 - Detection of anaplasma platys: The invention provides compositions and methods for the detection of Anaplasma platys polynucleotides and polypeptides.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090155824 - Methods for antibody engineering: The invention provides a method for identifying positions of an antibody that can be modified without significantly reducing the binding activity of the antibody. In many embodiments, the method involves identifying a substitutable position in a parent antibody by comparing its amino acid sequence to the amino acid sequences of... Agent: Bozicevic, Field & Francis LLP

20090155822 - Process for diagnosing rheumatic diseases: The invention relates to polypeptides reacting with rheumatism-associated autoantibodies. The invention moreover relates to a diagnostic agent comprising any of said polypeptides, to a diagnostic kit comprising said diagnostic agent and to a process for in vitro detection of rheumatic diseases. The invention furthermore relates to a medicament comprising any... Agent: Millen, White, Zelano & Branigan, P.C.

20090155826 - Biomarkers for pre-diabetes, cardiovascular diseases, and other metabolic-syndrome related disorders and methods using the same: Biomarkers relating to insulin resistance, pre-diabetes, type-2 diabetes, metabolic syndrome, atherosclerosis, and cardiomyopathy are provided, as well as methods for using such biomarkers as biomarkers for insulin resistance, pre-diabetes, type-2 diabetes, metabolic syndrome, atherosclerosis, and cardiomyopathy. In addition, methods for modulating the respective disorders or conditions of a subject are... Agent: Brinks Hofer Gilson & Lione

20090155828 - Methods of detecting prostate cancer: Proteins specific for prostate epithelial cells, normal or neoplastic, are identified and used for diagnosis, development of antibodies, and for evaluating drugs that react with the neoplastic specific proteins. Affinity based probes are used that react specifically with the active site to provide a measure of the enzyme activity of... Agent: Knobbe Martens Olson & Bear LLP

20090155827 - Pigf and flt-1 as prognostic parameters for cardiovascular diseases: The present invention refers to a use of an ex vivo method comprising the determination of PlGF and sFlt-1 in a sample for diagnosis, risk stratification and/or monitoring of a vascular disease with atherosclerotic etiology, in particular a coronary heart disease such a unstable angina pectoris or myocardial infarction, and/or... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090155829 - Heme choline esters and uses thereof: Methods of activating an apo-peroxidase are provided. The methods include the steps of providing a solution comprising an apo-peroxidase and a heme choline ester, hydrolyzing the heme choline ester with a choline esterase, and converting the apo-peroxidase to active peroxidase. The methods disclosed herein also provide for detecting the presence... Agent: General Electric Company Global Research

20090155832 - Apparatus and method for improved optical detection of particles in fluid: A number of fluidic-photonic devices for allowing optical detection, systems employing such devices, and related methods of operation and fabrication of such devices are disclosed herein. In at least some embodiments, the devices can serve as flow cytometry devices and/or employ microfiuidic channels. Also, in at least some embodiments, the... Agent: Whyte Hirschboeck Dudek S C Intellectual Property Department

20090155831 - Cardiomyocytes and methods of producing and purifying cardiomyocytes: The invention provides methods for producing a culture of cardiomyocytes and cultures of cardiomyocytes. Exemplary methods of producing and cultures of cardiomyocytes include a population of cells including cells having spontaneous and periodic electrical activity, and/or including nodal, sino-atrial or pacemaker cells; immature cardiomyocytes (cardiomyoblasts); mature contractile cardiomyocytes; or a... Agent: Pillsbury Winthrop Shaw Pittman LLP

20090155830 - Composition and a kit for detecting early apoptosis in frozen umbilical cord and a method therefor: There are provided a composition and kit for detecting early apoptosis in cryopreserved umbilical cord blood stem cells, and a method therefor. According to the present invention, when the umbilical cord blood stem cells are cryopreserved and later used for cell therapy, the quality of umbilical cord blood is assessed... Agent: Jhk Law

20090155838 - Devices, systems and methods for the collection, stimulation, stabilization, and analysis of a biological sample: Devices, systems, methods and kits for the collection, stimulation, stabilization and analysis of biological samples, including blood samples, are disclosed. An embodiment of the invention includes a container having a side wall, a bottom wall and a closure member defining an internal compartment having arranged therein a partition defining and... Agent: Wilson Sonsini Goodrich & Rosati

20090155835 - Diagnostic method and prognostic tool for rheumatoid arthritis: The invention relates to a diagnostic method and prognostic tool for rheumatoid arthritis and uses thereof.... Agent: Dobrusin & Thennisch PC

20090155834 - Methods for identifying agents which alter histone protein acetylation, decrease aging or increase lifespan: Methods of identifying agents which alter the NAD-dependent acetylation status and mono-ADP-ribosylation of nuclear proteins are disclosed. The methods further include identifying agents which alter the life span or aging of a cell or an organism by determining the level of NAD-dependent acetylation and/or ADP ribosylation of a nuclear protein.... Agent: Lowrie, Lando & Anastasi, LLP

20090155836 - Methods for treating hiv infected subjects: Methods for inducing a population of T cells to proliferate by activating the population of T cells and stimulating an accessory molecule on the surface of the T cells with a ligand which binds the accessory molecule are described. T cell proliferation occurs in the absence of exogenous growth factors... Agent: Wilmerhale/boston

20090155833 - Screening method of nesfatin-1-action regulating substance or nesfatin-1-like action substance with the use of receptor protein selected from the group consisting of gpr3, gpr6 and gpr12: t

20090155837 - Two-photon fluorescent probes for acidic vesicles in live cells and tissue and method of imaging acidic vesicles in live cells and tissue using the same:

20090155839 - Method for detecting bacterial spores: A method of detecting the presence and quantity of bacterial spores, which includes adding an electrophilic alcohol and an acid anhydride to a sample, admixing the sample with a solvent, and analyzing the sample. The sample may be analyzed by injecting the mixture into a gas chromatograph equipped with a... Agent: The Webb Law Firm, P.C.

20090155840 - Method and device for cell counting: A microfluidic device and method is provided for determining a cell concentration in a sample. The microfluidic device includes a body having a channel therethough that extends along an axis. The channel includes an input and an output, and is at least partially defined by a surface. Indicia overlaps the... Agent: Wisconsin Alumni Research Foundation

20090155841 - Smear slide preparing apparatus and smear slide preparing method: The present invention is to present a smear slide preparing apparatus capable of properly providing sample-related information on a predetermined area of a slide glass even when glass shards and dust and the like are attached to the predetermined area. A smear slide preparing apparatus comprises: a smear section for... Agent: Sughrue Mion, PLLC

20090155842 - Prognostic assay for metachronous colorectal cancer: The invention provides a prognostic assay for metachronous colorectal carcinoma, which assay comprises obtaining a colorectal mucosa tissue biopsy sample taken from a human or non-human mammalian subject, and determining the average longest nuclear axis for a set of elongate nuclei in elongate cells in dysplastic tissue within said sample.... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090155847 - Combinatorial dna library for producing modified n-glycans in lower eukaryotes: The present invention relates to eukaryotic host cells having modified oligosaccharides which may be modified further by heterologous expression of a set of glycosyltransferases, sugar transporters and mannosidases to become host-strains for the production of mammalian, e.g., human therapeutic glycoproteins. The invention provides nucleic acid molecules and combinatorial libraries which... Agent: Merck And Co., Inc

20090155846 - Kinase anchor protein muteins, peptides thereof and related methods: A-kinase anchor protein (AKAPS) muteins, peptides thereof, and nucleic acids encoding the peptides are provided herein. Also provided are transgenic animals, cells comprising transgenes and various methods employing such peptides.... Agent: Grant Anderson LLP C/o Portfolioip

20090155844 - Method of synthesizing a suppressor trna, dna construct and use thereof for producing a non-natural amino acid-incorporated protein: There are provided a DNA construct comprising non-eukaryote-derived suppressor tRNA gene containing no internal promoter functioning in a eukaryotic cell, and a eukaryote-derived or bacteriophage-derived promoter linked at the 5′ end of the tRNA gene, a method for synthesizing a suppressor tRNA by using the DNA construct, and a process... Agent: Birch Stewart Kolasch & Birch

20090155845 - Molecules designated ldcam: The invention is directed to LDCAM as a purified and isolated protein, the DNA encoding the LDCAM, host cells transfected with cDNAs encoding LDCAM, processes for preparing LDCAM polypeptides and compositions and methods for treating utilizing LDCAM polypeptides.... Agent: Immunex Corporation Law Department

20090155848 - Novel glucose dehydrogenase: The present invention provides glucose dehydrogenase which is excellent in heat resistance and substrate specificity and is not affected by dissolved oxygen. Specifically, the present invention relates to glucose dehydrogenase characterized by being derived from an eukaryotic organism and keeping 90% or more activity after being treated with heat at... Agent: Leydig Voit & Mayer, Ltd

20090155843 - Tnf antagonists: TNF binding polypeptides based on human tetranectin C-type lectin like domains (CTLD) with improved binding characteristics and improved efficacy. The polypeptides comprise a TNF binding domain having the amino acid sequence KRWS-RYF (SEQ ID NO:1). Also provided are methods of preparing the polypeptides of the invention. The polypeptides may be... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090155849 - Generation of specific adhesion in gram-negative bacteria by means of anchoring immunoglobulin single domains on their surface with autotransporters: The present invention refers to an expression vector for gram-negative bacteria allowing for the production of hybrid proteins between single domain recombinant antibodies and a transporter domain of an autotransporter, as well as to its anchoring and expression on the external surface of a bacterial membrane, and to a method... Agent: Mathews, Shepherd, Mckay, & Bruneau, P.A.

20090155850 - Horse:human chimeric antibodies: The present invention provides a plurality of chimeric single chain variable region (scFv) antibodies. The chimeric scFv antibodies individually comprise variable regions from both horse and non-horse antibodies. Methods of making and using the plurality are also provided.... Agent: Marshall, Gerstein & Borun LLP

20090155852 - Hyaluronan synthase genes and expression thereof in bacillus hosts: The present invention relates to a recombinant Bacillus host cell containing a recombinant vector including a nucleic acid segment having a coding region segment encoding enzymatically active hyaluronan synthase (HAS). The recombinant Bacillus host cell is utilized in a method for producing hyaluronic acid (HA).... Agent: Dunlap Codding, P.C.

20090155851 - Novel process for preparation of chondroitin fraction: e

20090155853 - Non-viral gene delivery complex: The invention relates to fusion proteins useful in delivering a targeted nucleic acid to a target cell, comprising a gene delivery fusion protein (GDFP), said GDFP comprising a nucleic acid binding domain (NBD) that binds to the targeted nucleic acid, fused to a gene delivery domain (GDD) that mediates delivery... Agent: Knobbe, Martens, Olson & Bear, LLP

20090155855 - Cover for sample with homogenous pressure application: The present invention relates to means for covering one or more sample(s) that are suitable to avoid or minimize evaporation and/or condensation of any vaporizable substance that may be present in the sample(s) or reaction mixture(s), in particular evaporation of substance at the fringes of a vessel or an array... Agent: King Spalding LLP

20090155854 - Method for amplifying a flavivirus cdna in a prokaryotic cell: The invention relates to a method for amplifying a functional flavivirus cDNA in a prokaryotic cell, such as E. coli. The method involves a modified flavivirus cDNA that has one or more silent mutations in one or more prokaryotic promoter regions within a flavivirus cDNA. The silent mutation decreases or... Agent: Alston & Bird LLP

20090155856 - Nucleic acid amplification method: An object to be achieved by the present invention is to provide a nucleic acid amplification method by which a nucleic acid can be amplified using oligonucleotide primers and DNA polymerase. The present invention provides a nucleic acid amplification method which comprises performing incubation of a reaction solution containing at... Agent: Birch Stewart Kolasch & Birch

20090155858 - Iterative nucleic acid assembly using activation of vector-encoded traits: Certain aspects of the present invention provide methods for assembling nucleic acid molecules using iterative activation of one or more vector-encoded traits to progressively assemble a longer nucleic acid insert. Aspects of the invention also provide kits, compositions, devices, and systems for assembling synthetic nucleic acids using iterative activation of... Agent: Wolf Greenfield & Sacks, P.C.

20090155857 - Facilitator and method for amplification: Subject matter of the invention is a method for amplification of nucleic acids, wherein a successful binding of a primer and a facilitator onto the template is required for amplification. The invention further comprises the inventive facilitator, inventive kits comprising a facilitator and the use of said inventive method, facilitator... Agent: Kriegsman & Kriegsman

20090155859 - Contamination-free reagents for nucleic acid amplification: Methods and kits for generating contamination-free reagents and reagent solutions for use in nucleic acid amplification are provided. Methods include processing of polymerase solutions, nucleotide solutions and primer solutions to render contaminating nucleic acid inert. The methods employ the proofreading activity of the polymerase and/or exonucleases to de-contaminate the reagents... Agent: General Electric Company Global Research

20090155860 - Process for the production of oligosaccharides: A process for producing a prebiotic mixture of galactooligosaccharides from lactose using galactosidase producing bacteria, wherein the bacterial cells may be reused in synthesis reactions without loss of yield of the product.... Agent: Christie, Parker & Hale, LLP

20090155861 - Method for producing an l-amino acid using a bacterium of the enterobacteriaceae family: A method is described for producing an L-amino acid, for example L-threonine, L-lysine, L-leucine, L-histidine, L-cysteine, L-phenylalanine, L-arginine, L-tryptophan, L-glutamic acid, L-valine, and L-isoleucine, by fermentation of glucose using a bacterium of the Enterobacteriaceae family, wherein the bacterium has been modified to enhance the activity of the high-affinity arabinose transporter... Agent: Cermak & Kenealy LLP Acs LLC

20090155862 - Process for the preparation of 2-hydroxymethyl-pyrrolidine-3,4-diols: m

20090155863 - Ketoreductase polypeptides and uses thereof: The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to synthesize a variety of... Agent: Dechert, LLP

20090155864 - Systems, methods, and devices for employing solar energy to produce biofuels: A photo-bioreactor can be arranged to receive incident solar radiation. The photo-bioreactor can contain photosynthetic organisms. The photosynthetic organisms can be genetically modified to produce an organic substance. The organic substance can be a biofuel or a precursor to a biofuel. The precursor can be isolated and converted into a... Agent: Miles & Stockbridge PC

20090155865 - Esterases and their use for processes for kinetic resolution of butinolesters: New enzymes having esterase activity and their use for processes for kinetic resolution of butinolesters.... Agent: Connolly Bove Lodge & Hutz, LLP

20090155867 - Glycolic acid production by fermentation from renewable resources: The present invention provides a method for the biological production of glycolic acid from a fermentable carbon source in a microorganism. In one aspect of the present invention, a process for the conversion of glucose to glycolic acid is achieved by the use of a recombinant organism comprising a host... Agent: Bozicevic, Field & Francis LLP

20090155866 - Methods for the synthesis of olefins and derivatives: The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method... Agent: Mcdermott, Will & Emery

20090155868 - Method of production of optically active halohydrocarbons and alcohols using hydrolytic dehalogenation catalysed by haloalkanedehalogenases: A method of production of optically active compounds, particularly halohydrocarbons, haloalcohols, alcohols, halopolyols and polyols using hydrolytic dehalogenation of racemic or prochiral halegenhydrocarbons by dehalohenation catalysed by haloalkane dehalogenases (EC where at least one wild type or modified haloalkane dehalogenase is affected by at least one racemic or prochiral... Agent: Notaro & Michalos P.C.

