|
FREE patent keyword monitoring and additional FREE benefits. |
![]() |
|
|
USPTO Class 435 | Browse by Industry: Previous - Next | All 08/2007 | Recent | 09: Oct | Sept | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 08: Dec | Nov | Oct | Sp | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 07: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 06: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Chemistry: molecular biology and microbiology inventions 08/07Recently published patent applications awaiting approval from the USPTO. Recent week's RSS XML file available below.Listing format for abstract view: USPTO application #, Title, Abstract excerpt,Patent Agent. Listing format for list view: USPTO National Class full category number, title of the patent application. 08/30/2007 > patent applications in patent subcategories. 20070202516 - Gene detection assay for improving the likelihood of an effective response to an egfr antagonist cancer therapy: The invention provides a method for more effective treatment of patients susceptible to or diagnosed with tumors overexpressing EGFR, as determined by a gene amplification assay, with an EGFR antagonist. Such method comprises administering a cancer-treating dose of the EGFR antagonist, preferably in addition to chemotherapeutic agents, to a subject... Agent: Genentech, Inc. 20070202522 - Isothermal screening of tumor cell related nucleic acids: The presently described technology relates generally to the art of molecular diagnostics and more particularly to point-of-care diagnostic methods and materials. The diagnostic methods and materials of the presently described technology are suitable for a variety of uses including but not limited to the bedside or field diagnosis of infectious... Agent: Mcandrews Held & Malloy, Ltd 20070202508 - Novel thermophilic proteins and the nucleic acids encoding them: The disclosed invention relates to the fields of molecular biology and biochemistry. Thermophilic proteins and the nucleic acids encoding them are disclosed. The thermophilic proteins are from, or derived from, a bacteriophage, YS40, that infects the thermophilic bacterium Thermus thermophilus. These proteins have enhances stability, particularly at high temperatures.... Agent: Polsinelli Shalton Flanigan Suelthaus PC 20070202507 - Utilization of nucleotide probes in elisa procedure for the quantitative determination of plasmodium falciparum dna in malaria: The present invention is the development of a simple and specific quantitative method for the determination of P. falciparum DNA in malaria that involves the direct detection of the highly 42-kDa conserved C-terminal region of P. falciparum merozoite surface protein (MSP1) gene. This procedure entails the amplification of the 42-kDa... Agent: Dr. Mai Nguyen 20070202555 - Method for judging feature of malignant tumor: A method for judging feature of malignant tumor is described. The method comprises obtaining step, first comparing step, second comparing step and judging step. The obtaining step comprises obtaining a first parameter based on activity and expression level of a first cyclin dependent kinase (first CDK) contained in a tumor... Agent: Sughrue Mion, PLLC 20070202562 - Flux limiting membrane for intravenous amperometric biosensor: A flux limiting layer for an intravenous amperometric biosensor is formed on a substrate to limit a diffusion rate of an analyte from blood to an enzyme electrode. The layer may be formed from ethylene vinylacetate (EVA) dissolved in a solvent such as paraxylene, spray-coated to cover a portion of... Agent: Edwards Lifesciences Corporation 20070202570 - Enzyme composition, low molecular weight hyaluronan and process for preparing the same: The present invention is to provide a low molecular weight hyaluronan by acting a hyaluronidase derived from a microorganism belonging to the genus Penicillium on a hyaluronan and a process for preparing the same, and an enzyme composition which can be suitably used for the preparation of the low molecular... Agent: Birch Stewart Kolasch & Birch 20070202485 - Methods and apparatus for preserving the endothelium in isolated hollow organs and biological vessels: The invention relates to a method and an apparatus for the endothelium-preserving treatment of isolated hollow organs, especially biological vessels such as blood vessels and lymphatic vessels by means of endothelium-protective perfusates or incubation solutions containing at least 0.1 percent by weight of native albumin and a nutrient substrate, preferably... Agent: Mayer, Brown, Rowe & Maw LLP 20070202487 - Assay for phospholipidosis: Cell based assays for phospholipidosis are provided. The assays employ image and data analysis technology to provide an indication of whether a population of cells exhibits phospholipidosis. Methods to assess the effect of a stimulus on inducing phospholipidosis in a population of cells are also provided.... Agent: Beyer Weaver LLP 20070202486 - Method of assaying substance capable of changing mitochondrial membrane potential: The present invention aims to provide a convenient and high precision evaluation method of a pharmaceutical agent that changes the mitochondrial membrane potential, using a mitochondrial membrane potential of a cultured cell as an index. The present invention provides a method for evaluating the ability of a test substance to... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070202488 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg. 20070202489 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg. 20070202490 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg. 20070202491 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg. 20070202494 - Development of diagnostic kit for the detection of chrysanthemum virus b: The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1:Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer:TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies... Agent: Sughrue Mion, PLLC 20070202493 - Device and method for maintaining a plurality of beads in suspension: A device and a method for maintaining a plurality of beads in suspension in a fluid are provided. The device includes a container having a chamber in fluid communication with an inlet and an outlet. The chamber is configured to hold the plurality of beads and the fluid therein. Each... Agent: Patrick W. Rasche Armstrong Teasdale LLP 20070202496 - Liver cancer biomarkers: A method of detecting whether a subject is afflicted with or at increased risk of developing liver cancer is carried out by detecting cleavage of a marker in a sample such as a blood sample from the subject. Suitable markers include but are not limited to, calreticulin, calreticulin precursor, protein... Agent: Myers Bigel Sibley & Sajovec 20070202495 - Use of resistive-pulse sensing with submicrometer pores or nanopores for the detection of the assembly of submicrometer or nanometer sized objects: Methods and compositions for detecting the assembly of complexes include providing a solution where a first portion is separated from a second portion via a submicrometer pore, submicrometer tube or channel, nanopore, or nanotube or channel. One or more submicrometer or nanometer sized object(s) is added to the first portion... Agent: Harness, Dickey & Pierce, P.L.C 20070202492 - Viral assay: The application relates to an assay method for studying the effect of at least one compound on RN virus replication and transcription comprising the steps of providing a synthetic RN molecule encoding at least a portion of the genome of an RN virus of interest and a copy of a... Agent: Birch Stewart Kolasch & Birch 20070202500 - Acylglycerol acyltransferase-like protein mgat-x2 and uses thereof: The present invention is directed to a polynucleotide and polypeptide sequence of a novel acylglycerol acyltransferase-like protein MGAT-X2. The invention also provides the human MGAT-X2 associated with the cardiovascular diseases, metabolic diseases, muscle-skeleton disorders or dermatological diseases. The invention also provides assays for the identification of compounds useful for the... Agent: Banner & Witcoff, Ltd. 20070202502 - Assay for bipolar affective disorder: The present invention provides a method of diagnosing bipolar affective disorder (BAD) and for determining a predisposition of a subject to bipolar affective disorder. In particular, the methods of the present invention comprise detecting a marker that comprises one or more polymorphisms at position 4q35.2 of the human genome and/or... Agent: Knobbe Martens Olson & Bear LLP 20070202534 - Cd38 as a prognostic indicator in b cell chronic lymphocytic leukemia: The subject invention discloses a method for determining the prognosis and probable clinical course of a subject diagnosed with B-CLL. Specifically, the invention involves comparing CD38 expression in a biological sample from the subject containing B-CLL cells to a baseline level of CD38 expression, wherein an elevated level of CD38... Agent: Amster, Rothstein & Ebenstein LLP 20070202529 - Compositions and methods for labeling of nucleic acid molecules: The present invention is generally related to compositions, kits and methods for labeling nucleic acid molecules using reverse transcriptases, preferably multi-subunit reverse transcriptases such as ASLV reverse transcriptases. Specifically, the invention relates to methods, kits and compositions for fluorescently labeling nucleic acid molecules during nucleic acid synthesis. The labeled nucleic... Agent: Invitrogen Corporation C/o Intellevate 20070202530 - Devices and methods for isolating and recovering target cells: A cell isolating device and method is provided to concentrate or isolate cells with specific characteristics from a mixture of different cell types. One embodiment may comprise two subtypes of antibodies that are directly conjugated to biotin (Abb) and conjugated to a fluorescent molecule (Abf). The conjugated antibodies (Abb+Abf) bind... Agent: Inskeep Intellectual Property Group, Inc 20070202514 - Dna diagnostics based on mass spectrometry: Fast and highly accurate mass spectrometry-based processes for detecting a particular nucleic acid sequence in a biological sample are provided. Depending on the sequence to be detected, the processes can be used, for example, to diagnose a genetic disease or chromosomal abnormality; a predisposition to a disease or condition, infection... Agent: Grant Anderson LLP C/o Portfolioip 20070202519 - Domain segmentation and analysis: Methods and apparatus, including computer program products, implementing and using techniques for analysis of images of cells and extraction of biologically significant features from the cell images, such as features located in cell boundary regions and cell-cell junctions. The extracted features may be correlated with particular conditions induced by biologically-active... Agent: Beyer Weaver LLP 20070202526 - Genotyping result evaluation method and system: A method and a system for evaluating results of differentiating genotype signals and noise signals when a DNA fragment containing a gene to be analyzed is amplified by PCR and detected by electrophoresis are provided. An outlier of genotyping results is detected based on the fact that, when using the... Agent: Reed Smith LLP 20070202533 - High speed dna sequencer and method: This invention relates to a device for the determination of the sequence of nucleic acids