20090155869 - Engineered microorganisms for producing n-butanol and related methods: A recombinant microorganism expressing at least a heterologous enzyme of an NADH-dependent pathway for conversion of a carbon source to n-butanol, metabolic intermediate and/or a derivative thereof and capable of producing n-butanol, a metabolic intermediate and/or a derivative thereof at a high yield and related methods. The recombinant microorganism engineered... Agent: Paul, Hastings, Janofsky & Walker LLP

20090155870 - Fermentive production of four carbon alcohols: Methods for the fermentive production of four carbon alcohols are provided. Specifically, butanol, preferably 2-butanol is produced by the fermentive growth of a recombinant bacteria expressing a 2-butanol biosynthetic pathway. The recombinant microorganisms and methods of the invention can also be adapted to produce 2-butanone, an intermediate in the 2-butanol... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center

20090155872 - Alcoholic xylose fermentation at high temperatures by the thermotolerant yeast hansenula polymorpha: Methods and compositions for the production of ethanol from lignocellulosic starting materials are provided herein. Embodiments provide yeast cells of the genus H. polymorpha with one or more modifications, including, for example, an inactive acid trehalase gene, overexpression of xylulokinase, and/or overexpression of heat-shock protein 104.... Agent: Buchanan Ingersoll & Rooney PC (archer Daniels Midland Company)

20090155871 - Methods and compositions for ethanol producing cyanobacteria: The present invention relates to methods and systems for the production of ethanol by cyanobacteria. More specifically, the methods can be used to produce ethanol using genetically engineered light responsive cyanobacteria.... Agent: Knobbe Martens Olson & Bear LLP

20090155873 - Biofuel production: Methods, enzymes, recombinant microorganism, and microbial systems are provided for converting polysaccharides, such as those derived from biomass, into suitable monosaccharides or oligosaccharides, as well as for converting suitable monosaccharides or oligosaccharides into commodity chemicals, such as biofuels. Commodity chemicals produced by the methods described herein are also provided. Commodity... Agent: Seed Intellectual Property Law Group PLLC

20090155874 - Method for producing terpenes and mep-transformed microorganisms therefore: The present invention relates to a microorganism capable of producing a terpene of choice. The microorganism expresses a heterologous pathway for the formation of isoprene units and, preferably, a heterologous terpene synthase. In this way, high amounts of terpene can be isolated from the medium of the microorganism.... Agent: Winston & Strawn LLP Patent Department

20090155876 - Biological production method of photoconductive arsenic-sulfide (as-s) nanotube and strain used for the same: Disclosed is a biological method for preparing arsenic sulfide (As—S) compounds. More particularly, the present invention provides a method for production of nanotubes based on As—S compounds including As2S3 by reacting thiosulfate S2O32− with arsenate As5+ through mediation of Shewanella sp. strain.... Agent: The Nath Law Group

20090155875 - Methods to enhance carbon monoxide dehydrogenase activity and uses thereof: This invention relates, in part, to methods and compositions for modulating the water-gas shift reaction (e.g., promoting the water-gas shift forward reaction) or in which the water-gas shift reaction has been modulated. The methods and compositions, therefore, also relate, in part, to increasing the oxidation rate of carbon monoxide (CO),... Agent: Wolf Greenfield & Sacks, P.C.

20090155877 - Biochip for sorting and lysing biological samples: A biochip (100) for lysing and/or cell separation is formed to provide a sealed chamber for biological fluid. A conductive layer (140) bonded between upper (130) and lower (150) insulating layers is etched to form a microfluidic channel (250) between two electrodes (190, 200). The microfluidic channel connects a fluid... Agent: Dinsmore & Shohl LLP

20090155878 - Apparatus, method and system for creating, handling, collecting and indexing seed and seed portions from plant seed: An apparatuses, methods and systems for creating, handling and collecting seed portions are highly beneficial. The apparatus includes a carrier having one or more carrying positions adapted to carry a seed. The carrying positions having a seed orienter adapted to orient the seed relative to the carrying position in the... Agent: Mckee, Voorhees & Sease, P.L.C Attn: Pioneer Hi-bred

20090155879 - Reconstitution of 5-enolpyruvylshikimate-3-phosphate synthase activity by fragment complementation: The present invention relates to protein fragments of 5-enolpyruvylshikimate-3-phosphate synthase, which are selected from the protein fragment pairs of EPSPS, two such protein fragments can make up full length EPSPS and reconstitute EPSPS activities by complementation without help of any joint structure. The present invention also relates to nucleic acid... Agent: Fish & Richardson PC

20090155880 - Mutant protein having diaphorase activity: A mutant protein having diaphorase activity is provided. A mutant protein includes an amino acid sequence obtained by deletion, replacement, addition, or insertion of at least one amino acid residue of a native-form amino acid sequence of SEQ. ID. No. 1, wherein the mutant protein has diaphorase activity with an... Agent: K&l Gates LLP

20090155881 - Cell-free protein synthesis method and cell-free protein synthesis reaction solution using adenosine 3',5'-bisphosphate: The present invention provides a method of conducting cell-free protein synthesis by conveniently suppressing mRNA degradation, and a reaction solution enabling cell-free protein synthesis by conveniently suppressing mRNA degradation. A cell-free protein synthesis method using a cell-free protein synthesis reaction solution containing at least an extract liquid derived from a... Agent: Cheng Law Group, PLLC

20090155882 - Alpha-amylase variants: The invention relates to a variant of a parent Termamyl-like alpha-amylase, which variant exhibits altered properties, in particular reduced capability of cleaving a substrate close to the branching point, and improved substrate specificity and/or improved specific activity relative to the parent alpha-amylase.... Agent: Novozymes North America, Inc.

20090155884 - Avian leukosis viruses and polypeptide display: The invention provides methods and materials involved in displaying polypeptide sequences using viruses such as avian leukosis viruses. Specifically, the invention provides nucleic acid molecules, collections of nucleic acid molecules, polypeptides, collections of polypeptides, viruses, and collections of viruses as well as methods for making nucleic acid molecules, collections of... Agent: Fish & Richardson P.C.

20090155883 - Scientifically modulated and reprogrammed treatment (smart) virus technology intended to neutralize the human immunodeficiency virus: The concept is to combat one of the deadliest infectious diseases known by fighting fire with fire. Scientifically Modulated And Reprogrammed Treatment (SMART) Virus technology is intended to neutralize the Human Immunodeficiency Virus. The SMART Virus carrying combinations of CD4, CCR5 and CXCR4 cell-surface receptors is capable of engaging the... Agent: Lane B. Scheiber

20090155885 - Device and method for the incubation of cells: Device for the incubation of cells comprising a sterile or sterilisable, portable receptacle for enclosing in a contamination-proof manner at least one integrated and/or insertable culture vessel for accommodating cells with at least one closable opening for introducing and/or removing cells and/or culture medium and/or a culture vessel into and/or... Agent: Vidas, Arrett & Steinkraus, P.A.

20090155886 - Nucleic acids and polypeptides specific for pathogenic strains of the neisseria genus: The invention concerns nucleic acids coding for polypeptides specific of the Neisseria genus pathogenic strains, the corresponding polypeptides, and their diagnostic and therapeutic applications.... Agent: Stites & Harbison PLLC

20090155887 - Vaccine composition: The present invention provides a hyperblebbing non-typeable Haemophilus influenzae bacterium which has been genetically modified by either or both processes selected from a group consisting of: down-regulation of expression of one or more tol genes; and mutation of one or more gene(s) encoding a protein comprising a peptidoglycan-associated site to... Agent: Glaxosmithkline Corporate Intellectual Property, Mai B482

20090155888 - Fluorescent protein: e

20090155889 - System and method for regeneration of an absorbent solution: A system (10) for absorbing an acidic component from a process stream (22), the system including: a process stream (22) including an acidic component; an absorbent solution to absorb at least a portion of the acidic component from the process stream (22), wherein the absorbent solution includes an amine compound... Agent: Michaud-duffy Group LLP

20090155890 - Use of non-pathogenic bacteria in their spore or dormant form to remove glycypharus droppings and allergic materials of all sorts of textile: The use and application of non-pathogenic bacteria in their spore or dormant form to remove glycyphagus droppings and other organic allergenic materials of any sorts of textile and in any environment they occur in and characterised by the fact that the non-pathogenic bacteria consume the glycyphagus droppings and organic allergenic... Agent: Stabilpress International Nv

20090155891 - Apparatus for detecting nucleic acid amplification product in real time: There is provided an apparatus for detecting a nucleic acid amplification product in real time, which is capable of effectively excluding or reducing apparatus error factors without using a second fluorescence signal used for correction. A plurality of wells 7A are given with temperature cycles and fluorescence strength from a... Agent: Kratz, Quintos & Hanson, LLP

20090155892 - Bioreactor comprising a retaining system: Disclosed is a bioreactor in which a supporting wall (100) or a retaining mechanism (100) that represents pressure relief for a gas-tightly embodied flap is provided behind the flap (14) used for filling and emptying the bioreactor while percolate is prevented from accumulating between the gas-tight flap and the retaining... Agent: Morrison & Foerster, LLP

20090155893 - Methods and apparatus for amplification of dna using sonic energy: Apparatus and methods for amplification of DNA are provided that use sonic energy in place of conventional thermocyclers. In one embodiment, sonic energy is applied to a PCR cocktail to effect dissociation of double stranded DNA into single strands of DNA. A quiescence stage, where no sonic energy is applied,... Agent: Holme Roberts & Owen, LLP

20090155894 - Electrokinetic thermal cycler and reactor: Microfluidic devices are disclosed for carrying out cyclic or iterated reactions such as PCR, LDR, and other cyclic or iterated reactions. A microchannel forms a closed loop, through which a reaction mixture may be thermally cycled an arbitrary number of times. Flow is preferably mediated primarily by electrokinetics. Multiple temperature... Agent: Patent Department Taylor, Porter, Brooks & Phillips, L.l.p

20090155895 - Liquid-gas-phase exposure reactor for cell culturing: Initiation of growth and cultivation of cells can be performed by introducing the cells into culture compartments of a liquid-gas-phase exposure bioreactor containing a supply chamber in which there are disposed hollow-filament membranes having an inside diameter of no larger than 5 mm, wherein an inner volume of said hollow-filament... Agent: Oblon, Spivak, Mcclelland Maier & Neustadt, P.C.

20090155896 - Human cancer suppressor gene, protein encoded therein, expression vector containing the same, and cell transformed by the vector: Disclosed are a human cancer suppressor gene, a protein encoded therein, an expression vector containing the same, and a cell transformed by the vector. The gene of the present invention can be used for diagnosing, preventing and treating the human cancers.... Agent: Hamre, Schumann, Mueller & Larson, P.C.

20090155897 - Glycoprotein vi fusion proteins: s

20090155898 - Method for producing dendritic cells: Disclosed are embryonic stem cell-derived dendritic cells, genetically modified immature dendritic cells capable of maturation, as well as methods for the production of such cells. In one embodiment, the cells made be produced by a method comprising the steps of providing a population of embryonic stem cells; culturing the embryonic... Agent: Bozicevic, Field & Francis LLP

20090155899 - Modified chimeric polypeptides with improved pharmacokinetic properties: Modified chimeric polypeptides with improved pharmacokinetics are disclosed. Specifically, modified chimeric Flt1 receptor polypeptides that have been modified in such a way as to improve their pharmacokinetic profile are disclosed. Also disclosed are methods of making and using the modified polypeptides including but not limited to using the modified polypeptides... Agent: Regeneron Pharmaceuticals, Inc

20090155900 - Cell culture matrices: The present invention relates to cell culture, more specifically to cell culture which may be cell culture such as stem cell culture, embryonic stem cell (ESC) culture and primary cell culture. Disclosed herein are compositions of matter, including without limitation cell matrices, matrix-forming formulations and cell cultures, wherein the cells... Agent: Invitrogen Corporation C/o Intellevate

20090155901 - Mammalian cell line expressing inducible c-src: The present invention is directed to a unique mammalian cell line expressing inducible c-Src, and, particularly, a unique human cell line overexpressing c-Src in an inducible manner.... Agent: Kilyk & Bowersox, P.l.l.c.

20090155902 - Manipulation of cells on a droplet actuator: A method of inoculating a culture medium including providing a droplet including a single cell type on a droplet actuator and inoculating a culture medium with the droplet. A method of providing a metabolically useful substance to a cell culture, including providing a droplet actuator including a cell culture droplet... Agent: Ward And Smith, P.A.

20090155906 - Cell differentiation suppressing agent, method of culturing cells using the same, culture solution, and cultured cell line: The object of the present invention is to provide a differentiation inhibiting agent which allows culture of a stem cell or an embryonic stem cell in an undifferentiated state without use of any feeder cell, a method for culturing using the same, a cell culture liquid using the same, and... Agent: Birch Stewart Kolasch & Birch

20090155905 - Composition and method for increasing apoptosis in cancer cells: Disclosed are cell permeable peptides and peptide agents that inhibit anti-apoptotic processes in cancer cells to promote tumor cell death, as well as a method for providing therapeutic treatment for cancer. The composition may be delivered in conjunction with a conventional chemotherapeutic agent to provide a synergistic effect that significantly... Agent: Donna J. Russell

20090155904 - Method of inhibiting expression of target mrna using sirna consisting of nucleotide sequence complementary to said target mrna: A inhibition method of target mRNA expression includes: (a) obtaining binding energy of a double combination section on a dsRNA sequence of all combination comprising complementary nucleotides to a random target mRNA; (b) dividing the binding energy into four sections on the dsRNA sequence of each combination to obtain a... Agent: Rothwell, Figg, Ernst & Manbeck, P.C.

20090155903 - Pharmaceutical composition and method: The invention provides compounds, pharmaceutical compositions and methods for the therapeutic treatment and prevention of neurodegenerative disorder and other Aβ42-related diseases and disorders.... Agent: Myriad Genetics Inc. Intellecutal Property Department

20090155907 - Removal of embedding medium: A method, apparatus and system for automated removal of an embedding medium from an embedded biological sample. The method comprising the steps of: providing an automated sample processing apparatus having an automated process operation capability that causes automated process operation events through robotic sample process functions; providing a clearing solvent,... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20090155908 - Bioreactor for cell growth and associated methods: Apparatuses, systems, and methods are provided for growing and maintaining cells. A three-dimensional matrix, such as a hydrogel material, is seeded with cells and placed in a bioreactor having two compartments. The matrix is supported between the two compartments by first and second porous materials, which engage opposing surfaces of... Agent: Alston & Bird LLP

20090155909 - Down-regulation of gene expression using artificial micrornas: Isolated nucleic acid fragments comprising precursor miRNA, and artificial miRNAs and their use in down-regulating gene expression are described.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center

20090155910 - Down-regulation of gene expression using artificial micrornas: Isolated nucleic acid fragments comprising precursor miRNAs, and artificial miRNAs and their use in down-regulating gene expression are described.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center

20090155911 - Genetically modified plants and their applications in phytoremediation: Genetically modified plants able to accumulate heavy metals in shoots and methods of removing and possibly recovering said heavy metals, using said genetically modified plants. Said genetically modified plants include more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn<2+>/Co<2+>/Cd<2+>/Pb<2+> subclass and that they... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090155913 - Compositions comprising promoter sequences and methods of use: Nucleic acid molecules, fragments and variants thereof having promoter activity are provided in the current invention. The invention also provides vectors containing a nucleic acid molecule of the invention and cells comprising the vectors. Methods for making and using the nucleic acid molecules of the invention are further provided.... Agent: Alston & Bird LLP

20090155912 - Method for transfer of molecular substances with prokaryontic nucleic acid-binding proteins: The invention relates to a method for the transfer of molecular substances, for example proteins or nucleic acids in cells, in the case of using DNA combined with a possible gene expression. A prokaryotic nucleic acid-binding protein is used for the transfer, which is preferably obtained from a thermostable organism.... Agent: Townsend And Townsend And Crew, LLP

06/11/2009 > patent applications in patent subcategories. invention type

20090148832 - Compositions and methods for generation of infectious hepatitis c virus in immortalized human hepatocytes: The present invention provides a cell line capable producing infectious hepatitis C virus 1a (HCV 1a) particles in culture. Disclosed are compositions and methods for an HCV 1a (clone H77) transfected immortal human hepatocyte (IHH) capable of generating infectious HCV 1a virus particles in culture. Also disclosed are methods of... Agent: Randolph Bretton

20090148830 - Identification of microorganisms causing acute respiratory tract infections (ari): The present invention relates to a method for the detection of acute respiratory tract infection (ARI) comprising the simultaneous amplification of several target nucleotide sequences present in a biological sample by means of a primer mixture comprising at least one primer set from each one of the following gene regions:... Agent: Nixon & Vanderhye, PC

20090148829 - Methods for rapid identification of pathogens in humans and animals: The present invention provides methods of: identifying pathogens in biological samples from humans and animals, resolving a plurality of etiologic agents present in samples obtained from humans and animals, determining detailed genetic information about such pathogens or etiologic agents, and rapid detection and identification of bioagents from environmental, clinical or... Agent: Casimir Jones, S.c.

20090148831 - Ns5a nucleotide sequence variation as a marker for interferon response: Methods and reagents for determining a nucleotide variation at position 937 of the HCV-1a NS5A gene useful in predicting an individual's response to interferon treatment are presented.... Agent: Roche Palo Alto LLC Patent Law Dept. M/s A2-250

20090148828 - Viral detection liposomes and method: A method of generating pathogen detecting liposomes includes a step of providing molecular beacons with fluorescing components. The molecular beacons include either strands of RNA or DNA and the fluorescing components include an emitter and a quencher. The method further uses nanodroplet technology to encapsulate the molecular beacons within a... Agent: Robert A. Parsons

20090148853 - Biomarkers for predicting the sensitivity of cells to immunomodulatory compounds during treatment of non-hodgkin's lymphoma: Provided herein are the biomarkers for monitoring the treatment by immunomodulatory compounds. The use of biomarkers such as SPARC, p21, and cyclin D1 mRNA or protein levels as biomarkers to predict whether an immunomodulatory compound is likely to be successful in treating certain types of cancer, such as NHL, is... Agent: Jones Day

20090148833 - Devices for generating detectable polymers: This document provides systems, devices, and methods involved in generating detectable polymers. For example, diagnostic systems, diagnostic devices, primer systems, and collections of primer systems are provided.... Agent: Fish & Richardson P.C.

20090148844 - Dna marker for meat tenderness in cattle: A method for assessing the tenderness of meat from an animal, comprising the step of testing the animal for a genetic marker in the calpain3 (CAPN3) gene associated with Warner-Bratzler peak force variation or for a genetic marker located other than in CAPN3 which shows allelic association therewith.... Agent: Sughrue Mion, PLLC

20090148845 - Enzyme measurement assay using a modified substrate comprising a substrate attached to a macromolecule via a spacer: The invention provides novel reagents and methodologies for detecting free versus bound compounds. It is particularly useful to detect thrombin when it is not bound to A2M in the presence of thrombin bound to A2M by using a modified substrate that is sterically hindered from reacting with the bound thrombin.... Agent: Occhiuti Rohlicek & Tsao, LLP

20090148843 - Means and methods for the prediction of joint destruction: The present invention relates to a method of diagnosing and/or predicting joint destruction, early joint destruction and/or accelerated joint destruction in particular, in rheumatoid arthritis, comprising determining in a sample obtained from an individual the presence of at least one nucleic acid sequence encoding an IL-4 receptor (IL-4R) which contains... Agent: Fulbright & Jaworski L.L.P.

20090148840 - Method for detecting colon cancer markers: A method of detecting a tumor marker for the diagnosis of large bowel cancer and adenomatous polyposis coli comprising the steps of a) collecting and freezing feces, b) homogenizing the frozen feces in the presence of an RNAase inhibitor and preparing a suspension, c) extracting RNA from the obtained sample... Agent: Frishauf, Holtz, Goodman & Chick, PC

20090148839 - Method for evaluating cell populations: The invention describes specific sialylated structures present on human stem cells and cell populations derived thereof. The invention is especially directed to methods to control the status of stem cells by observing changes in sialylation of the cells; and control of potential contaminations of biological materials; and reagents and methods... Agent: Birch Stewart Kolasch & Birch

20090148835 - Method for identifying the origin of a compound biological product: The present invention relates to an identification method. In particular, a method for identifying the origin of a compound biological product, including the batch of origin, but also in some cases the actual biological sources of a compound biological product.... Agent: Knobbe Martens Olson & Bear LLP

20090148836 - Method for rapid detection and identification of bioagents: Method for detecting and identifying unknown bioagents, including bacteria, viruses and the like, by a combination of nucleic acid amplification and molecular weight determination using primers which hybridize to conserved sequence regions of nucleic acids derived from a bioagent and which bracket variable sequence regions that uniquely identify the bioagent.... Agent: Casimir Jones, S.c.

20090148837 - Method for rapid detection and identification of bioagents: Method for detecting and identifying unknown bioagents, including bacteria, viruses and the like, by a combination of nucleic acid amplification and molecular weight determination using primers which hybridize to conserved sequence regions of nucleic acids derived from a bioagent and which bracket variable sequence regions that uniquely identify the bioagent.... Agent: Casimir Jones, S.c.

20090148838 - Methods for analysis of gene expression: This invention provides methods, compositions and kits for gene expression analysis and gene expression profiling. The methods of the invention are highly sensitive; have a wide dynamic range; are rapid and inexpensive; have a high throughput; and allow the simultaneous differential analysis of a defined set of genes. The methods,... Agent: Quine Intellectual Property Law Group, P.C.

20090148850 - Methods for identifying modulators of p2ry14: Methods for identifying modulators of P2RY14 are described. The methods are particularly useful for identifying agents that are useful for treating metabolic syndrome.... Agent: Merck And Co., Inc

20090148834 - Methods of use of alpha-methylacyl-coa racemase in hormone refractory and metastatic prostate cancers: Methods for identifying patients having or at risk of developing prostate cancer (including hormone refractory or androgen independent prostate cancer) and patients having or at risk of developing a cancer arising from metastasis if a prostate cancer to another tissue, e.g., liver and lymph node, by measuring the expression or... Agent: Millennium Pharmaceuticals, Inc.

20090148851 - Methods, kits, and compositions for detecting enzyme activity: The inventive subject matter relates to methods, kits, and compositions for detecting enzyme activity in a biological sample. In particular, the inventive subject matter relates to methods, kits, and compositions for detecting von Willebrand factor degrading enzyme activity in a biological sample.... Agent: The Nath Law Group

20090148846 - Modified oligonucleotides and applications thereof: Disclosed, among other things, are primers containing certain modified nucleobases in the 3′ terminal region of the primers that provide reduced formation of primer-dimers during amplification reactions, and various methods of use thereof.... Agent: Mila Kasan, Patent Dept. Applied Biosystems

20090148841 - Multiplexed genomic gain and loss assays: Encoded bead multiplex assays for chromosomal gains and losses are provided that provide the benefits of complex, large template DNA sources, such as BAC DNA, as the probe material without bead networking or other assay performance problems. Reagents for assaying DNA are described herein which include a plurality of encoded... Agent: Gifford, Krass, Sprinkle, Anderson & Citkowski, P.C.

20090148854 - Nucleic acid and corresponding protein entitled 184p1e2 useful in treatment and detection of cancer: A novel gene (designated 184P1E2) and its encoded protein, and variants thereof, are described wherein 184P1E2 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 184P1E2 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 184P1E2 gene... Agent: Agensys C/o Morrison & Foerster LLP

20090148855 - Nucleic acid encoding or targeting sodium channel scn3a alpha subunits: The present invention relates to epilepsy. More particularly, the present invention relates to idiopathic generalized epilepsy (IGE) and to the identification of three genes mapping to chromosome 2, which show mutations in patients with epilepsy. The invention further relates to nucleic acid sequences, and protein sequences of these loci (SCNA)... Agent: Goudreau Gage Dubuc

20090148849 - One-step target detection assay: The present invention provides nucleic acid amplification, detection, and genotyping techniques. In one embodiment, the present invention provides a method for amplifying and detecting a target nucleic acid sequence by providing a first primer pair comprising: a first primer comprising a target specific sequence, a tag sequence 5′ of the... Agent: Fulbright & Jaworski L.L.P.

20090148848 - Pitx2 polynucleotide, polypeptide and methods of use therefor: A novel T-type calcium channel (CACNA1G) is provided, as are polynucleotides encoding the same. CACNA1G has been implicated in cellular proliferative disorders. More specifically, it has been observed that the methylation state of specific regions within CpG islands associated with the CACNA1G gene correlates with a number of cancerous phenotypes... Agent: Dla Piper LLP (us)

20090148842 - Preparation of templates for methylation analysis: The invention relates to a method of preparing and using a library of template polynucleotides suitable for use as templates in solid-phase nucleic acid amplification and sequencing reactions to determine the methylation status of the cytosine bases in the library. In particular, the invention relates to a method of preparing... Agent: Klauber & Jackson

20090148847 - Rapid magnetic flow assays: Disclosed is an improvement in methods for nucleic acid and immunological bioassays. The methods comprise a step for “sweeping” paramagnetic bead: target molecule complexes so as to capture them with an affinity capture agent on a test pad by moving a magnetic force field from outside to inside the test... Agent: Seed Intellectual Property Law Group PLLC

20090148852 - Sensitive method for detecting low levels of atp: Methods are provided for sensitive detection of adenosine triphosphate (ATP) in samples using the luciferin-luciferase reaction. Aspects include using a pH composition that maximizes a signal to noise ratio. The maximum signal to noise ratio can be particularly useful with recombinant luciferase including recombinant Coleoptera luciferase.... Agent: Charm Sciences, Inc.