and other polymeric or chain type molecules. Specifically, the device analyzes a sample prepared by incorporating fluorescent tags at the end of copies of varying lengths of the sample to be sequenced. The sample is... Agent: Dewalch Technologies, Inc. 20070202512 - Human single nucleotide polymorphisms associated with dose-dependent weight gain and methods of use thereof: The invention provides novel polynucleotides and polypeptides associated with the incidence of PPAR-agonist associated weight gain and lower HbA1C levels. The invention also provides polynucleotide fragments corresponding to the genomic and/or coding regions of these polynucleotides which comprise at least one polymorphic locus per fragment. Allele-specific primers and probes which... Agent: Louis J. Wille Bristol-myers Squibb Company 20070202498 - Light emitting probes: This invention relates to a composition comprising at least two chemically different fluorophores, providing a donor and an acceptor respectively, connected together by at least one linker moiety and bonded to a binder moiety.... Agent: Law Office Of Duncan Palmatier 20070202527 - Method and device for producing vaccine: A method of making a vaccine using animal derived component free (ADCF) cell culture technology, including the steps of attaching ADCF-adapted cells to a microcarrier including an attachment mechanism for attaching filipodia of the cells, the microcarrier being in a culture, growing the cells in ADCF maintenance media, infecting the... Agent: Kenneth I. Kohn Kohn & Associates, PLLC 20070202504 - Method of searching specific base sequence: It is intended to efficiently determine a base sequence specifically appearing in an expression gene. For this, providing that the expression gene consists of exons (301) . . . (306) and especially that exon (301) is united with exon (302) and exon (302) with exon (303), an aggregate of base... Agent: Day Pitney LLP 20070202511 - Methods and compositions for the rapid isolation of small rna molecules: The present invention provides extraction compositions and methods for the rapid and efficient isolation of small RNA molecules from a biological sample. In particular, the extraction compositions, when contacted with a biological sample, releases the small RNA molecules from the other molecules in a biological sample, and the released small... Agent: Polsinelli Shalton Welte Suelthaus PC 20070202523 - Methods and kits for amplifying dna: Novel methods of synthesizing multiple copies of a target nucleic acid sequence which are autocatalytic are disclosed (i.e., able to cycle automatically without the need to modify reaction conditions such as temperature, pH, or ionic strength and using the product of one cycle in the next one). In particular, methods... Agent: Gen Probe Incorporated 20070202510 - Methods for diagnosing and treating kidney cancer: Methods, reagents and kits for diagnosing and treating kidney cancer are disclosed. An immunoassay for detecting kidney cancer is based on the relative change of the CELSR1 protein in urine or blood compared with normal tissue. An immunohistochemical assay for detecting kidney cancer is based on the relative absence of... Agent: Perkins Coie LLP 20070202513 - Methods for disease detection: The present invention provides methods for detecting disease by analysis of a patient sample to determine the integrity of nucleic acids in the sample.... Agent: Wolf Greenfield & Sacks, P.C. 20070202505 - Methods for gene function analysis: The present invention provides methods for analysis of gene function using effector libraries.... Agent: Moser, Patterson & Sheridan, LLP 20070202528 - Methods for modulating proteins not previously known as proteases: The present invention relates to the proteins not previously identified as proteases; the use of those peptides in screening for compounds that modulate protease activity; treating individuals in need of treatment with the compounds or proteases; and in methods for diagnosing a disease or disorder associated with a protease of... Agent: Genencor International, Inc. Attention: Legal Department 20070202499 - Methylated gene biomarkers for detecting cancer: The present invention includes methods diagnosising of cancer by analysis of a patient sample, particularly for the presence of a methylated SPARC nucleic acid molecule, and particularly for the diagnosis of pancreatic cancer. The invention also includes therapeutic methods for treating cancers by administering to cancers patients therapeutically effective amounts... Agent: Edwards Angell Palmer & Dodge LLP 20070202509 - Microarray having a base cleavable sulfonyl linker: The present invention provides a microarray having base cleavable, sulfonyl-containing linkers and a process to make the microarray. Oligonucleotides of any sequence may be synthesized on the microarray having the cleavable linker. The oligonucleotides may be cleaved and recovered as a pool of oligonucleotides having a three prime phosphate moiety.... Agent: Combimatrix Corporation 20070202525 - Non-invasive fetal genetic screening by digital analysis: The present methods are exemplified by a process in which maternal blood containing fetal DNA is diluted to a nominal value of approximately 0.5 genome equivalent of DNA per reaction sample. Digital PCR is then be used to detect aneuploidy, such as the trisomy that causes Down Syndrome. Since aneuploidies... Agent: Peters Verny , L.L.P. 20070202517 - Novel acid detection assays employing blocker oligonucleotides: The present invention provides methods, compositions, and kits for detecting the presence or absence of target sequences in a sample, where the sample also contains interfering sequences that are similar or identical to the target sequences. In particular, the present invention provides blocker oligonucleotides that at least partially inhibit the... Agent: Medlen & Carroll, LLP 20070202520 - Novel lipase: A novel phospholipase A1 (PLA1) having a substrate specificity to phosphatidic acid (PA); a peptide or a polypeptide originating in the above novel PLA1; a polynucleotide encoding the peptide or polypeptide originating in the novel PLA1; a process for producing the peptide or polypeptide originating in the novel PLA1; an... Agent: Sughrue Mion, PLLC 20070202532 - Nucleic acid purification method and purification apparatus: The object of the present invention is to provide a nucleic acid purification method and purification apparatus characterized by high washing efficiency where contamination does not occur and liquid does not remain in the nozzle tip. The present invention provides a tip containing the solid phase capturing a nucleic acid... Agent: Dickstein Shapiro LLP 20070202497 - One step oligochromatographic device and method of use: The present invention relates to methods and devices for detecting one or more analytes in a biological sample, preferably a clean liquid sample. This invention in particular relates to improved rapid tests such as “dipsticks”, “lateral flow” devices and “flow-through” devices. The invention in particular relates to oligochromatographic devices that... Agent: Fitch Even Tabin And Flannery 20070202503 - Pharmaceutical composition of (+)-erythro-mefloquine and its use: A pharmaceutical composition is in the form of a unit dosage comprising 1 to 60 mg (+)-erythro-mefloquine. This is intended for daily dosing.... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070202518 - Physiogenomic method for predicting statin injury to muscle and muscle side effects: The present invention relates to the use of genetic variants of associated marker genes to predict an individual's susceptibility to muscular injury and muscular side effects in response to statin therapy. The present invention further relates to analytical assays and computational methods using the novel marker gene set. The present... Agent: Morgan & Finnegan, L.L.P. 20070202515 - Promac signature application: The present invention is directed to ProMac signature genes and methods and kits for using the ProMac signature genes for diagnostic, prognostic, or monitoring ProMac associated diseases.... Agent: Cooley Godward Kronish LLP Attn: Patent Group 20070202501 - Proteins expressed in ink cells: Purified immunocytes were analyzed for expression frequencies, and the NKIR gene expressed specifically in natural killer (NK) cells was successfully identified. The NKIR gene encodes a receptor. Agonists and antagonists for the receptor can be identified by using the receptor.... Agent: Fish & Richardson PC 20070202521 - Single molecule dna sequencing using fret based dynamic labeling: Some of the subject methods may be used to sequence single molecules of polynucleotides of interest. The methods of the invention employ fluorescent intercalators as a donor in FRET (fluorescence resonance energy transfer). Fluorescent intercalators intercalate within the double-stranded region of the primed template. The intercalators may be used as... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070202506 - Single nucleotide polymorphisms predicting cardiovascular disease: The present invention relates to an isolated polynucleotide encoding a Na+/K+ ATPase polypeptide useful in methods to identify therapeutic agents useful for treating cardiovascular diseases, the polynucleotide is selected from the group consisting of: SEQ ID 4 and SEQ ID 5 (baySNP-1765) with allelic variation G in position 240 contained... Agent: Palmer & Dodge, LLP Kathleen M. Williams 20070202524 - Targeted vectors: This invention provides therapeutic and diagnostic agent delivery vehicles, including viral vectors, that are complexed to a targeting moiety by coordinate covalent linkages mediated by a transition metal ion. The complex is typically formed with a transition metal ion that is in a kinetically labile oxidation state; after the complex... Agent: Townsend And Townsend And Crew, LLP 20070202531 - Thermal cycling device: Multi-layer devices suitable for thermal cycling processes. The devices are particularly suitable for performing polymerase chain reactions (PCR). One embodiment includes a first conducting layer, a second conducting layer adjacent to the first layer, and a third conducting layer adjacent to the second layer opposite the first layer. Insulating layers... Agent: Dickinson Wright PLLC 20070202538 - Assay modules having assay reagents and methods of making and using same: We describe assay modules (e.g., assay plates, cartridges, multi-well assay plates, reaction vessels, etc.), processes for their preparation, and method of their use for conducting assays. Reagents may be present in free form or supported on solid phases including the surfaces of compartments (e.g., chambers, channels, flow cells, wells, etc.)