20090148862 - Evaluation method of organic or bio-conjugation on nanoparticles using imaging of time-of-flight secondary ion mass spectrometry: Said method for evaluating conjugation between two materials according to the present invention can be used for determining whether the conjugation is formed between nanoparticles and an organic, bio or inorganic material. In addition, it can be used for determining whether the conjugation is formed between organic and inorganic materials,... Agent: Clark & Brody

20090148861 - Kir channel modulators: Provided is a three-dimensional structure of an alcohol bound to an alcohol-binding site of an inwardly rectifying potassium (Kir) channel, Kir channel alcohol modulators and methods for identifying Kir channel modulators.... Agent: Grant Anderson LLP C/o Portfolioip

20090148857 - Method and apparatus for detection of analyte using an acoustic device: Methods for detecting analytes in a sample are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for the analyte, is combined with the sample to form a plurality of analyte-particle complexes. The system also includes a transport arrangement for transporting the... Agent: Proskauer Rose LLP

20090148856 - Methods and apparatus for therapeutic drug monitoring using an acoustic device: Methods for therapeutic drug monitoring are provided. A plurality of particles, each of which is coated with a capture agent capable of binding a therapeutic drug of choice is combined with the sample to form a plurality of therapeutic drug-particle complexes. The system also includes a transport arrangement for transporting... Agent: Proskauer Rose LLP

20090148864 - Methods and compositions for the detection of cervical disease: Methods and compositions for identifying high-grade cervical disease in a patient sample are provided. The methods of the invention comprise detecting overexpression of at least one biomarker in a body sample, wherein the biomarker is selectively overexpressed in high-grade cervical disease. In particular claims, the body sample is a cervical... Agent: Alston & Bird LLP

20090148858 - Methods for characterizing biological molecule modulators: Methods for characterizing a biochemical reaction and analysis of reaction products by establishing continuously variable concentration gradients of one or more reagents of the biochemical reaction are provided. Methods for determining mechanism of inhibition or activation, potency of inhibition or activation, or both of an enzyme inhibitor or activator, respectively,... Agent: Eksigent Technologies, LLC C/o Sheldon Mak Rose & Anderson

20090148860 - Methods of diagnosing muscle damage: A method for assessing muscle damage in a biological sample obtained from a subject is disclosed. The method involves obtaining a biological sample from a subject being assessed for muscle damage, and evaluating the sample for the presence or absence of a myofilament protein modification product. The method can also... Agent: Clark & Elbing LLP

20090148859 - Mtor pathway theranostic: This invention relates, e.g., to a method for predicting a subject's response to a chemotherapeutic agent and/or the subject's prognosis, comprising measuring the phosphorylation state of at least one member of the mTOR pathway, and/or of at least one member of an interconnected polypeptide pathway (e.g. a member of the... Agent: Foley And Lardner LLP Suite 500

20090148863 - Nanoparticle biosensors: Compositions which are useful in ultralow level of detection based on functionalized nanoparticles having exceptional combinations of properties including stability, brightness, binding specificity, and ability to be imaged at single nanoparticle resolution over desired period of time. The biological moieties on the nanoparticles preserve biological function. The nanoparticle surface can... Agent: Foley And Lardner LLP Suite 500

20090148865 - Polysaccharide structure and sequence determination: The invention provides a method for the structural analysis of a saccharide, comprising: a) providing on a surface a plurality of essentially sequence- and/or site-specific binding agents; b) contacting said surface with a saccharide to be analyzed, or with a mixture comprising a plurality of fragments of said saccharide; c)... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.c

20090148868 - Jab1 as a prognostic marker and a therapeutic target for human cancer: Methods of diagnosing and prognosticating the development of human cancers, such as breast cancer, colon cancer, and pancreatic cancer, are provided. The diagnostic and prognostic methods include the detection and/or quantifying of the amount of expression of JAB1 in human cells, particularly in relation to the amount of p27 or... Agent: Fulbright & Jaworski L.L.P.

20090148869 - Cell assay kit and method: A method and kit for assaying a cell sample for the presence of at least a threshold number of cells of a given type are disclosed. The kit includes an assay device having a sample chamber for receiving the cell sample and an elongate collection chamber containing a selected-density and/or... Agent: King & Spalding LLP

20090148870 - Rapid detection of mycobacterium tuberculosis and antimicrobial drug resistance: The invention includes methods and kits for rapidly detecting tuberculosis or other mycobacterial infection in a sputum sample inexpensively and within minutes. It includes methods and kits for determining the species or phylogenetic group of mycobacterial infection. It includes methods and kits for determining the drug sensitivity of mycobacteria from... Agent: Hugh Mctavish Mctavish Patent Firm

20090148866 - Antibodies and improved test sample handling methods for use in assays for myeloperoxidase: The present disclosure relates to isolated antibodies that can be used in an assay to determine the concentration levels of myeloperoxidase (MPO) in a test sample. Additionally, the present disclosure also relates to the use of improved test sample handling methods in assays in order to preserve the original MPO... Agent: Paul D. Yasger Abbott Laboratories

20090148867 - Universal fluorescent sensors: A probe comprises: (1) a target binding site moiety which is attached to a first fluorescent polypeptide; (ii) a mimic moiety which is capable of binding to the target binding site moiety and is attached to a second fluorescent polypeptide; and (iii) a linker which connects the two fluorescent polypeptides... Agent: Fulbright & Jaworski, LLP

20090148871 - Interdependent assays for detecting two or more analytes of interest in a test sample: The present invention relates to interdependent assays and kits for detecting and at least two analytes of interest in a single test sample.... Agent: Paul D. Yasger Abbott Laboratories

20090148872 - Lipoprotein sensor: According to the present invention there is provided a biosensor comprising a substrate containing a biochemical analyte, an enzyme system, a low molecular weight glycol ether and a detection means. The biochemical analyte is a low density lipoprotein. The enzyme system contains a cholesterol enzyme such as cholesterol esterase, cholesterol... Agent: Darby & Darby P.C.

20090148873 - Apparatus and method to measure platelet contractility: An apparatus and method for measuring blood platelet contractility, hereinafter called a “retractometer” is disclosed. Also disclosed is a system apparatus and method for automatically measuring platelet contractility in a plurality of samples, having an array of retractometer units and an electronic solenoid valve controller to fully automate screening in... Agent: Fuess & Davidenas

20090148875 - Control markers for auto-detection of control solution and method of use: A method of distinguishing a control solution from a sample in an electrochemical test sensor is performed. The method includes adding a control marker to the control solution. The control solution includes the control marker and analyte. The test sensor includes working and counter electrodes, and a reagent. A potential... Agent: Nixon Peabody LLP

20090148874 - Mutants of pyrroloquinoline quinone dependent soluble glucose dehydrogenase: A mutant of PQQ-dependent soluble glucose dehydrogenase (s-GDH; EC is provided with improved specificity for glucose as compared to maltose, having a substitution of threonine at position 348 by either glycine, alamine or serine, wherein said mutant additionally comprises, at least one mutation for improving the stability of the... Agent: Barnes & Thornburg LLP (roche)

20090148876 - Methods for the generation of cartilage-like material by mechanical loading: A cartilage-like biomaterial is bioengineered by using a self-aggregating suspension cell culture with hydrostatic mechanical force without the use of a scaffold or foreign matrix for cell attachment during culture. The cells in suspension culture may be preconditioned prior to application of the hydrostatic mechanical force, such as hydrostatic pressure,... Agent: Townsend And Townsend And Crew, LLP

20090148877 - Enzymatic methods for measuring plasma and tissue sphingomylelin and phosphatidylcholine: A method for measuring sphingomyelin and phosphatidylcholine comprising incubating sphingomyelin and phosphatidylcholine with bacterial sphingomyelinase and bacterial phospholipase D, alkaline phosphatase, choline oxidase, peroxidase, N-Ethyl-N-(2-hydroxy-3-sulfopropyl)-3,5-dimethoxyaniline, and 4-aminoantipyrine, preferably for about 45 minutes. A blue dye is generated.... Agent: Scully Scott Murphy & Presser, PC

20090148878 - Secreted and transmembrane polypeptides and nucleic acids encoding the same: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides... Agent: Goodwin Procter LLP

20090148879 - Stabilizing compositions, methods and kits for chemiluminescent assays: The present invention relates to stabilizing compositions, methods and kits for chemiluminescent assays.... Agent: Robert Deberardine D-377/ap6a-1

20090148883 - Biomarker for assessing response to fms treatment: A biomarker that correlates to treatment with drugs that inhibit FMS is disclosed. This biomarker has been shown to have utility in assessing response to the compounds. The plasma level of the biomarker is increased upon treatment with FMS inhibitor compounds, thus indicating that this biomarker is involved in FMS... Agent: Philip S. Johnson Johnson & Johnson

20090148885 - Fibroblast growth factor-like polypeptides: The present invention provides novel Fibroblast Growth Factor-like (FGF-like) polypeptides and nucleic acid molecules encoding the same. The invention also provides vectors, host cells, antibodies and methods for producing FGF-like polypeptides. Also provided for are methods for the diagnosis and treatment of diseases associated with FGF-like polypeptides.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090148881 - Geobacillus thermodenitrificans as well as the screening method and the uses thereof: The invention provides a strain of Geobacillus thermodenitrificans as well as the screening method and the uses thereof. The strain was deposited as the number CGMCC-1228 in the China General Microbiological Culture Collection Center of the China Committee of Culture Collection for Microorganisms. The strain was obtained by primary screening,... Agent: Shook, Hardy & Bacon LLP Intellectual Property Department

20090148884 - Lat1 transporters expressed in blood brain barrier cells: LAT1 is consistently expressed at high levels in brain microvessel endothelial cells. Disclosed herein are assays for determining whether a test material/molecule is a substrate for, and/or is actively transported by, the LAT1 transporter, and therefore a candidate substrate for crossing the blood brain barrier. The assays are useful in... Agent: Townsend And Townsend And Crew, LLP

20090148880 - Method and devices for treating individual biological cells: The invention relates to a method for treating a biological cell (1) including a cytoskeleton (3) enveloped by a cell membrane (2). The method includes the following steps: the biological cell (1) and a tool (10) are mutually oriented such that the tool (10) comes into contact with the biological... Agent: Caesar, Rivise, Bernstein, Cohen & Pokotilow, Ltd.

20090148886 - Methods of identifying compounds that decrease intraocular pressure: This disclosure concerns methods for identifying Best2 modulators, for example methods of screening for Best2 inhibitors. In some examples, the methods include identifying compounds that alter intracellular calcium concentration, intracellular pH, or transepithelial potential in cells expressing Best2. In certain embodiments, the disclosure concerns methods of identifying compounds that decrease... Agent: Klarquist Sparkman, LLP

20090148882 - Multiple coagulation test cartridge and method of using same: Embodiments of the present invention relate to multiple coagulation test cartridges and methods of using such cartridges. In one embodiment the cartridge is a disposable single-use cartridge for use in evaluating blood clotting. The cartridge includes multiple containers, such as tubes, each of which includes one or more coagulation affecting... Agent: Stroock & Stroock & Lavan LLP

20090148887 - Genetically encoded boronate amino acid: Provided are compositions comprising an aminoacyl tRNA synthetase that selectively recognizes a boronic amino acid. Methods of incorporating a boronic amino acid into a target polypeptides and target polypeptides produced by the methods are also provided. Methods of producing a protein, which methods comprise site-specifically encoding a boronic amino acid... Agent: Quine Intellectual Property Law Group, P.C.

20090148888 - Recombinant toxin fragments: A single polypeptide is provided which comprises first and second domains. The first domain enables the polypeptide to cleave one or more vesicle or plasma-membrane associated proteins essential to exocytosis, and the second domain enables the polypeptide to be translocated into a target cell or increases the solubility of the... Agent: Morris Manning Martin LLP

20090148891 - Dna polymerases and related methods: Disclosed are mutant DNA polymerases having improved extension rates relative to a corresponding, unmodified polymerase. The mutant polymerases are useful in a variety of disclosed primer extension methods. Also disclosed are related compositions, including recombinant nucleic acids, vectors, and host cells, which are useful, e.g., for production of the mutant... Agent: Townsend And Townsend And Crew, LLP

20090148900 - Hemcm42 nucleic acids: The present invention relates to novel human secreted proteins and isolated nucleic acids containing the coding regions of the genes encoding such proteins. Also provided are vectors, host cells, antibodies, and recombinant methods for producing human secreted proteins. The invention further relates to diagnostic and therapeutic methods useful for diagnosing... Agent: Townsend And Townsend And Crew LLP

20090148897 - Human ron-related gene variant associated with cancers: The invention relates to the nucleic acid and polypeptide sequences of three novel human Ron-related gene variants (Ron-V1, Ron-V2, and Ron-V3). The invention also provides a process for producing the polypeptides of the variants, as well as uses for the nucleic acid, polypeptide and antibodies to same in diagnosing human... Agent: Baker & Mckenzie LLP

20090148898 - Human ron-related gene variant associated with cancers: The invention relates to the nucleic acid and polypeptide sequences of three novel human Ron-related gene variants (Ron-V1, Ron-V2, and Ron-V3). The invention also provides a process for producing the polypeptides of the variants, as well as uses for the nucleic acid, polypeptide and antibodies to same in diagnosing human... Agent: Baker & Mckenzie LLP

20090148896 - Hyperthermophilic dna polymerase and methods of preparation thereof: The present invention relates to a hyperthermophilic DNA polymerase and a preparation method thereof. The invention provides a novel hyperthermophilic DNA polymerase isolated from a Thermococcus sp. strain, a functional equivalent thereof, a protein having the amino acid sequence thereof, and a preparation method thereof. The DNA polymerase according to... Agent: Clark & Elbing LLP

20090148895 - Method for gene amplification: The present invention provides a double-stranded DNA constructed specifically for high speed gene amplification, a method for gene amplification and a method for synthesizing protein. The gene amplification system of the present invention used a site-specific recombinase such as Cre-lox system and target sequence thereof to efficiently induce a type... Agent: Jenkins, Wilson, Taylor & Hunt, P. A.