... Agent: Nixon & Vanderhye, PC 20070202537 - Biomarkers for als: Provided are methods for diagnosing sporadic and familial forms of amyotrophic lateral sclerosis (“ALS”) that detect conformers or conformer patterns of the copper-zinc superoxide dismutase-1 (“SOD-1”) enzyme that are common to sporadic or familial ALS individuals but distinct from SOD-1 conformers of normal individuals. Methods of identifying candidate drugs that... Agent: Foley And Lardner LLP Suite 500 20070202542 - Disposable immunodiagnostic test system: A disposable immunodiagnostic test system tests for marker proteins in a sample and includes intimately contacting passage, protein, and absorbent layers. The passage layer is non-porous and has an aperture therethrough. The protein layer is porous, has combinable proteins immobilized thereon, and enables passage of the sample therethrough. The protein... Agent: Lang Michener LLP 20070202536 - Methods and compositions for separating rare cells from fluid samples: The present invention includes methods of enriching rare cells, such as cancer cells, from biological samples, such as blood samples. The methods include performing at least one debulking step on a blood sample and selectively removing at least one type undesirable component from the blood sample to obtain a blood... Agent: David R Preston & Associates Apc 20070202535 - Methods for analyzing interactions between proteins and sugar chains: As a result of investigating the optimum conditions of methods for immobilizing proteins that interact with sugar chains onto a substrate, it was revealed that coating the surface of a slide glass with GTMS enables immobilization at a higher S/N ratio than conventionally possible. Moreover, by using a substrate to... Agent: Darby & Darby P.C. 20070202539 - Methods for quantitative proteome analysis of glycoproteins: The invention provides a method for identifying and quantifying polyglycopeptides in a sample. The method can include the steps of immobilizing glycopolypeptides to a solid support; cleaving the immobilized glycopolypeptides, thereby releasing non-glycosylated peptides and retaining immobilized glycopeptides; releasing the glycopeptides from the solid support; and analyzing the released glycopeptides.... Agent: Mcdermott, Will & Emery 20070202543 - Optical reader system and method for monitoring and correcting lateral and angular misaligments of label independent biosensors: An optical reader system and method are described herein that can detect a lateral and/or angular misalignment of one or more biosensors so that the biosensors can be properly re-located after being removed from and then reinserted into the optical reader system. In one embodiment, the biosensors are incorporated within... Agent: Corning Incorporated 20070202540 - Tape stripping methods for analysis of skin disease and pathological skin state: The present invention provides non-invasive methods for detecting, monitoring, and diagnosing skin disease and pathological skin states such as irritated skin and psoriasis. The methods include using tape stripping to analyze expression in epidermal samples, of one or more skin markers. In illustrative examples, the tape stripping is performed using... Agent: Lisa A. Haile, J.d., Ph.d. Dla Piper US LLP 20070202541 - Test system for measuring the interaction of stat 6 with ncoa-1: The present invention relates to a method to identify substances and a use of such substances which can modulate IL-4 dependent signaling involved in tumor diseases, preferably Hodgkin Lymphomas or inflammatory airway diseases, preferably asthma and a method for determining whether a substance can modulate the interaction of STAT6 with... Agent: Michael P. Morris Boehringer Ingelheim Corporation 20070202546 - Immunoassay carrier: An immunoassay in provided which comprises (a) providing an assay plate having a plurality of recesses, the recesses having solid supports therein having antibody bound thereto; (b) carrying out an assay in one or more of the recesses but not in all of the recesses having antibody bound thereto; (c)... Agent: Clark & Elbing LLP 20070202545 - Method for evaluating kidney function in a feline: Methods for (1) evaluating feline kidney function by determining ghrelin level in feline tissue or biofluid and correlating the ghrelin level directly to kidney function and (2) diagnosing kidney disease in a feline comprises determining an observed ghrelin level in a tissue or biofluid of the feline and comparing the... Agent: Colgate-palmolive Company 20070202544 - Methods for diagnosing and treating endoplasmic reticulum (er) stress diseases: The present invention provides methods and reagents to quantify endoplasmic reticulum stress (ER stress) levels, and methods and compounds for treating ER stress disorders such as diabetes. Methods for quantifying ER stress in mammalian cells are exemplified.... Agent: Fish & Richardson PC 20070202549 - Assessing risk of cerebrovascular thrombosis by measuring c4d on platelets: This invention provides for a convenient, economical, and sensitive test for assessing the risk of a person suffering from a thrombotic stroke. More specifically, it has been determined that persons at risk for cerebrovascular thrombosis have an elevated deposition of C4d on their platelets.... Agent: Townsend And Townsend And Crew, LLP 20070202550 - Novel g protein-coupled receptor protein, its dna and ligand thereof: The polypeptides in the present invention possess the effects of promoting and inhibiting the secretion of prolactin, and are thus useful as drugs for the prevention and treatment of various diseases, in terms of prolactin secretion stimulants, which are associated with the secretion of prolactin, such as hypoovarianism, spermatic underdevelopment,... Agent: Edwards Angell Palmer & Dodge LLP 20070202552 - Binding polypeptides and uses thereof: The invention provides antibodies or antigen binding fragments thereof to DR5 and HER-2. The antibodies and/or antigen binding fragments thereof comprise variant CDRs comprising highly restricted amino acid sequence diversity. The invention also provides these polypeptides as fusion polypeptides to heterologous polypeptides such as at least a portion of phage... Agent: Merchant & Gould PC 20070202553 - Dominant b cell epitopes and methods of making and using thereof: Disclosed are methods for obtaining at least one epitope suitable for detecting the presence of an antibody against a tumor associated antigen of a cancer in a sample. Kits, assays, and substrates employing the epitopes of the present invention are disclosed. Also disclosed are epitopes of NY-ESO-1 and XAGE-1b and... Agent: Smith, Gambrell & Russell, LLP (uc) Suzannah K. Sundby 20070202554 - Method for determining degree of negative effect of macrophages on vertebrate: The present invention provides a method for determining the degree of macrophage-associated negative effects on a vertebrate including a human, the method including assaying diacetylpolyamine contained in a sample collected from the vertebrate. According to the method of the present invention, metabolic conditions of macrophages can be monitored, and the... Agent: Wenderoth, Lind & Ponack, L.L.P. 20070202551 - Tgfbeta: Latent TGFβ induces constitutive activation of NF-κB but does not activate Smad signaling. Latent TGFβ may be used to identify modulators of signaling pathways that are essential for tumor maintenance. Latent TGFβ may also be used to protect a patient from treatments that induce apoptosis.... Agent: Polsinelli Shalton Flanigan Suelthaus PC 20070202547 - Methods for detecting substances which bind to the amyloid precursor protein or beta amyloid fragments, and binding compounds: Disclosed are methods for identifying and evaluating the binding properties of substances to the amyoid precursor protein (APP) or to β-amyloid (Aβ fragments of APP. Also disclosed is a class of benzofuran derivatives of formula (I), which interact specifically with APP or Aβ, and block interaction of APP or Aβ... Agent: Merck And Co., Inc 20070202548 - Screening assay to identify inhibitors of the murd enzyme using an activator-independent murd enzyme: The use of an activator-independent MurD enzyme in a screening assay to identify inhibitors of the enzyme, which assay comprises contacting the enzyme with a test compound in the presence of enzyme substrates and appropriate buffers and detecting any modulation of enzyme activity by the test compound.... Agent: Astrazeneca R&d Boston 20070202557 - Enzyme immunoassay chip and method: An enzyme immunoassay chip having, as micro channels, a reaction liquid leading-in flow passage part, a reaction flow passage part, and detection flow passage part sequentially disposed on a substrate continuously to each other, comprising an installed part for bead-bodies supporting antibodies and the bead-body flow stopping part formed in... Agent: Wenderoth, Lind & Ponack, L.L.P. 20070202556 - Methods and kits for detection of thromboxane a2 metabolites: Methods, compositions and kits are provided for measuring aspirin's anti-thrombotic effectiveness on a subject. Included are a novel assay for quickly and specifically measuring TxA2 metabolite levels in urine and correlating the levels with aspirin dose in a subject. The methods, compositions and kits utilize a novel anti TxA2 metabolite... Agent: Swanson & Bratschun, L.L.C. 20070202558 - Elisa for vegf: The vascular endothelial growth factor (VEGF) activity in a patient's bloodstream or other biological sample can serve as a diagnostic and prognostic index for cancer, diabetes, heart conditions, and other pathologies. Antibody-sandwich ELISA method and kits for VEGF as an antigen were developed to detect VEGF levels in biological samples... Agent: Merchant & Gould PC 20070202559 - Chemical sensor enhanced by direct coupling of redox enzyme to conductive surface: The invention provides a method, apparatus and system for detecting electrochemical oxidoreduction activity mediated by a redox enzyme at a site remote from the enzyme. In one embodiment, the method comprises immobilizing the redox enzyme on a first region of a conductive surface and contacting a substrate capable of producing... Agent: Karen S. Canady Canady & Lortz LLP 20070202561 - Electronic detection immunoassays that utilize a binder support medium: A binder support medium-based immunoassay device and method is provided, utilizing the catalyzed formation of dopants and their subsequent effects on electroconductive polymers to detect an analyte of interest.... Agent: David W. Highet, Vp And ChiefIPCounsel Becton, Dickinson And Company 20070202560 - Resin microchannel array, method of manufacturing the same and blood test method using the same: A resin microchannel array includes a first substrate having a plurality of depressions, each depression having an inlet port at one end and an outlet port at another end, and walls sectioning the depressions, each wall having a micro groove connecting the depressions, and a second substrate having a flat... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070202563 - Chondroitinase abc i and methods of analyzing therewith: The invention relates to chondroitinase ABC I and uses thereof. In particular, the invention relates to recombinant and modified chondroitinase ABC I, their production and their uses. The chondroitinase ABC I enzymes of the invention are useful for a variety of purposes, including degrading and analyzing polysaccharides such as glycosaminoglycans... Agent: Wolf Greenfield & Sacks, P.C. 20070202564 - Microbial streaking device: A streaker device for streaking a microbial inoculum for single colonies on the surface of a solid growth medium. The streaking device has a row of spaced apart contact surfaces for contact with the surface of the solid growth medium. The spaced apart contact surfaces are resiliently flexibly supported by... Agent: Dykas, Shaver & Nipper, LLP 20070202565 - Growth plotter: A digital growth plotter according to the present invention includes a housing for being conveniently and ergonomically held by a caregiver. The growth plotter includes a processor, input devices, a data storage device, and a display. The housing may include a battery for energizing the electronic components. The input device... Agent: Harshaw Research, Inc. 20070202567 - Diagnostics and therapeutics for diseases associated with arginyl aminopeptidase rnpep (rnpep): The invention provides a human RNPEP which is associated with the cardiovascular diseases, cancer, dermatological diseases, hematological diseases, neurological diseases, urological diseases, respiratory diseases. The invention also provides assays for the identification of compounds useful in the treatment or prevention of cardiovascular diseases, cancer, dermatological diseases, hematological diseases, neurological diseases,... Agent: Banner & Witcoff, Ltd. 20070202566 - Hydrolases, nucleic acids encoding them and methods for making and using them: The invention provides hydrolases, polynucleotides encoding them, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides, e.g., enzymes, having a hydrolase activity, e.g., an esterase, acylase, lipase, phospholipase (e.g., phosphlipase A, B, C and D activity, patatin activity, lipid acyl... Agent: Diversa C/o Mofo S.d. 20070202568 - Insertion of furin protease cleavage sites in membrane proteins and uses thereof: Cleavage site for the protease furin is inserted between domains of a membrane glycoprotein. Upon cleavage by furin in the trans-Golgi network, the protein is separated into individual membrane-free domain that retains its native conformation. This protocol can be used to produce virus membrane protein domains for structural analysis and... Agent: Fulbright & Jaworski, L.L.P. 20070202571 - Method for microbial production of amino acids of the spartate and/or glutamate family and agents which can be used in said method: e 20070202572 - Microorganisms for therapy: Therapeutic methods and microorganisms therefor are provided. The microorganisms are designed to accumulate in immunoprivileged tissues and cells, such as in tumors and other proliferating tissue and in inflamed tissues, compared to other tissues, cells and organs, so that they exhibit relatively low toxicity to host organisms. The microorganisms also... Agent: Fish & Richardson, PC 20070202569 - Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby: Namely, the present invention includes a protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein; a gene coding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this... Agent: Kilyk & Bowersox, P.l.l.c. 20070202573 - Soluble fusion proteins comprising heterologous polypeptides: A soluble fusion protein is disclosed. The soluble fusion protein comprises at least one soluble polypeptide and a heterologous polypeptide being fused thereto, the heterologous polypeptide being normally insoluble and/or suboptimally expressed when expressed in a cell, wherein the at least one soluble polypeptide has an amino acid sequence at... Agent: Martin D. Moynihan Prtsi, Inc. 20070202574 - Novel saccharothrix strain an antibiotics derived therefrom, i.e. mutactimycins and aldgamycins: The invention relates to a novel strain Saccharothrix actinomycete SA 103 deposited at CNCM on 16 Feb. 2004, number 1-3160 or a mutant strain thereof; a method and a medium for selection of said strain; and a method for the production of a broth, active concentrate and active compounds from... Agent: Foley And Lardner LLP Suite 500 20070202575 - Oligodeoxynucleotide and its use to induce an immune response: wherein the central CpG motif is unmethylated, R is A or G, and Y is C or T, as well as an oligodeoxynucleotide delivery complex and a pharmacological composition comprising the present inventive oligodeoxynucleotide, and a method of inducing an immune response by administering the present inventive oligodeoxynucleotide to a... Agent: Klarquist Sparkman, LLP 20070202576 - Detectable labeled nucleoside analogs and methods of use thereof: The invention relates to detectable labels useful for detection of nucleotide sequences. Specifically, the invention relates to labeled-imidazole-PEG compounds, such as nucleosides, nucleotides, and nucleic acids incorporating such compounds, and methods utilizing such compounds. The invention further relates to kits comprising labeled imidazole-PEG compounds.... Agent: Roche Molecular Systems Inc Patent Law Department 20070202577 - Method for the production of hyperbranched polysaccharide fractions: The invention relates to a method for producing hyperbranched amylopectin having a mean molecular weight ranging between 2,000 and 29,000 Dalton and an average degree of branching of more than 10 percent and less than 20 percent, said degree of branching being expressed in mole percent of the anhydroglucose units... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070202578 - Production of globosides oligosaccharides using metabolically engineered microorganisms: The present invention relates to the large scale in vivo synthesis of globosides oligosaccharides; especially globotriose, globotetraose and globopentaose, which are the carbohydrate portions of globotriosylceramide (Gb3Cer), globotetraosylceramide (Gb4Cer) and globopentaosylceramide (Gb5Cer) respectively. It also relates to high yield production of potential anticancer vaccines of the globo-series glycosphingolipids, including the... Agent: Foley And Lardner LLP Suite 500 20070202579 - Production of isoprenoids: The present invention relates to a process for the production of isoprenoids Coenzyme Q-10 by microorganisms. More particularly, the present invention relates to a process for increased production of Coenzyme Q-10 by microorganisms of the genus Rhodobacter, preferably of the species R. sphaeroides which have been transformed with one or... Agent: Nixon & Vanderhye, PC 20070202580 - Synthesis of mono and di esters from biologically-produced 1,3-propanediol: A process for forming an ester from 1,3-propanediol comprising providing 1,3-propanediol with at least 90% biobased carbon, contacting the 1,3-propanediol with an acid, thereby forming the ester, and recovering the ester is provided. The acid can be an organic acid. Additionally, a process for producing an ester, either or both... Agent: Mccarter & English, LLP Basil S. Krikelis 20070202581 - Method for the production of polyhydroxyalkanoic acid: Embodiments of the invention relate to the microbial production of polyhydroxyalkanoic acids, or polyhydroxyalkanoates (PHA), from substrates which cannot be used as a source of carbon and/or energy for microbial growth or PHA synthesis and which have microbial and environmental toxicity. According to one embodiment of the invention, a process... Agent: Knobbe Martens Olson & Bear LLP 20070202583 - Fermentation process: The present invention provides a process of fermenting starch-containing material, comprising i) fermenting starch-containing material by subjecting said material to a carbohy-drate-source generating enzyme and a fermenting microorganism, ii) reducing the particle size of the starch-containing material obtained from step i) and/or liquefying the starch-containing material obtained from step i),... Agent: Novozymes North America, Inc. 20070202582 - Process for the production of ethanol from algae: The present invention describes a process for the production of ethanol by harvesting starch-accumulating filament-forming or colony-forming algae to form a biomass, initiating cellular decay of the biomass, fermenting the biomass in the presence of a yeast, and the isolating the ethanol produced. The present invention further relates to processing... Agent: Vance Intellectual Property, PC 20070202584 - Chloride ion-resistant sulfur-oxidizing bacteria: A microorganism having an ability to oxidize sulfur even at high chloride ion concentration is provided. Specifically, a microorganism belonging to the genus Acidithiobacillus having the ability to oxidize sulfur even at high chloride ion concentration is provided. A method for bacterial leaching of copper sulfide ores and a method... Agent: Birch Stewart Kolasch & Birch 20070202585 - Microorganism having the improved gene for hydrogen-generating capability, and process for producing hydrogen using the same: A hydrogen producing method by culturing a microorganism having a hydrogenase gene, in which a lactic acid biogenetic path and a succinic acid biogenetic path in anaerobic metabolic paths are inactivated, under an anaerobic condition in the presence of organic substrate. The microorganism may further have a formate dehydrogenase gene.... Agent: Nixon & Vanderhye, PC 20070202586 - Crystal structure of soluble glutaminyl cyclase: The invention relates to a crystalline structure of glutaminyl cyclase (QC). The invention also relates to the methods of preparing the crystalline structure of QC and the methods for identifying candidate inhibitors of QC. This invention further provides a structural basis for the rational design or identification of new inhibitors... Agent: Akin Gump Strauss Hauer & Feld L.L.P. 20070202587 - Recombinant aav production in mammalian cells: The present invention includes methods and compositions for the production of high titer recombinant Adeno-Associated Virus (rAAV) in a variety of mammalian cells. The disclosed rAAV are useful in gene therapy applications. Disclosed methods based on co-infection of cells with two or more replication-defective recombinant herpes virus (rHSV) vectors are... Agent: Edwards Angell Palmer & Dodge LLP 20070202588 - Petroleum biosorbent based on strains of bacteria and yeast: This invention relates to biosorbents used for clean-up of petroleum-based contamination of water. The invention can be used for clean-up of natural and artificial water reservoirs, sewers, and liquid waste that is contaminated with petroleum and petroleum products. The invention absorbs petroleum-based contamination and degrades it using strains of bacteria,... Agent: United States Department Of Energy 20070202589 - Cell culture plate and method of manufacturing the same: A cell culture plate has a plurality of flow channels, uneven pattern areas and through holes. The flow channels are formed between the uneven pattern areas, and culture solution flows from the flow channels into the uneven pattern areas or from the uneven pattern areas into the flow channels. The... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070202591 - Altered superantigen toxins: The present invention relates to genetically attenuated superantigen toxin vaccines altered such that superantigen attributes are absent, however the superantigen is effectively recognized and an appropriate immune response is produced. The attenuated superantigen toxins are shown to protect animals against challenge with wild type toxin. Methods of producing and using... Agent: Elizabeth Arwine, Esq. U.s. Army Medical Research & Materiel Command 20070202594 - Carrier for cell culture and method for culturing cells: A carrier for cell culture which enables cells to efficiently grow thereon is provided. A carrier comprises a particulate base body mainly formed of a resin material and a coating layer. The coating layer is formed from particles of a calcium phosphate-based compound, and the particles are partially embedded in... Agent: Greenblum & Bernstein, P.L.C 20070202593 - Cell-targeted ikb and methods for the use thereof: Activation of nuclear factor kB (NF-kB) is involved in a number of diseases such as viral and bacterial infections, and cell proliferative disorders such as cancer and autoimmune disease. In certain instances, constitutive NF-kB activity has also been liked to the resistance of certain cancers to chemo and radiation therapy.... Agent: Fulbright & Jaworski L.L.P. 20070202592 - Pluripotent cells distributed ubiquitously in animal tissue, which proliferate selectively in lower-serum culture: It is intended to provide a pluripotent cell having the following properties: (1) being contained in a mixed-cell type population obtained by enzymatic treatment of the tissue collected from an animal; (2) being contained in a sedimented cell population obtained by centrifugating the mixed-cell type population of the property (1);... Agent: Wenderoth, Lind & Ponack, L.L.P. 20070202590 - Process for producing multipotential stem cell origination in testoid cell: The present invention provides a method of producing pluripotent stem cells, which comprises culturing testis cells using a medium containing glial cell derived neurotrophic factor (GDNF) or an equivalent thereto to obtain pluripotent stem cells. The medium can further contain leukemia inhibitory factor (LIF), epidermal growth factor (EGF), basic fibroblast... Agent: Leydig Voit & Mayer, Ltd 20070202595 - Human embryonic stem cell lines and methods of use thereof: The invention provides novel human embryonic stem cell lines. The invention further provides human embryonic stem cell lines that are genetically related and immunologically identical. The invention further provides methods of deriving, propagating and using such lines, optionally under animal-free conditions.... Agent: Wolf Greenfield & Sacks, P.C. 20070202596 - Selective antibody targeting of undifferentiated stem cells: This invention provides a system for producing differentiated cells from a stem cell population for use wherever a relatively homogenous cell population is desirable. The cells contain an effector gene under control of a transcriptional control element (such as the TERT promoter) that causes the gene to be expressed in... Agent: Geron Corporation 20070202597 - Process for recycling solid supports for cultivation of anchorage-dependent cells: This invention relates to methods for use in industrial production of proteins. Specifically, the present invention provides a method of recycling solid supports for cultivation of anchorage-dependent cells such as, e.g., microcarriers and Fibra-Cel® disks. Solid supports recycled by a method of the present invention allow obtaining a protein productivity... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070202599 - Composition and method for production of transformed cells: A composition useful for the production of transformed eukaryotic cells is described. The composition comprises submucosal tissue and a nucleic acid sequence. The nucleic acid sequence is typically recombinant DNA including gene(s) encoding for one or more biofunctional proteins. The submucosal tissue component of the present composition comprises the tunica... Agent: Barnes & Thornburg LLP 20070202598 - New transfection reagents: Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)l, or {(CH2)i-Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester,... Agent: Invitrogen Corporation C/o Intellevate 20070202600 - Transfection reagents: Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)I, or {(CH2)i—Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester,... Agent: Invitrogen Corporation C/o Intellevate 20070202601 - Method for macerating biological material and apparatus for carrying out said method: In order to ensure consistently good maceration of biological material in an electroporation reactor, it is proposed to monitor the conductivity of the mixture therein and to detect any arcing which occurs therein. The results of such monitoring are used to modify the operating voltage of the electroporation reactor and/or... Agent: Factor & Lake, Ltd. 08/23/2007 > patent applications in patent subcategories.20070196849 - Double-ligation method for haplotype and large-scale polymorphism detection: The present teachings provide methods, compositions, and kits for querying the identity of a target polynucleotide strand comprising. In some embodiments, the present teachings provide a method comprising forming a reaction complex comprising the target polynucleotide strand hybridized to an upstream probe, a middle probe, and a downstream probe, wherein... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070196830 - Method for identification of medically relevant fungi: Multiple species of fungi in an environment can be identified in one sample by extracting and purifying fungal DNA in the sample. PCR is then performed followed by cloning the amplifed DNA and transforming the DNA into bacteria for purposes of growing the organisms. Colonies of the growth containing transformed... Agent: Glenna Hendricks, Esq. 20070196840 - Method of determining outcome of non small-cell lung cancer according to xrcc3 polymorphism: l 20070196832 - Methods for mutation detection: The invention relates to methods for detecting a mutation in a nucleic acid. Methods of the invention are useful for detecting and identifying mutations that are indicative of disease or the predisposition for disease.... Agent: Goodwin Procter LLP Patent Administrator 20070196861 - Method for forming film, base plate with film, sensor, and liquid composition: A method for forming a film comprises: preparing a liquid composition containing a substance for detecting an object and a polyether derivative having a weight-average molecular weight of 2000 or less; supplying the liquid composition to a side adjacent to a first surface of a base plate by using a... Agent: Oliff & Berridge, PLC 20070196892 - Method of converting a fermentation byproduct into oxygen and biomass and related systems: In one aspect, the invention relates to a method of converting byproducts of a fermentation process into oxygen and biomass. Related methods, systems, and other aspects are also described.... Agent: King & Schickli, PLLC 20070196810 - Polymerized hemoglobin media and its use in isolation and transplantation of islet cells: Solutions and suspensions comprising polymerized hemoglobin derived from human blood are disclosed. The solutions and suspensions may comprise cell culture medium, an enzyme (such as a protease), and/or a buffer. Processes of preparing the solutions and suspensions are also disclosed. The solutions and suspensions may be employed in methods of... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070196811 - Use of flavanol derivatives for the cryopreservation of living cells: A medium for storing a biological sample, in particular sperm, oocytes, embryos and stem cells, in a refrigerated, frozen or vitrified state. The medium includes a balanced salt solution, a cryoprotectant, and a 4-thioderivative of flavan-3-ol of formula (I) with cryoprotective effect... Agent: Berenbaum, Weinshienk & Eason, P.c 20070196812 - Effective method of function analysis and screening of protein utilizing fluorescent light generated by cell-free protein synthesizing system: A method of detecting a reaction between a fluorescently labeled protein synthesized in a cell-free protein synthesizing system and a sample solution simply, in a short time and at high precision is provided. A case of detecting a binding reaction between an antibody fused with GFP and a sugar on... Agent: Scully Scott Murphy & Presser, PC 20070196816 - Engineered stimulus-responsive switches: Ligand-responsive chimeric proteins are engineered to cause a detectable output in response to a preselected stimulus. The engineered chimeric proteins are useful in industrial, commercial, medical, and scientific fields as a tool for programming a cellular response to a stimulus of choice and for use with in vitro assays. The... Agent: Goodwin Procter LLP Patent Administrator 20070196813 - Extraction of substances of interest from blood for mass spectrometric analysis: In a method for preparing a blood sample for subsequent processing in a mass spectrometry laboratory, substances of interest are extracted from whole blood, blood plasma or blood serum immediately after the blood sample has been taken from a subject. The extraction is carried out by means of reversible immobilization... Agent: Law Offices Of Paul E. Kudirka 20070196814 - Method for producing vascular wall lesion using platelets: It is an object of the present invention to provide a cell culture system in which platelet aggregation that is found in lesions of arteriosclerosis, restenosis, and the like is reproduced. The present invention provides a method for producing a cell culture system containing aggregated platelets, which comprises culturing platelets... Agent: Birch Stewart Kolasch & Birch 20070196815 - Positive selection procedure for optically directed selection of cells: Provided are methods and systems that can be used as a means of positive selection by initiating light mediated DNA repair in cells, having photosensitive repair systems, with desired characteristics from libraries of mutants that have been deactivated with a lethal light source.... Agent: Needle & Rosenberg, P.C. 20070196820 - Devices and methods for enrichment and alteration of cells and other particles: The invention features a device for the deterministic separation of analytes coupled to a reservoir containing a reagent that alters a magnetic propert of the analyte. Exemplary methods include the enrichment of a sample in a desired analyte (e.g., using deterministic separation) or the alteration of a desired analyte in... Agent: Clark & Elbing LLP 20070196822 - Method for characterizing compounds: An in vitro method for characterising the activity and/or the function of a test agent on signalling pathways and/or cellular processes within a host cell is disclosed which is conducted on living cells in a none-destructive manner. The method of the invention may be used with an imaging system and... Agent: Ge Healthcare Bio-sciences Corp. Patent Department 20070196821 - Methods for identifying markers for early-stage human cancer, cancer progression and recurrence: A method is described to identify secreted proteins identified with stages of malignancy of cancer. The proteins are initially identified by trapping them with a fluorescent protein containing vector that can insert in any gene. The secreted proteins are initially identified by their fluorescence. Secreted proteins identifying tumors with specific... Agent: Anticancer C/o Mofosd Attn: Denise Caldwell 20070196819 - Patterning method for biosensor applications and devices comprising such patterns: A patterned substrate for biosensing applications, wherein the pattern includes hydrophilic and hydrophobic areas, and selected ones of the areas include at least at least one reporter molecule, a property of which is detectable. A method of making a patterned substrate includes performing a stamping procedure to provide a pattern... Agent: Young & Thompson 20070196817 - Sampling device: A method and a device for collecting a sample of material from a surface. A ball (2) within a socket (3) such that the ball is free to rotate in any direction. As the ball rolls across the surface the sample of material is collected by the ball and is... Agent: Foley And Lardner LLP Suite 500 20070196824 - Simultaneous quantification of nucleic acids in diseased cells: Processes and methods for the simultaneous quantification