20090148899 - Method for producing optically-active amine compound, recombinant vector, and transformant containing the vector: The present invention relates to a method for producing an optically-active amine compound. The method is characterized by using a transaminase (A), an α-keto acid reductase (B), and an enzyme (C), each having specific properties, in an identical reaction system to convert a ketone compound into a corresponding optically-active amine... Agent: Birch Stewart Kolasch & Birch

20090148894 - Methods for optimizing the secretion of protein in prokaryotes: Methods are provided for producing recombinant proteins by utilizing expression vectors carrying nucleic acids encoding the proteins, and secretory signal sequences to direct the secretion of the proteins to the periplasm or extracellular medium. Expression vectors which encode a fusion protein comprising a carrier protein and the protein are also... Agent: Edward Yoo C/o Bennett Jones

20090148892 - Novel methods: This present invention relates to the use of the B1 domain of Protein G as an epitope tag for over-expression of proteins in mammalian cells.... Agent: Smithkline Beecham Corporation Corporate Intellectual Property-us, Uw2220

20090148893 - Novel subtilases: The present invention relates to methods for producing variants of a parent TY145 subtilase and of a parent BPN′ subtilase and to TY145 and BPN′ variants having altered properties as compared to the parent TY145/BPN′ subtilase.... Agent: Novozymes North America, Inc.

20090148890 - Nucleic acid and amino acid sequences relating to streptococcus pneumoniae for diagnostics and therapeutics: The invention provides isolated polypeptide and nucleic acid sequences derived from Streptococcus pneumoniae that are useful in diagnosis and therapy of pathological conditions; antibodies against the polypeptides; and methods for the production of the polypeptides. The invention also provides methods for the detection, prevention and treatment of pathological conditions resulting... Agent: Hamilton, Brook, Smith & Reynolds, P.C.

20090148903 - Polypeptides having beta-glucosidase activity and polynucleotides encoding same: The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.... Agent: Novozymes, Inc.

20090148902 - Polypeptides having endoglucanase activity and polynucleotides encoding same: The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.... Agent: Novozymes, Inc.

20090148901 - Polypeptides having xylanase activity and polynucleotides encoding same: The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.... Agent: Novozymes, Inc.

20090148889 - Subtilases: The present invention relates to novel JP170 like subtilases from wild-type bacteria, hybrids thereof and to methods of construction and production of these proteases. Further, the present invention relates to use of the claimed subtilases in detergents, such as a laundry or an automatic dishwashing detergent.... Agent: Novozymes North America, Inc.

20090148905 - Antigen-binding constructs: The invention relates to antigen-binding constructs comprising a protein scaffold which are linked to one or more epitope-binding domains wherein the antigen-binding construct has at least two antigen binding sites at least one of which is from an epitope binding domain and at least one of which is from a... Agent: Smithkline Beecham Corporation Corporate Intellectual Property-us, Uw2220

20090148904 - Production of cytotoxic antibody-toxin fusion in eukaryotic algae: Methods and compositions are disclosed to engineer chloroplast comprising heterologous genes encoding target binding domain fused to a eukaryotic toxin and produced within a subcellular organelle, such as a chloroplast. The present disclosure demonstrates that when chloroplasts are used, toxins normally refractive to production in eukaryotic cells may be used... Agent: Dla Piper LLP (us)

20090148906 - Optimized messenger rna: The present invention is directed to a synthetic nucleic acid sequence which encodes a protein wherein at least one non-common codon or less-common codon is replaced by a common codon. The synthetic nucleic acid sequence can include a continuous stretch of at least 90 codons all of which are common... Agent: Lowrie, Lando & Anastasi, LLP

20090148908 - Compositions and methods for generating antibodies: The compositions and methods of the present invention comprise the efficient and effective presentation of antigens to the appropriate components of the immune system resulting in the production of species-specific antibodies in vitro. In general, these compositions comprise one or more antigenic components together with a colloidal metal, optionally combined... Agent: King & Spalding

20090148907 - Novel fructofuranosidase activity for obtaining the prebiotic oligosaccharide 6-kestose: The invention relates to a novel fructofuranosidase activity for obtaining the prebiotic oligosaccharide 6-kestose. One object of the invention is to characterize a novel transfructosylase activity which is associated with the extracellular invertase of Schwanniomyces occidentalis (specifically the strains selected from the group consisting of ATCC260077, ATCC7410 and ATCC20499) and... Agent: Merchant & Gould PC

20090148909 - Gene sms 27: The present invention relates to newly identified genes that encode proteins that are involved in the synthesis of L-ascorbic acid (hereinafter also referred to as Vitamin C). The invention also features polynucleotides comprising the full-length polynucleotide sequences of the novel genes and fragments thereof, the novel polypeptides encoded by the... Agent: Nixon & Vanderhye, PC

20090148910 - Reusable pcr amplification system and method: A DNA amplification device utilizing a polydimethylsiloxane (PDMS) and silicon substrate coated with spin-on glass (SOG) is provided. This PDMS layer is irreversibly bonded to the SOG layer of the silicon substrate using oxygen plasma. The amplification device is an inexpensive, microfluidic device, which can be utilized as a portable... Agent: Shook, Hardy & Bacon LLP Intellectual Property Department

20090148912 - Biological sample reaction chip, biological sample reaction apparatus, and biological sample reaction method: A biological sample reaction chip, including: a plurality of reactors disposed on one plane; a reaction fluid distribution channel connected via a microchannel to each reactor and provided on the plane on which the plurality of reactors are disposed; and a reaction fluid movement stopping unit, which is connected to... Agent: Harness, Dickey & Pierce, P.L.C

20090148911 - Dna polymerases with enhanced length of primer extension: A formulation and kit of thermostable or other DNA polymerases comprising at least one thermostable or other DNA polymerase which lacks 3′-exonuclease activity, and at least one thermostable DNA polymerase exhibiting 3′-exonuclease activity. Also provided is an improved method for enzymatic extension of DNA strands, especially while, but not limited... Agent: Sonnenschein Nath & Rosenthal LLP

20090148913 - Storage of cellulosic feedstocks to facilitate biofuel production: A method for storing cellulosic feedstock materials, particularly corn cobs, to facilitate the production of ethanol therefrom is effective to store feedstocks having a moisture content between about 20% and 50%. The method is initiated with the piling of the feedstock into a smooth, substantially rounded pile. The cellulosic biomass... Agent: Miller Law Group, PLLC

20090148914 - Materials and methods for the efficient production of acetate and other products: The subject invention provides materials and methods wherein unique and advantageous combinations of gene mutations are used to direct carbon flow from sugars to a single product. The techniques of the subject invention can be used to obtain products from native pathways as well as from recombinant pathways. In preferred... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association

20090148915 - Method for producing l-lysine or l-threonine: A bacterium belonging to the genus Escherichia which has an ability to produce L-lysine or L-threonine and which is modified so that a malic enzyme does not function normally in a cell, and a method for producing L-lysine or L-threonine, comprising culturing the bacterium in a medium to produce and... Agent: Cermak & Kenealy LLP Acs LLC

20090148916 - Process for producing hmg-coa reductase inhibitor: b

20090148917 - Method for producing chiral alcohols: The invention relates to a method for producing an enantiopure alcohol of general formula (Ia) or (Ib), wherein R1, R2, R3, R4, R5 and R6 each represent hydrogen, halogen, a C1-C6 alkyl or C1-C6 alkoxy group, with the proviso that at least one of the groups R1, R2, R3, R4,... Agent: Workman Nydegger 1000 Eagle Gate Tower

20090148919 - Delta 6-desaturase genes and uses thereof: The subject invention relates to the identification of genes involved in the desaturation of polyunsaturated fatty acids at carbon 6 (i.e., “Δ6-desaturase”). In particular, Δ6-desaturase may be utilized, for example, in the conversion of linoleic acid to γ-linolenic acid and in the conversion of α-linolenic acid stearidonic acid. The polyunsaturated... Agent: Ross Products Division Of Abbott Laboratories Department 108140-ds/1

20090148918 - Glycerol feedstock utilization for oil-based fuel manufacturing: The invention provides methods of manufacturing biodiesel and other oil-based compounds using glycerol and combinations of glycerol and other feedstocks as an energy source in fermentation of oil-bearing microorganisms. Methods disclosed herein include processes for manufacturing high nutrition edible oils from non-food feedstock materials such as waste products from industrial... Agent: Townsend And Townsend And Crew, LLP

20090148920 - Integrated glyceride extraction and biodiesel production processes: Biodiesel is used to extract glycerides from biomass derived sources and the extractant containing biodiesel and glycerides is subjected to ester-forming conditions including the presence of lower alkanol to produce biodiesel, a portion of which is used for the extraction of glycerides.... Agent: Pauley Petersen & Erickson

20090148921 - Compositions and methods for enhancing apoptosis: The present invention is directed to compositions of matter useful for the enhancement of apoptosis in mammals and to methods of using those compositions of matter for the same.... Agent: Genentech, Inc.

20090148922 - Pancreatic cancer genes: The present invention provides the art with the DNA coding sequences of polynucleotides that are up-or-down-regulated in cancer and dysplasia. These polynucleotides and encoded proteins or polypeptides can be used in the diagnosis or identification of cancer and dysplasia. Inhibitors of the up-regulated polynucleotides and proteins can decrease the abnormality... Agent: Novartis Vaccines And Diagnostics, Inc. Corporate Intellectual Property-r338

20090148923 - Modification of xylanases to increase thermophilicity, thermostability and alkalophilicity: A modified Family 11 xylanase enzyme comprising cysteine residues at positions 99 and 118 to form an intramolecular disulfide bond is provided. The modified xylanase is produced by substitution of an amino acid at position 99, 118 or both positions 99 and 118 with a cysteine to produce the intramolecular... Agent: Cooley Godward Kronish LLP Attn: Patent Group

20090148924 - Proteases and variants thereof: The present invention relates to isolated proteases of the RP-II type and variants of RP-II proteases exhibiting improved properties in comparison to the parent RP-II protease, DNA constructs and vectors coding for the expression of said proteases and variants, host cells capable of expressing the proteases and variants from the... Agent: Novozymes North America, Inc.

20090148925 - Single chain class i major histocompatibility complexes: A recombinant polypeptide and nucleic acid constructs capable of expressing the recombinant polypeptide are provided. The recombinant polypeptide comprises a chimeric polypeptide including an antigenic peptide being capable of binding a human MHC class I, a functional human β-2 microglobulin and a functional human MHC class I heavy chain.... Agent: Martin D. Moynihan Prtsi, Inc.

20090148926 - Hon-shimeji mushroom-fungal bed culture: Solution: There is provided a fungal bed culture of a hon-shimeji mushroom inoculated with a liquid seed culture characterized in that the surface of a culture medium for cultivation has a liquid seed culture inoculated portion and a liquid seed culture non-inoculated portion as well as a fungal bed cultivation... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090148927 - Mass production of aquatic plants: A method of mass production of algae is provided, including an algae growth trough having an algae introduction end having a first width and an algae extraction end having a second width wider than the first width. Water is supplied to the trough from a water treatment facility and carbon... Agent: Harness, Dickey & Pierce, P.L.C

20090148928 - Heterotrophic shift: Methods and systems of cultivating photosynthetic cells under autotrophic and heterotrophic growth conditions are described herein. Under different growing conditions, photosynthetic cells may produce different quantities and characteristics of lipids. The methods and systems herein utilize changing growth conditions to alter the macromolecular content of a photosynthetic cell.... Agent: Wilson Sonsini Goodrich & Rosati

20090148929 - Biostimulation agent for bioremediation and methods therefor: A biostimulation agent in the form of hollow spheres comprising soy wax or a combination of soy wax and beeswax. The biostimulation agent is capable of providing sufficient nutrients to help maximize biostimulation of indigenous microbes capable of biodegradation of chemical and/or petrochemical spills in the environment. The hollow spheres... Agent: The Webb Law Firm, P.C.

20090148930 - Promoter enhanced chilled ammonia based system and method for removal of co2 from flue gas stream: A chilled ammonia based CO2 capture system and method is provided. A promoter is used to help accelerate certain capture reactions that occur substantially coincident to and/or as a result of contacting a chilled ammonia based ionic solution with a gas stream that contains CO2.... Agent: Alstom Power Inc. Intellectual Property Law Dept.

20090148931 - Illumination systems, devices, and methods for biomass production: Illumination systems, devices, and methods for cultivating biomasses. A bioreactor system is operable for growing photosynthetic organisms. The bioreactor system includes a bioreactor and an illumination system. The illumination system includes one more optical waveguides configured to light at least some of a plurality of photosynthetic organisms retained in the... Agent: Seed Intellectual Property Law Group PLLC

20090148933 - Integrated nucleic acid assays: Integrated microfluidic cartridges for nucleic acid extraction, amplification, and detection from clinical samples are disclosed. The devices are single-entry, sanitary, and disposable. The devices enable simplex or multiplex nucleic acid target detection, as for example: assay panels for multiple infectious agents, or assay panels for cancerous cell types. Methods for... Agent: Seed Intellectual Property Law Group PLLC

20090148932 - Using coulomb forces to study charateristics of fluids and biological samples: A LoC (Lab on a Chip) is described to analyze surface properties of fluid drops. Substrates with cavities near the edge are filled with fluids that have a contact angle greater than 90°. The surfaces of two different drops can be brought in contact with one another by using Coulomb... Agent: Thaddeus Gabara

20090148934 - Systems and methods for cryopreservation of cells: An auto-nucleating device includes a tube containing a crystalline cholesterol matrix. The ends of the tube are closed by a membrane that is impermeable to the cholesterol but permeable to liquids contained in a cryopreservation vessel. The auto-nucleating device provides a site for ice nucleation during freezing of the liquid... Agent: Maginot, Moore & Beck, LLP Chase Tower

20090148935 - Application of rna interference targeting dhfr gene, to cell for protein production: Biological materials are applied to a CHO cell or the like for producing a species of protein. The biological materials includes a first vector and a second vector, the first vector including a dhfr gene of a species of mammal and a gene of the species of protein, the second... Agent: Thomas, Kayden, Horstemeyer & Risley, LLP

20090148936 - Lentiviral vector-mediated gene transfer and uses thereof: The present invention provides lentiviral vectors that are useful in human gene therapy for inherited or acquired proliferative ocular disease. It furnishes methods to exploit the ability of lentiviral vectors to transduce both mitotically active and inactive cells so that eye diseases may be treated.... Agent: Fulbright & Jaworski L.L.P.

20090148941 - Disposable mini-bioreactor device and method: This invention provides cylindrical cell culture tubes with a cap having both a septum and gas exchange membranes. The culture tubes can be used to inoculate media, culture cells, harvest cells and store cells in the same container with reduced risk of contamination, while facilitating automated handling.... Agent: Quine Intellectual Property Law Group, P.C.

20090148938 - Method for identifying ester coolers: The Transient Receptor Potential Cation Channel, Subfamily A, Member 1 (TRPA1) protein has been identified as an ester cooler receptor and therefore is useful in screening assays for identifying ester coolers, in particular ester coolers with a relative cooling strength which exceeds (−)−menthol.... Agent: Licata & Tyrrell P.C.

20090148937 - Micro-fluidic system comprising an expanded channel: The invention relates to a micro-fluidic system including a fluid medium channel that holds a fluid medium containing particles in suspension. According to the invention, the fluid medium channel has an expanded section with an enlarged cross-section along part of its length, in order to reduce the flow speed to... Agent: Caesar, Rivise, Bernstein, Cohen & Pokotilow, Ltd.

20090148939 - Novel fluorescent proteins from aequorea coerulscens and methods for using same: The present invention provides nucleic acid compositions encoding a novel colorless GFP-like protein, acGFP, from Aequorea coerulscens and fluorescent and non-fluorescent mutants and derivatives thereof, as well as peptides and proteins encoded by these nucleic acid compositions. The subject protein and nucleic acid compositions of the present invention are colored... Agent: B. Todd Patterson Moser, Patterson & Sheridan, L.L.P.

20090148940 - Novel fluorescent proteins from aequorea coerulscens and methods for using same: The present invention provides nucleic acid compositions encoding a novel colorless GFP-like protein, acGFP, from Aequorea coerulscens and fluorescent and non-fluorescent mutants and derivatives thereof, as well as peptides and proteins encoded by these nucleic acid compositions. The subject protein and nucleic acid compositions of the present invention are colored... Agent: Patterson & Sheridan, L.L.P.

20090148943 - Agent for enhancing the production of cytokines and/or chemokines: The present invention has an object to provide a means to effectively enhance the production of cytokines and/or chemokines in mammals. The object is solved by providing an agent for enhancing the production of cytokines and/or chemokines, which comprises, as an effective ingredient, a polypeptide having any one of the... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090148944 - Cell-type specific aptamer-sirna delivery system for hiv-1 therapy: The present invention relates to compositions and methods for delivery of siRNA to specific cells or tissue. More particularly, the present invention relates to compositions and methods for cell type-specific delivery of anti-HIV siRNAs via fusion to an anti-gp120 aptamer.... Agent: Rothwell, Figg, Ernst & Manbeck, P.C.

20090148942 - Humanized anti-cd70 binding agents and uses thereof: Disclosed are CD70 binding agents, such as humanized anti-CD70 antibodies and fragments and derivatives, that exert a cytotoxic, cytostatic or immunomodulatory on CD70 expressing cells, as well as pharmaceutical compositions and kits comprising the antibody, fragment or derivative. Also disclosed are methods for the treatment of CD70-expressing cancers and immunological... Agent: Townsend And Townsend And Crew LLP

20090148945 - Novel biodegradable elastomeric scaffold for tissue engineering and light scattering fingerprinting methods for testing the same: The present invention is directed to a novel biocompatible polymer that may be used in tissue engineering. More specifically, the specification describes methods and compositions for making and using a citric acid copolymers.... Agent: Marshall, Gerstein & Borun LLP

20090148946 - Separation system for cell, and cell culture system using separator for cell, and method of separation for cell: A cell is separated from a culture broth with an extremely simple configuration, and production yield of a target product is improved. There are provided separating means for separating a cell from the culture broth containing the cell, a buffer tank connected to the separating means through a first pipeline,... Agent: Brundidge & Stanger, P.C.

20090148947 - Flat microfibers as matrices for cell growth: The present invention relates to culturing cells utilizing a matrix of microfibrillated thermoplastic polymeric materials. More specifically, the present invention relates to a method of culturing cells. In addition, the invention relates to a microfibrillated article for culturing cells dispersed in a cell culture medium. The matrix of thermoplastic polymeric... Agent: 3m Innovative Properties Company

20090148948 - Nucleic acids encoding a g-protein coupled receptor involved in taste transduction: The invention provides isolated nucleic acid and amino acid sequences of sensory cell specific G-protein coupled receptors, antibodies to such receptors, methods of detecting such nucleic acids and receptors, and methods of screening for modulators of sensory cell specific G-protein coupled receptors.... Agent: Townsend And Townsend And Crew, LLP

20090148949 - Raav expression systems and methods of use: Disclosed are improved VP2-modified recombinant adeno-associated viral (rAAV) vectors, expression systems, and rAAV virions that are fully virulent, yet lack functional VP2 protein expression. Also disclosed are pharmaceutical compositions, virus particles, host cells, and pharmaceutical formulations that comprise these modified vectors useful in the expression of therapeutic proteins, polypeptides, peptides,... Agent: Haynes And Boone, LLPIPSection

20090148950 - Production of packaged dna sequences: A method of producing a packaged DNA sequence is disclosed. In one embodiment, the method comprises the steps of: (a) selecting a DNA sequence to be packaged and a papillomaviral capsid sequence, wherein the DNA sequence to be packaged is between 7 Kb-8.5 Kb, (b) co-transfecting the products of step... Agent: Quarles & Brady LLP

06/04/2009 > patent applications in patent subcategories. invention type

20090142744 - Method for the analysis of a blood sample, and apparatus and reagent for its implementation: Method for the automatic analysis of a blood sample in which: an analysis solution containing the blood sample, a diluent, and at least one compound to lyze the erythrocytes; at least one compound to stabilize the haemoglobin in the form of a chromogenic complex, is formed in a single dilution... Agent: Young & Thompson

20090142745 - Instruments and methods for exposing a receptacle to multiple thermal zones: A receptacle having a plurality of interconnected chambers arranged to permit multiple process steps or processes to be performed independently or simultaneously. The receptacles are manufactured to separate liquid from dried reagents and to maintain the stability of the dried reagents. An immiscible liquid, such as an oil, is included... Agent: Rothwell, Figg, Ernst & Manbeck, P.C.

20090142746 - Pancreatic cancer genes: The present invention provides the art with the DNA coding sequences of polynucleotides that are up-or-down-regulated in cancer and dysplasia. These polynucleotides and encoded proteins or polypeptides can be used in the diagnosis or identification of cancer and dysplasia. Inhibitors of the up-regulated polynucleotides and proteins can decrease the abnormality... Agent: Novartis Vaccines And Diagnostics, Inc. Corporate Intellectual Property-r338

20090142747 - Development of diagnostic kit for the detection of chrysanthemum virus b: The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer:TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal... Agent: Sughrue Mion, PLLC

20090142748 - Microporous materials, methods of making, using, and articles thereof: Described herein are methods for separating one or more analytes present in a fluid sample. The methods involve passing the fluid through or into a microporous material, wherein the analytes are localized near the surface of the microporous material. Additional processing steps such as hybridization and amplification can be performed... Agent: Ballard Spahr Andrews & Ingersoll, LLP

20090142755 - Assay for detecting genetic abnormalities in genomic nucleic acids: The present invention provides methods of detecting unamplifed genomic nucleic acid anchored to a solid support. The methods are useful for the detecting genetic abnormalities associated with various diseases, diagnosis, and prognosis.... Agent: Foley & Lardner LLP

20090142749 - Assessment of disease risk by quantitative determination of epimutation in normal tissues: An assay for assessing the risk of disease in an individual, wherein said assay comprises the steps of isolating a population of cells from normal tissue of said individual, and quantitatively determining the frequency of epimutation of a particular gene in said population of cells, wherein the epimutation of said... Agent: Foley And Lardner LLP Suite 500

20090142753 - Compositions and methods for detecting compounds to treat a neurological disorder: The present invention generally provides compositions and methods that can be used to detect compounds that modulate the activity of at least one of the DJ-1, Parkin and Pink-1 genes.... Agent: Edwards Angell Palmer & Dodge LLP

20090142770 - Hair follicle pharmacodynamic assay for telomerase activity: The invention is directed to methods for determining the efficacy of treatment with telomerase modulators in mammals by the analysis of the level of telomerase reverse transcriptase activity in mammalian hair follicle cells.... Agent: Geron Corporation Attn. David J. Earp

20090142765 - Method and apparatus for rapidly counting and identifying biological particles in a flow stream: A method for increasing the throughput, or the precision, or both the precision and the throughput, of a flow cytometer, or of a hematology analyzer employing a flow cytometer, and for further reducing the complexity of such a cytometer or analyzer, by utilizing the technique of laser rastering in combination... Agent: Paul D. Yasger Abbott Laboratories

20090142767 - Method for nucleic acid quantitation: It is intended to provide a novel convenient approach for DNA quantitative analysis that overcomes the disadvantages of conventional formulations. A standard DNA sample is prepared by introducing a single-base substitution into target DNA, and a predetermined amount thereof is mixed with a target DNA sample. The target and standard... Agent: Stanley P. Fisher Reed Smith LLP

20090142750 - Method of detecting and identifying gram-negative obligative anaerobic bacterium: There is provided a method of detecting potentially beer-spoiling obligatory anaerobic gram-negative bacteria, and a method of simultaneously detecting and distinguishing different beer-spoilage microorganisms including such bacteria.... Agent: Oblon, Spivak, Mcclelland Maier & Neustadt, P.C.

20090142762 - Method of screening for binding interaction using sets of microparticles and unique probes: The present invention relates to methods for screening for binding interactions using multiple sets of microparticles, wherein said set has the same identifiable characteristic and wherein one of more sets comprise subsets of microparticles and said subset presents at least one unique probe that acts as a binding partner for... Agent: Marshall, Gerstein & Borun LLP

20090142771 - Methods and instruments for processing a sample in a multi-chambered receptacle: A receptacle having a plurality of interconnected chambers arranged to permit multiple process steps or processes to be performed independently or simultaneously. The receptacles are manufactured to separate liquid from dried reagents and to maintain the stability of the dried reagents. An immiscible liquid, such as an oil, is included... Agent: Rothwell, Figg, Ernst & Manbeck, P.C.

20090142761 - Methods and kits for methylation detection: Ligation-based methods and kits are disclosed for determining the degree of methylation of one or more target nucleotides. In certain embodiments, the methylation status of one or more target nucleotides is determined by generating misligation products. In certain embodiments, at least one target nucleotide is amplified prior to the ligation... Agent: Mila Kasan, Patent Dept. Applied Biosystems

20090142764 - Methods and kits for multiplex amplification of short tandem repeat loci: Methods and materials are disclosed for use in simultaneously amplifying at least 11 specific STR loci of genomic DNA in a single multiplex reaction, as are methods and materials for use in the analysis of the products of such reactions. Included in the present invention are materials and methods for... Agent: Mila Kasan, Patent Dept. Applied Biosystems

20090142769 - Methods for determining anti-tnf therapeutic response: The present invention relates to methods for identifying patients that will respond to treatment with anti-TNF-therapy, i.e., anti-TNF responder patients. In particular, the present invention relates to determining response to an inhibitor of tumor necrosis factor (TNF) in a patient with a chronic inflammatory disease by determining the activity of... Agent: Darby & Darby P.C.

20090142766 - Methods for measuring the metabolism of cns derived biomolecules in vivo: The present invention provides methods for measuring the metabolism of a central nervous system derived biomolecule implicated in a neurological and neurodegenerative disease or disorder. In particular, the method comprises measuring the in vivo metabolism of the biomolecule in the central nervous system of a subject. Also provided is a... Agent: Polsinelli Shughart PC

20090142763 - Nested pcr-based method for specific genotyping of the fc gamma receptor iiia gene: The application describes a novel method for detection of a single nucleotide polymorphism, e.g., the 158 F/V polymorphism, in the FcγRIIIa gene using nested PCR to amplify large gene amplicons to aid in, e.g., genotyping applications. Thus, based on the results obtained in FcγRIIIa genotyping analysis, the present invention provides... Agent: Fitzpatrick Cella (wyeth)

20090142760 - Nucleic acid sequences associated with cell states: The present invention is directed to nucleic acid sequences whose expression is associated with different cell states, including nucleic acid sequences whose expression is induced at least 100-fold, or alternatively upregulated, in cells exhibiting asymmetric self-renewal relative to other cells. The invention is also directed to nucleic acid sequences whose... Agent: Ronald I. Eisenstein Nixon Peabody LLP

20090142768 - Perforin-2 proteins: Perforin-2 (P2) molecule is a pore forming protein. The 5′ untranslated region of the perforin-2 protein controls translational activity. Compositions include the perforin protein and the 5′ untranslated region. Methods of use include high-throughput screening assays for identification of therapeutic compounds in treatment of diseases.... Agent: Darby & Darby P.C.

20090142756 - Prediction of bare metal stent restenosis: Methods for predicting whether or not a patient is likely to experience restenosis after the placement of a bare metal stent are provided. The methods involve detecting and analyzing gene expression patterns of the cellular components of whole blood, where activation of selected genes has been found to be indicative... Agent: Whitham, Curtis & Christofferson & Cook, P.C.

20090142759 - Qpcr array with in situ primer synthesis: Application of in situ oligonucleotide synthesis, using a maskless photolithographic oligonucleotide synthesis apparatus or by other means, for direct fabrication of polymerase chain reaction (PCR) primers in situ in PCR reaction wells. The synthesized oligonucleotides contain an enzymatically degradable linker sequence and a specific primer sequence. The method may be... Agent: Lynn E Barber

20090142754 - Rna detection assays: The present invention provides novel cleavage agents and polymerases for the cleavage and modification of nucleic acid. The cleavage agents and polymerases find use, for example, for the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. In some embodiments, the 5′ nuclease activity of a... Agent: Casimir Jones, S.c.

20090142752 - Snap-back primers and detectable hairpin structures: The present invention provides methods, compositions, and kits comprising snap-back primers used for forming 3′ hairpin structures, 5′ hairpin structures, and double hairpin structures. The hairpin structures may be used for detecting target sequences (e.g., such as small RNA target sequence), for detecting polymorphisms in target sequences (e.g., such as... Agent: Casimir Jones, S.c.

20090142758 - Strategies for sequencing complex genomes using high throughput sequencing technologies: A method for determining a genome sequence comprising the steps of digesting the genome with at least one first restriction endonuclease, ligating at least one adaptor to the restriction fragments of the first subset, selectively amplifying the first set of adaptor-ligated restriction fragments using a first primer combination wherein at... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw

20090142757 - Strip and method for detecting nucleotide amplification products of mycobacterium tuberculosis and non-tuberculous mycobacterium: The present invention provides a test strip and a method for rapid identifying the presence of the amplified DNA product of Mycobacterium tuberculosis and non-tuberculous mycobacteria.... Agent: Wpat, PC Intellectual Property Attorneys

20090142772 - Devices and methods for the detection of analytes: System and methods for detecting analytes such as pathogenic cells are described. The methods allow for the direct measurement of analytes such as pathogenic organisms without the need for sample preparation and/or PCR. The devices can be used individually as point-of-use sensors for airborne pathogens and other pathogenic organisms in... Agent: Morris Manning Martin LLP

20090142774 - Method for the early detection of renal injury: A method and kit for detecting the immediate or early onset of renal disease and injury, including renal tubular cell injury, utilizing NGAL as an immediate or early on-set biomarker in a sample of blood serum. NGAL is a small secreted polypeptide that is protease resistant and consequently readily detected... Agent: Hasse & Nesbitt LLC

20090142773 - Methods and controls for monitoring assay quality and accuracy in parathyroid hormone measurement: The present invention relates to the use of control compositions and kits comprising such to evaluate and monitor the consistency of assays utilized to determine parathyroid hormone levels.... Agent: Morrison & Foerster LLP

20090142775 - Methods for separating organelles: Methods and kits for separating organelles of a specific type from a mixture of organelles of different types are described. The methods comprise providing a mixture of organelles of different types, adding probes to the mixture to form an organelle-probe complex with a distinct diffusion coefficient, and separating the organelles... Agent: Agilent Technologies Inc.

20090142778 - Compositions and methods for the therapy and diagnosis of inflammatory bowel disease: Compositions and methods for the therapy and diagnosis of Inflammatory Bowel Disease (IBD), including Crohn's Disease and Ulcerative Colitis, are disclosed. Illustrative compositions comprise one or more bacterial polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific... Agent: Townsend And Townsend And Crew, LLP

20090142779 - Methods and kits for measuring von willebrand factor: Methods and kits for measuring levels of von Willebrand factor function in a sample without using a platelet aggregation agonist, such as ristocetin, comprising recombinant glycoprotein Ibα having at least two of a G233V, D235Y and M239V mutations and an agent to detect a complex between the recombinant glycoprotein Ibα... Agent: Quarles & Brady LLP

20090142780 - Methods of donor specific crossmatching: The detection of endothelial cell antibodies has been proven clinically important for successful organ transplantation. Disclosed are methods of isolating endothelial cell antibodies and methods for donor-specific crossmatching.... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.c

20090142776 - Antibody for assaying adamts13 activity and method for assaying the activity: The subject of the present invention is to provide a useful antibody for measuring ADAMTS13 activity, in particular, a monoclonal antibody and a method for measuring ADAMTS13 activity. Further, another subject of the present invention also is to provide a monoclonal antibody which has specific reactivity to an antigenic determinant... Agent: Jhk Law

20090142777 - Reagents for the detection of protein phosphorylation in leukemia signaling pathways: The invention discloses 424 novel phosphorylation sites identified in signal transduction proteins and pathways underlying human Leukemia, and provides phosphorylation-site specific antibodies and heavy-isotope labeled peptides (AQUA peptides) for the selective detection and quantification of these phosphorylated sites/proteins, as well as methods of using the reagents for such purpose. Among... Agent: Simona Levi-minzi, Ph.d. General Counsel

20090142782 - Identification of actinobacillus actinomycetemcomitans antigens for use in the diagnosis, treatment, and monitoring of periodontal diseases: Antibodies, polypeptides, and polynucleotides are provided for the detection, prevention, amelioration and treatment of diseases caused by Actinobacillus actinomycetecomitans.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090142781 - Non-liquid phase type chemiluminescent enzyme immunoassay method and assay kit: A chemiluminescent enzyme immunoassay method whereby a target substance such as a protein is assayed. This chemiluminescent enzyme immunoassay method comprises: the step of capturing an immune complex containing an enzyme-labeled antibody, which is labeled with an enzyme acting a chemiluminescent substrate, and the target substance on a support having... Agent: The Nath Law Group

20090142783 - Human p51 genes and gene products thereof: Novel human genes falling within the category of family genes relating to p53 gene which is known as a cell proliferation regulatory gene, and gene products thereof. A human p51 gene characterized by containing a base sequence encoding an amino acid sequence represented by SEQ ID NO:1; a human p51... Agent: Sughrue Mion, PLLC

20090142785 - Capturing carrier, capturing device, analysis system using the same, and method for capturing and testing microorganisms: In order to make a process of capturing and testing air-borne microorganisms more convenient and quick, a capturing device which comprises the capturing carrier comprising a polymer which is in a gel phase at the time of capturing the microorganisms but undergoes a phase transition under heating to a sol... Agent: Oliff & Berridge, PLC

20090142784 - Methods: A method for identifying a compound expected to be useful in modulating a LRRK2 protein kinase activity, the method comprising the steps of (1) determining whether a test compound modulates the protein kinase activity of a LRRK2 polypeptide on a substrate Ezrin/Radixin/moesin (ERM) family polypeptide and (2) selecting a compound... Agent: K&l Gates LLP

20090142786 - Secreted and transmembrane polypeptides and nucleic acids encoding the same: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides... Agent: Genentech, Inc.

20090142787 - Albumin denaturing agent: An albumin denaturing agent for digesting an albumin by a protease efficiently is provided. The albumin denaturing agent contains quaternary ammonium having a hydrocarbon group with a carbon number of 12 or more, or a salt of the quaternary ammonium. The albumin in a sample is digested by the protease... Agent: Hamre, Schumann, Mueller & Larson, P.C.

20090142788 - Screening method using new substrate epha4 of gamma-secretase:

20090142792 - Biomarkers for the diagnosis of autoimmune disease: Compositions and methods are provided for prognostic classification of autoimmune disease patients into subtypes, which subtypes are informative of the patient's probability of developing clinical symptoms or severe disease. The patterns of circulating blood levels of serum cytokines provides for a signature pattern that can discriminate patients that have a... Agent: Stanford University Office Of Technology Licensing Bozicevic, Field & Francis LLP

20090142795 - Device and method of maintaining sperm motility in a capillary-loaded chamber: The invention relates, generally, to a method of removing sharp edges from a microscope coverslip comprising grinding down the edges and polishing the edges The invention also relates to a device for determining cell motility comprising a slide, a coverslip, comprising at least one edge that has been smoothed and... Agent: Stroock & Stroock & Lavan LLP

20090142790 - Label free biosensors and cells: Disclosed are compositions and methods for using label free optical biosensors for performing cell assays. In certain embodiments the assays can be performed in high throughput methods and can be multiplexed.... Agent: John L. Haack Corning Incorporated

20090142791 - Method and apparatus for detecting an analyte: Embodiments of the present technique facilitate the detection of analytes. Detection is generally achieved by binding agents labeled with non-radiative energy transfer acceptors. The binding agents, when bound to a specific analyte, change conformation such that the distance between the respective non-radiative energy transfer acceptors and a respective quantum dot... Agent: General Electric Company (pcpi) C/o Fletcher Yoder

20090142794 - Mutated anthrax toxin protective antigen proteins that specifically target cells containing high amounts of cell-surface metalloproteinases or plasminogen activator receptors: The present invention provides methods of specifically targeting compounds to cells overexpressing matrix metalloproteinases, plasminogen activators, or plasminogen activator receptors, by administering a compound and a mutant protective antigen protein comprising a matrix metalloproteinase or a plasminogen activator-recognized cleavage site in place of the native protective antigen furin-recognized cleavage site,... Agent: Townsend And Townsend And Crew, LLP

20090142793 - Screening assay to identify modulators of the sleep/wake cycle: Screening assays for identifying agents that modulate BK channel activity and further modulate the sleep/wake cycle in a subject, circadian regulated locomotor activity in a subject, or both are provided, as are agents identified using such screening assays. Also provided are methods of modulating the sleep/wake cycle in a subject... Agent: Lisa A. Haile, J.d., Ph.d. Dla Piper LLP (us)

20090142789 - Surface preparation method: A method of covalently immobilising a charged chemical species on or near a sensor surface of a mass-sensitive chemical sensor, the sensor surface bearing functional groups capable of forming covalent bonds with the chemical species, the method involving the application of an electric field between the charged chemical species and... Agent: Jeffrey B. Oster

20090142796 - Detection of inducible resistance to macrolide-lincosamide-streptogramin b: The wells of a multiple-well test panel contain a macrolide agent and a lincosamide agent and a combination of both macrolide agent and lincosamide agent. The test panel is inoculated with a broth-suspended microorganism, and placed into the automated microorganism identification (ID) and antimicrobial susceptibility determinations (AST) system. The test... Agent: David W. Highet, Vp & ChiefIPCounsel Becton, Dickinson And Company

20090142797 - Blood diluent and method of use thereof: Blood diluent for use in the analysis of blood components may include at least one purine compound or salt thereof. The blood diluent may also include at least one of alkali metal salt and/or at least one organic buffers and/or inorganic buffer. The blood diluent may be utilized to stabilize... Agent: Mindray C/o Stoel Rives LLP

20090142798 - Method of selectively lysing non-viable cells in cell population in sample: The present invention provides a method of selectively lysing non-viable cells from a cell population within a sample, the method including selectively lysing non-viable cells by mixing a cell-containing sample with a lysis buffer including a non-ionic surfactant and a divalent cation salt.... Agent: Sughrue Mion, PLLC

20090142799 - Method for quantitation of collagen in tissue: For successful wound healing to occur, the newly formed skin must generate tensile strength through collagen deposition. Measurement of collagen in the granulating wound bed may be predictive of successful wound healing. Existing methods for collagen measurement either require specialized equipment, or do not allow for discrimination of potential interfering... Agent: Fulbright & Jaworski L.L.P.

20090142803 - Amylolytic enzyme variants: The inventors have discovered some striking, and not previously predicted structural similarities and differences between the structure of Novamyl and the reported structures of CGTases, and based on this they have constructed variants of maltogenic alpha-amylase having CGTase activity and variants of CGTase having maltogenic alpha-amylase activity. Further, on the... Agent: Novozymes North America, Inc.

20090142801 - Btl-ii nucleic acids: The invention provides isolated BTL-II proteins, nucleic acids, antibodies, antagonists, and agonists and methods of making and using the same. Diagnostic, screening, and therapeutic methods using the compositions of the invention are provided. For example, the compositions of the invention can be used for diagnosis and treatment of inflammatory bowel... Agent: Immunex Corporation Law Department

20090142802 - Polypeptides and nucleic acids encoding same: The present invention relates to isolated polypeptides and isolated nucleic acid sequences encoding the polypeptides, as well as methods for producing and using the polypeptides in animal feed. An example of a polypeptide of the invention is the so-called L12 protein from Bacillus licheniformis ATCC 14580 which improves the Feed... Agent: Novozymes North America, Inc.

20090142804 - Process for preparing serine-rich protein employing cysteine synthase (cysk) gene: The present invention relates to a process for preparing a serine-rich foreign protein comprising culturing a bacterium containing the cysteine synthase (cysK) gene and a gene encoding the serine-rich foreign protein. The present invention comprises the steps of culturing a bacterium transformed with an expression vector containing a gene encoding... Agent: Sughrue Mion, PLLC

20090142800 - Secreted and transmembrane polypeptides and nucleic acids encoding the same: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides... Agent: Knobbe, Martens, Olson & Bear, LLP

20090142806 - Interleukin-17f antibodies and other il-17f signaling antagonists and uses therefor: The present invention provides isolated and purified polynucleotides and polypeptides related to the IL-17F signaling pathway. The invention also provides antibodies to IL-17F homodimers and IL-17A/IL-17F heterodimers, and methods of isolating and purifying members of the IL-17 family, including IL-17A/IL-17F heterodimers, from a natural source. The present invention also is... Agent: Wyeth Patent Law Group

20090142805 - High expression cell line that eliminates gene amplification: The present invention relates to methods, cell lines and kits for producing high titers of recombinant proteins without the need for gene amplification.... Agent: Millipore Corporation

20090142807 - Fusion partner for production of monoclonal rabbit antibodies: The invention provides a rabbit-derived immortal B-lymphocyte capable of fusion with a rabbit splenocyte to produce a hybrid cell that produces an antibody. The immortal B-lymphocyte does not detectably express endogenous immunoglobulin heavy chain and may contain, in certain embodiments, an altered immunoglobulin heavy chain-encoding gene. A hybridoma resulting from... Agent: Bozicevic, Field & Francis LLP

20090142808 - Novel enzyme with fructofuranosidase activity, which is used to obtain prebiotic oligosaccharides: The invention relates to a method of obtaining industrially-viable prebiotic oligosaccharides, using a novel extracellular enzyme (fructofuranosidase) of Xanthophyllomyces dendrorhous, which is characterised in that it also has transfructosilase activity. The invention also relates to a method of obtaining an enzymatic product with fructofuranosidase activity, as well as the substantially-pure... Agent: Merchant & Gould PC

20090142809 - Method for cleaving cervimycin monoesters: The invention relates to a method for cleaving cervimycin esters. An object of the invention to convert in a simple manner the cervimycin esters which are less active but formed in larger quantity into the highly active cervimycin K that occurs as a minor component in the preparation by fermentation,... Agent: Jordan And Hamburg LLP

20090142810 - 2'-terminator nucleotide-related methods and systems: The present invention provides methods of extending primer nucleic acids and sequencing target nucleic acids. The methods include the use of 2′-terminator nucleotides to effect chain termination. In addition to related reaction mixtures and kits, the invention also provides computers and computer readable media.... Agent: Roche Molecular Systems, Inc. Patent Law Department

20090142811 - Discovery, cloning and purification of thermococccus sp. (strain 9 degrees n-7) dna ligase: Compositions that describe a thermostable DNA ligase isolated from Thermococcus sp. (strain 9° N-7) and methods for making und using the same are described. The thermostable DMA ligase depends on ATP and not NAD+ as a cofactor during ligation, and retains activity at 100° C.... Agent: Harriet M. Strimpel, D. Phil.

20090142812 - Method for producing high molecular weight reduced viscosity starch pastes: Disclosed herein are methods of making high molecular weight, reduced viscosity starch pastes by enzymatic conversion. The methods provide a process for producing enzyme-thinned starch pastes that have improved molecular weight distributions, i.e., starch pastes having a more mid to high molecular weight content and less low molecular weight sugars... Agent: Foley & Lardner LLP

20090142751 - Analyzing polynucleotide sequences: An apparatus is provided for analysing a polynucleotide. The apparatus includes: a support having an impermeable surface; porous material attached to the impermeable surface; and an array of oligonucleotides with predetermined sequences attached to the porous material. The array includes at least two defined cells, the sequence of the oligonucleotides... Agent: Wenderoth, Lind & Ponack, L.L.P.

20090142813 - Processes for the production of l-citrulline: Processes for producing a suitable purity grade of L-Citrulline are disclosed. The processes can include contacting crude L-Citrulline in an aqueous solution with an adsorptive medium at a temperature above approximately 50° C. and below the temperature of denaturement for the L-Citrulline for an interval sufficient to remove at least... Agent: Young & Basile, P.C.

20090142814 - Method for producing carboxylic acid using methanol-assimilating bacterium: A method for producing a carboxylic acid by a fermentation process which comprises culturing a methanol-assimilating bacterium capable of producing the carboxylic acid in a liquid medium containing methanol and a counter ion to produce and accumulate the carboxylic acid in the medium, further comprising the feeding of a substance... Agent: Cermak & Kenealy LLP Acs LLC

20090142815 - Gene sms 05: The present invention relates to newly identified genes that encode proteins that are involved in the synthesis of L-ascorbic acid (hereinafter also referred to as Vitamin C). The invention also features polynucleotides comprising the full-length polynucleotide sequences of the novel genes and fragments thereof, the novel polypeptides encoded by the... Agent: Nixon & Vanderhye, PC

20090142816 - Gliocladium isolate c-13 and methods of its use for producing volatile compounds and hydrocarbons: Provided herein is Gliocladium isolate C-13 (NRRL 50072) which is an isolated strain of a Gliocladium spp. obtained from an endophyte of a Eucryphia cordifolia plant. Methods of culturing Gliocladium isolate C-13 are provided. The methods can include culturing the Gliocladium isolate C-13 under conditions sufficient to produce hydrocarbons. Also... Agent: Cooley Godward Kronish LLP Attn: Patent Group

20090142817 - Process for hydrolysis of starch: The present invention relates to a process for enzymatic hydrolysis of granular starch into a soluble starch hydrolyzate at a temperature below the initial gelatinization temperature of said granular starch.... Agent: Novozymes North America, Inc.

20090142818 - Process of producing a fermentation product: The present invention relates to a process of producing a fermentation product, especially ethanol, from starch-containing material using an alpha-amylase and a carbohydrate-source generating enzyme. The invention also relates to a composition comprising an alpha-amylase and a carbohydrate-source generating enzyme as well as the use such compositions for producing fermentation... Agent: Novozymes North America, Inc.

20090142819 - Methods for co-production of ethanol and silica from equisetum: A method for the co-production of silica and at least one other useful industrial chemical such as ethanol, comprises the steps of: pre-treating siliceous plant matter derived from plants, such as horsetail weeds from the genus Equisetum, to create a feedstock having exposed cellulose; placing the feedstock in a reactor... Agent: Bereskin And Parr

20090142820 - Directed evolution methods for improving polypeptide folding, solubility and stability: The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention... Agent: Los Alamos National Security, LLC

20090142821 - Peroxide-driven cytochrome p450 oxygenase variants: The invention relates to novel variants of cytochrome P450 oxygenases. These variants have an improved ability to use peroxide as an oxygen donor as compared to the corresponding wild-type enzyme. These variants also have an improved thermostability as compared to the cytochrome P450 BM-3 F87A mutant. Preferred variants include cytochrome... Agent: Joseph R. Baker, Apc Gavrilovich, Dodd & Lindsey LLP

20090142822 - Crystal structure of an angiotensin-converting enzyme (ace) and uses thereof: The present invention relates to a crystal of ACE protein. The present invention further relates to methods, processes, ACE modulators, pharmaceutical compositions and uses of ACE crystal and the structure coordinates thereof.... Agent: Marshall, Gerstein & Borun LLP

20090142823 - Attenuated rna virus and applications thereof: The invention encompasses an attenuated RNA virus and methods of using an attenuated RNA virus. The RNA virus comprises, in part, an ion channel protein comprising a peptide tag.... Agent: Polsinelli Shughart PC

20090142824 - Incubator: To improve an incubator. In an incubator for incubating a culture medium accommodated in an incubation space defined in a storage. A heater to control a temperature of the water stored in a water storing structure which is in the bottom side of the storage, and to keep the temperature... Agent: Kratz, Quintos & Hanson, LLP

20090142825 - Composite detection devices having in-line desalting and methods of making the same: A composite detection device having in-line desalting is provided. The composite detection device comprises a membrane configured for desalting at least a portion of an analyte stream, and a nanostructure for detecting a bio-molecule or a bio-molecule interaction, wherein the nanostructure and the membrane are arranged such that an analyte... Agent: General Electric Company Global Research

20090142826 - Diffraction-based diagnostic devices: A biosensor includes a substrate with areas of active receptive material disposed thereon. The receptive material is specific for an analyte of interest. A pattern of the active areas is defined on the substrate by an oxidizing photo-masking process.... Agent: Dority & Manning, P.A.

20090142827 - Mixing apparatus and container for such: A mixing apparatus is proposed having a container (2) for the mixing of media which has at least one inlet (31, 32, 33, 34, 35, 36) for the media to be mixed or at least one outlet (4), with a central cut-out (5) being provided which extends in a longitudinal... Agent: Townsend And Townsend And Crew, LLP

20090142828 - Methods and compositions for increasing protein yield from a cell culture: Disclosed herein are compositions and methods for increasing protein production from a cell culture. By switching the cells from a replicative to a productive state (RP switch), protein biosynthesis is extended. The productive state is a pseudo-senescent state. This pseudo-senescent state can be induced by transforming the cells with a... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090142829 - Recombinant constructs and their use in reducing gene expression: Recombinant constructs useful for reducing the expression of endogenous mRNA and any substantially similar endogenous mRNA are disclosed. In particular, a recombinant construct comprising, inter alia, a suitable nucleic acid sequence and its reverse complement can be used to alter the expression of any homologous, endogenous RNA (i.e., the target... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center

20090142830 - Aqueous solution for cell preservation: To provide an aqueous solution for cell preservation which is free of a natural animal-derived component such as a basal medium or serum. An aqueous preservation solution showing a high cell survival rate was obtained by removing a natural animal-derived component such as a basal medium or serum and controlling... Agent: Birch Stewart Kolasch & Birch

20090142831 - Placental stem cells: The present invention provides a method of extracting and recovering embryonic-like stem cells, including, but not limited to pluripotent or multipotent stem cells, from an exsanguinated human placenta. A placenta is treated to remove residual umbilical cord blood by perfusing an exsanguinated placenta, preferably with an anticoagulant solution, to flush... Agent: Jones Day

20090142832 - Indoles, derivatives, and analogs thereof and uses therefor: Indole derivatives and analog compounds and pharmaceutical compositions comprising the same are provided. Also provided are methods of using these compounds to inhibit tubulin polymerization in a cell associated with a proliferative disease or to treat a cancer.... Agent: Calfee Halter & Griswold, LLP

20090142833 - Pine cone extracts and uses thereof: A method of producing a pine cone extract and the pine cone extract produced there from, wherein the pine cone extract is useful in increasing the effects of nucleic acid vaccines and medicaments; and useful in the production of phenotypically immature and/or mature dendritic and/or fibrocyte cells.... Agent: Howrey LLP - East

20090142834 - Multipotent stem cells from peripheral tissues and uses thereof: This invention relates to multipotent stem cells, purified from the peripheral tissue of mammals, and capable of differentiating into neural and non-neural cell types. These stem cells provide an accessible source for autologous transplantation into CNS, PNS, and other damaged tissues.... Agent: Fasken Martineau Dumoulin LLP`

20090142835 - Stem cell separating material and method of separation: The present invention has its object to provide a material for separating stem cell and a filter for separating stem cell, each is capable of selectively separating and recovering, in a simple and easy manner, stem cells from body fluids or biological tissue-derived treated fluids, a method for separating and... Agent: Sughrue Mion, PLLC

20090142836 - Bioengineered tissue constructs and methods for production and use: Bioengineered constructs are formed from cultured cells induced to synthesize and secrete endogenously produced extracellular matrix components without the requirement of exogenous matrix components or network support or scaffold members. The bioengineered constructs of the invention can be treated in various ways such that the cells of the bioengineered constructs... Agent: Foley Hoag, LLP Patent Group, World Trade Center West

20090142837 - Method and apparatus for substantially isolating plant tissues: The present invention provides methods and devices for the rapid isolation of monocot plant embryos suitable for transformation or tissue culture. The invention includes mechanical devices for substantially isolating plant embryos for use as transformable explants. Media suitable for isolating plant embryos and methods for their preparation are also provided.... Agent: Sonnenschein Nath & Rosenthal LLP

20090142842 - Cleavable modifications to reducible poly(amido ethylenimine)s to enhance nucleotide delivery: Improved poly(amido ethylenimine) copolymers for gene delivery are disclosed. One illustrative embodiment includes polyethylene glycol (PEG) covalently bonded to a branched poly(triethyenetetramine/cystamine bisacrylamide) copolymer (poly(TETA/CBA)). The polyethylene glycol can be linear or branched. Another illustrative embodiment includes an RGD peptide covalently bonded to the poly(TETA/CBA)-PEG conjugate. Still another illustrative embodiment... Agent: Alan J. Howarth

20090142840 - Dna encoding anti-apoptotic protein and recombinant 30k protein: The present invention relates to DNAs encoding anti-apoptotic 30K proteins. More particularly, the present invention is directed to 30K protein genes and a recombinant proteins prepared by using novel anti-apoptotic gene obtained from silkworm. The present invention also provides anti-apoptotic health care food, pharmaceutical preparation, additive for cell culture medium,... Agent: The Nath Law Group

20090142839 - Inducing premature senescence to stabilize stem cell feeder layer cells: The present invention provides stem cell feeder layer cell lines that contain are readily triggered to differentiation. The expression vector encodes the senescence-triggering factors (STFs) consisting of Cip/Kip, INK4A, Cy protein or ankyrin-binding protein motifs. Each expression vector also contains an inducible transcription regulation element for conditional expression of the... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20090142838 - Methods for expressing rnp particles in eukaryotic cells: Provided herein are nucleic acid constructs and methods for producing or enhancing the production of group II intron RNP particles in eukaryotic cells. The present methods comprise introducing at least one nucleic acid construct comprising a nucleic acid encoding a modified or wild type group II intron RNA and a... Agent: Calfee Halter & Griswold, LLP

20090142841 - Vectors capable of immortalizing non-dividing cells and cells immortalized with said vectors: Vectors capable of stably integrating a transgene in the genome of a non-dividing cell or of a slowly-dividing cell, said vector comprising or expressing at least one immortalization molecule and cells immortalized with said vectors.... Agent: Cooper & Dunham, LLP

20090142843 - Glucose transport mutants for production of biomaterial: A method is disclosed for restoring a Glu+ phenotype to a PTS−/Glu− bacterial cell which was originally capable of utilizing a phosphotransferase transport system (PTS) for carbohydrate transport. Bacterial cells comprising the Glu+ phenotype have modified endogenous chromosomal regulatory regions which are operably linked to polynucleotides encoding galactose permeases and... Agent: Danisco US Inc., Genencor Division

Previous industry: Education and demonstration
Next industry: Chemistry: analytical and immunological testing


RSS FEED for 20150521: xml
Integrate into your RSS reader/aggregator or website to track weekly updates.
For more info, read this article.


Thank you for viewing Chemistry: molecular biology and microbiology patents on the website. These are patent applications which have been filed in the United States. There are a variety ways to browse Chemistry: molecular biology and microbiology patent applications on our website including browsing by date, agent, inventor, and industry. If you are interested in receiving occasional emails regarding Chemistry: molecular biology and microbiology patents we recommend signing up for free keyword monitoring by email.