of nucleic acids in diseased cells that are based on real-time PCR are provided. The real-time PCR protocol is an excellent tool for reliable quantification of in vitro drug screening and evaluation protocols to determine the efficacy of potential anti-viral agents. Quantification using... Agent: Merchant & Gould PC 20070196823 - Surrogate markers for viral infections and other inflammatory responses: Compositions and methods for the detection, diagnosis and treatment of BVDV and other viruses are provided.... Agent: Dann, Dorfman, Herrell & Skillman 20070196818 - Using nucleic acids for clinical microbiology testing: A process for analysing a biological sample, comprising the steps of: (a) identifying a micro-organism present within the sample; and (b) determining the effect of one or more antimicrobial(s) on a micro-organism from the sample, wherein steps (a) and (b) are performed by analysing the micro-organism's nucleic acid. Steps (a)... Agent: Cooley Godward Kronish LLP Attn: Patent Group 20070196855 - Cell migration assay: The present invention is directed to a modified cell migration assay allowing for improved identification and discrimination of chemokine receptor antagonists from non-specific blockers.... Agent: Brinks Hofer Gilson & Lione 20070196839 - Considerations, evaluations, investigations and searching: Methods of considering DNA based links between two or more situations are provided. Amongst the methods is a method including obtaining a plurality of test results, each test result relating to a situation, each test result including information on the DNA from that situation, the plurality of test results providing... Agent: Merchant & Gould PC 20070196848 - Detection of phosphorylated eif2-alpha as a diagnostic test for efficacy and sensitivity of translation initiation inhibitors in the treatment of cancer and other proliferative diseases: The present invention relates to methods for determining the effectiveness of one or more agents for treating one or more disorders associated with aberrant cellular proliferation. Screening assays for the discovery of agents that alter eIF2α phosphorylation, inhibit translation initiation and/or inhibit aberrant cellular proliferation are also provided.... Agent: Banner & Witcoff, Ltd. 20070196829 - Essential and important genes of pseudomonas aeruginosa and the use thereof to design or identify antibacterial agents: The invention includes a database of candidate essential genes in Pseudomonas aeruginosa, as well as other important genes that, when mutated, lead to a growth attenuated phenotype. Such genes and mutants of such genes are important for identifying antibacterial agents suitable for treating and preventing Pseudomonas aeruginosa infections. The invention... Agent: Novartis Vaccines And Diagnostics Inc. 20070196835 - Gene expression profiling for identification monitoring and treatment of rheumatoid arthritis: A method is provided in various embodiments for determining a profile data set for a subject with rheumatoid arthritis or inflammatory conditions related to rheumatoid arthritis based on a sample from the subject, wherein the sample provides a source of RNAs. The method includes using amplification for measuring the amount... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.C. 20070196831 - Human sample matching system: Methods and apparatus for a human sample (S), analyzing the sample (S) and then determining a match with a member of the opposite sex is disclosed. In one embodiment, a customer purchases an AromaMatch™ Test Kit (14), which comprises a bottle of cleaning solution (20), a cotton ball (22) a... Agent: Giaccherini 20070196850 - Identification of aging genes through large-scale analysis: High throughput methods for screening genetic variants that are phenotypically distinguishable are provided. Methods for identifying “long-lived” genetic variants among a set of variants are also provided. Methods for identifying pharmaceutical compounds that can promote longevity in various subjects, including mammals, and that can delay the onset of various diseases... Agent: Woodcock Washburn LLP 20070196852 - Labeling reagent: The current invention restates substituted indole nucleosides as both terminal as well as internal building blocks of labeled oligonucleotide probes for the detection, analysis and quantitation of nucleic acids. The substituent comprises a linker and a detectable group or a linker and a reactive group for post synthesis coupling. These... Agent: Roche Diagnostics Operations Inc. 20070196834 - Method and system for the generation of large double stranded dna fragments: Synthesis of long chain molecules such as DNA is carried out rapidly and efficiently to produce relatively large quantities of the desired product. The synthesis of an entire gene or multiple genes formed of many hundreds or thousands of base pairs can be accomplished rapidly and, if desired, in a... Agent: Foley & Lardner LLP 20070196827 - Method for detecting gene mutation and kit for detecting gene mutation: A solution including a single-stranded nucleic acid (10) having a target base (11) related to SNP or the like is mixed with a solution including two kinds of single-stranded detecting nucleic acids (20a) and (20b) complementary to partial sequences that sandwich the target base (11) between them to hybridize the... Agent: Bell, Boyd & Lloyd, LLP 20070196843 - Method for identification and monitoring of epigenetic modifications: The present invention provides novel methods for identifying and monitoring epigenetic modifications, such as imprinted genes, using microarray based technology. Specifically, the invention detects imprinted genes by the presence of overlapping closed and open chromatin markers. The invention also discloses a method for detecting the loss of imprinting on a... Agent: Quarles & Brady LLP 20070196854 - Method for producing polymers: The invention relates to a method for producing polymers, in particular synthetic nucleic acid double strands of optional sequence, comprising the steps: (a) provision of a support having a surface area which contains a plurality of individual reaction areas, (b) location-resolved synthesis of nucleic acid fragments having in each case... Agent: Rothwell, Figg, Ernst & Manbeck, P.C. 20070196838 - Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites: The present invention provides compositions and methods for recombinational cloning. The compositions vectors having multiple recombination sites and/or multiple topoisomerase recognition sities. The methods premit the simultaeous cloning of two or more different nucleic acid molecules. In some embodiments the molecules are fused together while in other embodiments the molecules... Agent: Invitrogen Corporation C/o Intellevate 20070196847 - Methods for detection of chloral hydrate in dichloroacetic acid: Methods for detecting chloral hydrate in dichloroacetic acid are described.... Agent: Woodcock Washburn LLP 20070196837 - Methods for mapping signal transduction pathways to gene expression programs: The invention relates to improved methods of identifying the gene expression programs that are regulated by a signal transduction pathway. The invention also provides methods of identifying agents which modulate signal transduction pathway. The invention also provides improved methods of isolating DNA fragments to which a protein of interest is... Agent: Bozicevic, Field & Francis LLP 20070196853 - Methods for rapid genotype screening: The present invention provides a method to rapidly provide genotype screening of a plurality of biological samples in a designated well of a microwell container for remote user by a screening laboratory. The screening method can be used to determine if a biological sample is heterozygous, homozygous or wild for... Agent: Butler, Snow, O'mara, Stevens & Cannada PLLC 20070196836 - Microarray substrate, method of use, and products comprising the microarray substrate: e 20070196833 - Open channel solid phase extraction systems and methods: The invention provides, inter alia, capillary extraction devices, and methods of making and using the same.... Agent: Phynexus, Inc. 20070196825 - Optical sensors based on hybrid aptamer/conjugated polymer complexes: An optical sensor for detecting a target comprising a singlestranded aptamer complementary to said target, and a water-soluble cationic polythiophene derivative of the following formula: wherein “n” is an integer ranging from 6 to 100, is disclosed. The optical sensor allows for the detection of targets selected from the group... Agent: Knobbe Martens Olson & Bear LLP 20070196841 - Physiogenomic method for predicting response to diet: The present invention relates to the use of genetic variants of associated marker genes to predict an individual's response to diet. The present invention further relates to analytical assays and computational methods using the novel marker gene set. The present invention has utility for developing personalized diet regimens to optimize... Agent: Morgan & Finnegan, L.L.P. 20070196846 - Polymerases for nucleotide analogue incorporation: Compositions that include polymerases with features for improving entry of nucleotide analogues into active site regions and for coordinating with the nucleotide analogues in the active site region are provided. Methods of making the polymerases and of using the polymerases in sequencing and DNA replication and amplification as well as... Agent: Quine Intellectual Property Law Group, P.C. 20070196828 - Process for detecting or quantifying more than one nucleic acid in library via terminal attachment of non-inherent universal detection targets to nucleic acid copies produced thereby: This invention provides novel compositions and processes for analyte detection, quantification and amplification. Nucleic acid arrays and libraries of analytes are usefully incorporated into such compositions and processes. Universal detection elements, signaling entities and the like are employed to detect and if necessary or desirable, to quantify analytes. Amplification of... Agent: Enzo Biochem, Inc. 20070196844 - Protein pdx1 as a marker for breast cancer: The present invention relates to the diagnosis of breast cancer. It discloses the use of protein PDX1 (peroxiredoxin 1) in the diagnosis of breast cancer. It relates to a method for diagnosis of breast cancer from a liquid sample, derived from an individual by measuring PDX1 in said sample. Measurement... Agent: Roche Diagnostics Operations Inc. 20070196842 - Rapid analysis of variations in a genome: The invention provides a method useful for determining the sequence of large numbers of loci of interest on a single or multiple chromosomes. The method utilizes an oligonucleotide primer that contains a recognition site for a restriction enzyme such that digestion with the restriction enzyme generates a 5′ overhang containing... Agent: Morrison & Foerster LLP 20070196845 - Snp discrimination assay, and dna chips for snp discrimination: Disclosed herein is an SNP discrimination assay for discriminating base species of an SNP in a specific gene in a sample, which includes the steps of hybridizing four detection probes, which have at least a flanking sequence around an SNP in the gene and are different in base species at... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070196826 - Solvent for dissolving nucleic acid, nucleic acid-containing solution and method of preserving nucleic acid: As a solvent for dissolving a nucleic acid such as DNA or RNA, a solvent comprising an ionic liquid having, for example, ammonium cation, imidazolium cation orpyridinium cation is used and the nucleic acid is dissolved therein and preserved. Thus, a nucleic acid such as DNA or RNA can be... Agent: Westerman, Hattori, Daniels & Adrian, LLP 20070196851 - System and method for selecting differentially dependent genes from gene expression data: Dependence between expression levels of different genes is identified through a multivariate method of statistical analysis of single color microarray gene expression data. An algorithm is applied to gene data to identify those genes that are likely to change their relationship with all other genes, and select such genes for... Agent: Blank Rome LLP 20070196857 - Determination of risk and treatment of complications of prematurity: In one aspect of the present invention there is provided a method for determining the risk of developing a complication of preterm birth in a patient born before 40 weeks of gestation or weighing 10% less than the average for the patient's gestational age. The method involves measuring serum IGF-I... Agent: David S. Resnick 20070196864 - Method and kits for detecting cerebrospinal fluid in a sample: The present invention relates to detection of the presence or absence of cerebrospinal fluid (CSF) in a sample, in particular to the analysis of the CSF protein lipocalin-type prostaglandin D2 synthase (L-PGDS). The present invention provides assays for the analysis of PGDS indicating the presence or absence of CSF in... Agent: Wiggin And Dana LLP Attention: Patent Docketing 20070196862 - Method for detecting a response of each probe zone on a test strip: A method for detecting a response of each probe zone on a test strip is provided. The present method includes providing a test strip having a color pattern displayed thereon. The color pattern occurs in response to a tested solution contacting with the test strip and including a plurality of... Agent: Berkeley Law & Technology Group, LLP 20070196860 - Methods for measuring real time kinase activity: The present invention relates to methods for detecting and/or measuring the activity of a specific kinase, with the methods comprising contacting one or more kinases with a binding agent to isolate a specific kinase of interest. The isolated kinase is then contacted with a kinase activity sensor, where the kinase... Agent: Invitrogen Corporation C/o Intellevate 20070196856 - Methods of determining activity of ryanodine receptor modulators: Methods for identifying modulators of ryanodine receptors are disclosed. In preferred embodiments the activity of the ryanodine receptor is stimulated to a baseline level and the ability of a test compound to increase or decrease the baseline level indicates that the test compound is a modulator of ryanodine receptor activity.... Agent: Stout, Uxa, Buyan & Mullins LLP 20070196859 - Novel antibacterial agents: This invention relates to novel multibinding compounds (agents) that are antibacterial agents. The multibinding compounds of the invention comprise from 2-10 ligands covalently connected by a linker or linkers, wherein each of said ligands in their monovalent (i.e., unlinked ) state have the ability to bind to a an enzyme... Agent: Theravance, Inc. 20070196863 - Prion protein detection: An example embodiment of the invention includes a method of performing an assay comprising the steps of (1) providing a multimode waveguide; (2) fixing one or more fluidic cells to the multimode waveguide, wherein each of the one or more fluidic cells including a surface having a portion thereof sealed... Agent: Mcnees Wallace & Nurick LLC 20070196858 - Separation matrix and method of purification: The present invention relates to a separation matrix comprised of a porous support to which ligands have been immobilised, wherein said ligands comprise at least one sulphonamide and the R group of the sulphonyl comprises an aromatic group. The nitrogen of the sulphonamide may be a secondary or tertiary amine.... Agent: Ge Healthcare Bio-sciences Corp. Patent Department 20070196871 - Forensic test for human semen: Lateral flow immunochromatographic strip tests for the detection of human semen, method of detecting human semen, and methods of manufacturing ICS tests for the detection of human semen are described... Agent: Baker & Mckenzie LLP 20070196867 - Gpcr expressing cell lines and antibodies: The present invention provides expression vectors that facilitate high levels of expression of GPCR proteins. Encompassed by the invention are methods and compositions for recombinant cell lines expressing GPCR proteins with the aid of the expression vectors of the instant invention. The recombinant cell lines of the instant invention express... Agent: Morgan, Lewis & Bockius LLP (sf) 20070196872 - Materials and methods for identifying agents that modulate norrin, norrin mimetics, and agents identified thereby: The specification discloses materials and methods for screening and identifying reagents, which modulate Norrin activity as it relates to Wnt pathway signaling. Preferably, agents identified thereby modulate bone remodeling and/or lipid levels, and can be Norrin mimetics and Norrin agonists, as well as other agonists and mimetics of the LRP5/Norrin/Frizzled4... Agent: Drinker Biddle & Reath (dc) 20070196868 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP 20070196869 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP 20070196870 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP 20070196865 - Methods of screening compositions for g protein-coupled receptors aganist agonists: Methods of screening compositions for G protein-coupled receptor (“GPCR”) agonist activity against two or more GPCRs in a multiplex receptor assay format are disclosed. One or more cells expressing at least two different GPCRs are exposed to a test composition and it is determined whether or not the composition gives... Agent: Dorsey & Whitney LLP 20070196866 - Modulators of ion channel trpa1: This invention provides methods for modulating activities of noxious ion channel TRPAI and methods for screening for novel modulators of TRPAI. Compounds such as bradykinin, eugenol, gingerol, methyl salicylate, allicin, and cinnamaldehyde can be employed to activate cold themosensor TRPAI. These TRPAI agonists can be used in screenings methods to... Agent: Genomics Institute Of The Novartis Research Foundation 20070196873 - Pain signaling molecules: The invention relates generally to novel genes expressed in normal but not Neurogenin-1-deficient animals. The invention relates specifically to a novel family of G protein-coupled receptors and a novel family of two-transmembrane segment proteins that are expressed in dorsal root ganglia, and a method of screening for genes specifically expressed... Agent: Knobbe Martens Olson & Bear LLP 20070196876 - Free ngal as a biomarker for cancer: Uncomplexed neutrophil gelatinase associated lipocalin (NGAL) is present at increased levels in individuals with atypical ductal hyperplasia (ADH), a major risk factor for future breast cancer development; in individuals that have ovarian cancer; and in individuals that have breast cancer, both invasive and noninvasive. Accordingly, the present invention is directed... Agent: Goodwin Procter LLP Patent Administrator 20070196875 - Method for detecting ovarian cancer: A method of detecting ovarian cancer in a female test subject comprising determining the amount of plasmenyl-PA or a biomarker having a mass charge ratio of approximately 655.3 in a sample of a bodily fluid taken from the female test subject and comparing the amount of plasmenyl-PA (or the biomarker)... Agent: Frishauf, Holtz, Goodman & Chick, PC 20070196874 - Method of examining colon cancer and colon adenoma: The present invention provides a method for examining colorectal cancer and colorectal adenoma, which enables to detect colorectal cancer patients and patients at high risk of colorectal cancer at a high probability and is useful for diagnosis of colorectal cancer and colorectal adenoma, and provides the examination reagents thereof. The... Agent: Drinker Biddle & Reath (dc) 20070196877 - Rapid, low-cost assay for detecting brettanomyces and other spoilage yeast in wine: In one aspect, the present invention relates to a rapid, sensitive and cost-effective immunoassay for the detection of Brettanomyces yeast in wine.... Agent: Michael A. Shippey, Ph. D. 20070196878 - Immune diagnostic assay to diagnose and monitor tuberculosis infection: The present invention relates to a method of diagnosing and monitoring various distinct presentations of tuberculosis: active tuberculosis disease, latent tuberculosis infection and recent tuberculosis infection. The rapid immune assay is based on the evaluation of the frequency of Interferon (IFN) gamma-producing antigen-specific T lymphocytes responding to selected peptide sequences... Agent: Clark & Elbing LLP 20070196879 - Novel phosphate-binding protein, pharmaceutical compositions containing same and use thereof: A protein includes or is formed by: (i) SEQ ID NO: 1; (ii) any sequence that is derived from sequence SEQ ID NO: 1, for example, by the substitution, removal or addition of one or more amino acids, on the condition that the derivative sequence binds to the phosphate; (iii)... Agent: Young & Thompson 20070196880 - Methods for improving the recovery of troponin i and t in mebranes, filters and vessels: A method to facilitate recovery troponin I and/or troponin T from a sample comprising addition of troponin C to the sample or to a surface from which the troponin I and/or troponin T are recovered.... Agent: Foley & Lardner LLP 20070196881 - Signal amplification using a synthetic zymogen: Described herein are zymogens, methods of use for zymogens, and devices that incorporate zymogens. The zymogens include a substrate and an enzyme. The substrate can inhibit the enzyme and is a target for a protein produced by a microorganism. When the substrate is modified by a protein produced by a... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070196882 - Assay system for specific inhibitors of protein kinase c-related kinases: The present invention relates to an assay system for specific inhibitors of protein kinase C-related kinases (PRKs) relating to one or more of the reactions wherein said protein kinase C-related kinases are involved under physiological conditions. The invention also relates to a process for identifying specific inhibitors for protein kinase... Agent: Greenblum & Bernstein, P.L.C 20070196883 - Enzyme: The present invention relates to methods of altering the substrate specificity of PDK1, methods of identifying compounds which modulate the activity of PDK1 and methods of using PDK1 having altered substrate specificity.... Agent: Rogalsky & Weyand, LLP 20070196884 - Method for the detection of coliforms and in particular escherichia coli: The invention is relative to a novel method for the detection of coliforms, which is based on the use of a mixture of amino acids to promote the expression of inducible enzymes, in absence of cell growth. This enzyme-inducing solution can be used for the rapid detection of the enzymes... Agent: Nixon Peabody, LLP 20070196885 - Method of determining carbonic anhydrase i activity: To provide a method for specifically determining CA isozyme activity. The method for determining hydrolase activity of carbonic anhydrase I (CAI) in a sample, which is characterized in that the method employs, as a substrate or a combination of a substrate and an inhibitor, any of the following (A) to... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070196887 - Compositions and methods for monitoring breast cancer treatment: The present invention provides compositions and a method for monitoring breast cancer treatment.... Agent: Schwegman, Lundberg, Woessner & Kluth, P.A. 20070196888 - Method for inhibiting degradation of brain natriuretic peptides: A method for inhibiting the degradation of mammalian natriuretic peptides, in particular BNP, by using containers wherein the face coming into contact with specimens are made of a material is disclosed. Said material inhibits the activation of a substance, which in turn, degrades the peptides. This method makes it possible... Agent: Birch Stewart Kolasch & Birch 20070196886 - Target and method for inhibition of bacterial rna polymerase minimized derivatives of peptide antibiotic mccj25: Disclosed are targets, methods, and reagents for specific binding and inhibition of RNAP from bacterial species. The invention has applications in analysis of RNAP structure and function, control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, antibacterial therapy, and drug discovery.... Agent: Hoffmann & Baron, LLP 20070196889 - Use of pks 13 protein coding for condensase of mycolic acids of mycobacteria and related strains as an antibiotics target: The invention relates to a novel enzyme involved in the biosynthesis of mycolic acids and to the use thereof for the screening of antibiotics, especially antimycobacterials. The invention more particularly relates to the Pks13 protein which catalyzes Claisen condensation or malonic condensation in mycolates between an acyl-CoA molecule or an... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070196890 - Prebiotic effect analysis: A method for evaluating or quantifying the prebiotic capability of a fiber or for identifying a prebiotic substance, which comprises (a) a step of evaluating or quantifying the effect by the tested fiber or substance on the growth and/or modification of faecal bacterial population, and (b) a step of quantifying... Agent: Novartis Corporate Intellectual Property 20070196891 - Method for processing tissue samples in preparation for histological examination: A histological specimen retaining device for processing tissue. The histological specimen retaining device comprises a foldable permeable sheet having edges and a permeable target disposed on the foldable permeable sheet within the edges of said sheet thereby providing extended flap portions. The extended flap portions are foldable to overlap the... Agent: Thompson Coburn, LLP 20070196894 - Method for selective separation of free-astaxanthin from green algae haematococcus pluvialis: There is provided a method of separating free-astaxanthin selectively from green algae and, more particularly, to a method of separating free-astaxanthin selectively from Haematococcus pluvialis, the method comprising: mixing a cell culture containing Haematococcus pluvialis with an alkanic solvent and stirring, thereby obtaining an alkanic solvent extract containing astaxanthin material... Agent: Hamre, Schumann, Mueller & Larson, P.C. 20070196893 - Process for obtaining lutein from algae: A process of obtaining lutein in a high yield from green algae is described. Lutein and lutein-enriched products obtained by the process, which are suitable for use as dietary supplements and/or food additives, or cosmetic or pharmaceutical raw materials, are also described.... Agent: Cognis Corporation Patent Department 20070196896 - Human cell strains for protein production, provided by selecting strains with high intracellular protein and mutating with carcinogens: A novel human cell strain enabling the continuous production of a desired protein with high efficiency, comprising a novel human cell strain established by transforming a human cell strain whose total intracellular protein weight is 0.1 to 1 mg 1,000,000 cells; with the novel human cell strain being further characterized... Agent: Pepper Hamilton 20070196900 - Method for the manufacture of lantibiotics: The present invention relates to the manufacture of antibiotic compounds of the class known as lantibiotics. Preferably, the present invention relates to the purification of those lantibiotics.... Agent: Michael P. Morris Boehringer Ingelheim Corporation 20070196899 - Mutant protein having diaphorase activity: A mutant protein having diaphorase activity is provided. A mutant protein includes an amino acid sequence obtained by deletion, replacement, addition, or insertion of at least one amino acid residue of a native-form amino acid sequence of SEQ. ID. No. 1, wherein the mutant protein has diaphorase activity with an... Agent: Bell, Boyd & Lloyd, LLP 20070196897 - Polynucleotides encoding a novel human g-protein coupled receptor splice variant, hgprbmy29sv2: The present invention provides novel polynucleotides encoding HGPRBMY28 and HGPRBMY29 polypeptides, fragments and homologues thereof. The present invention also provides polynucleotides encoding splice variants of HGPRBMY29 polypeptides, HGPRBMY29v1 and HGPRBMY29v2. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing said polypeptides. Also provided are vectors,... Agent: Louis J. Wille Bristol-myers Squibb Company 20070196898 - Subtilases: The present invention relates to novel subtilases from wild-type strains of Bacillus, especially the Bacillus strains ZI344, EP655, P203, EP63, ZI120, ZI130, ZI1342 and ZI140, and to methods of construction and production of these proteases. Further, the present invention relates to use of the claimed subtilases in detergents, such as... Agent: Novozymes North America, Inc. 20070196895 - Use of a serum-free cell culture medium for the production of il-18bp in mammalian cells: The invention relates to a process for culturing IL-18BP expressing mammalian cells under serum-free conditions.... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070196901 - Kahalalide-producing bacteria: Disclosed are strains of Vibrio sp bacteria that produce kahalalides or derivatives thereof, methods of isolating said strains, and 16S rRNA sequences useful in identifying kahalalides producing bacteria.... Agent: Intellectual Property / Technology Law 20070196902 - Method of detecting azt resistance in hiv: Described herein is a method of determining the presence of a nucleoside reverse transcriptase inhibitor-resistant Human Immunodeficiency Virus-1 (HIV-1) virus particle in a biological sample, comprising identifying the presence in the sample of a point mutation at codon Q509 of an HIV-1 reverse transcriptase, for example and without limitation Q509L.... Agent: Jesse A. Hirshman, Esq. 20070196903 - Overcoming dapa aminotransferase bottlenecks in biotin vitamers biosynthesis: A method is disclosed for the increased production of biotin and the biotin precursor dethiobiotin using a bacterium that produces a lysine-utilizing DAPA aminotransferase. The method involves the use of a bacterium that is either grown in the presence of lysine or deregulated for lysine biosynthesis.... Agent: Stephen M. Haracz, Esq. Bryan Cave LLP 20070196904 - Method for the production of chiral secondary alcohols: Disclosed is a method for producing chiral, secondary alcohols of formula (I), wherein A represents an aromatic, heterocyclic, or alicyclic ring or a ring system with 4 to 20 C atoms, n represents 0, 1, 2, 3, 4, or 5, R represents halogen, OH, an O— protective group, NO2, N,N—R2,R3... Agent: Nixon & Vanderhye, PC 20070196905 - Stereoselective bioconversion of aliphatic dinitriles into cyano carboxylic acids: The present invention is directed to a regio- and stereoselective bioconversion of selected aliphatic dinitriles into corresponding cyanocarboxylic acids. More particularly, the present invention provides methods for the conversion of 2-isobutyl-succinonitrile into (S)-3 cyano-5-methylhexanoic acid, which is a useful intermediate in the synthesis of (S)-3(aminomethyl)-5-methylhexanoic acid (pregabalin). Pregabalin can be... Agent: Warner-lambert Company 20070196906 - Process for producing chiral hydroxyaldehyde compounds: An industrial process for producing hydroxyaldehydes efficiently, by solving the problems of conventional DERA, such as low stability against aldehydes, low catalytic activity for aldol condensation, and the difficulty of controlling the number of acetaldehyde molecules to be condensed, is provided. According to the process, aldol condensation of a substituted... Agent: Buchanan, Ingersoll & Rooney PC 20070196907 - Method for producing ethanol using raw starch: The present invention is directed to the methods for producing high levels of alcohol during fermentation of plant material, and to the high alcohol beer produced. The present invention is also directed to methods for producing high protein distiller's dried grain from fermentation of plant material, and to the high... Agent: Womble Carlyle Sandridge & Rice, PLLC 20070196908 - Stabilizers for polymerizable biocompatible materials: The present invention provides polymerizable biocompatible materials stabilized by amino acids or reducing salts to improve shelf life. Methods of stabilizing a polymerizable biocompatible material that inhibit auto polymerization of the material over time are also provided.... Agent: Woodcock Washburn LLP 20070196909 - Laboratory instrumentation information management and control network: An interface point network (IPN) and a method for communication with a laboratory information system using an IPN, wherein the IPN includes at least one host computer in communication with at least one laboratory instrument, the laboratory information system and an interface point server in communication with the host computer... Agent: Muirhead And Saturnelli, LLC 20070196910 - Methods for producing low binding surfaces: Hydrophobic polymer surfaces whose level of protein binding is less than about 50-80 ng/cm2 are achieved by: (1) applying a coating solution composed of a solvent and a non-ionic surfactant having a HLB number of less than 5 to the surface; and (2) drying the surface to remove the solvent... Agent: Susan S. Wilks Corning Incorporated 20070196911 - Devices and methods for growing human cells: A bioreactor having: a reaction chamber; a first port adapted for the introduction of human cells; a second port adapted for gas exchange, the second port comprising a filter; a third port adapted for introducing culture medium; a fourth port adapted for sampling cells; and a fifth port adapted for... Agent: Popovich, Wiles & O'connell, PA 650 Third Avenue South 20070196912 - Integrated chip carriers with thermocycler interfaces and methods of using the same: Methods and systems are provided for conducting a reaction at a selected temperature or range of temperatures over time. An array device is provided. The array device contains separate reaction chambers and is formed as an elastomeric block from multiple layers. At least one layer has at least one recess... Agent: Townsend And Townsend And Crew, LLP 20070196913 - Detachable bottom of cell culture plates for slides: An improvement made to cell culture plates and dishes. The plastic bottom is made detachable for slides without using glass for cell culture. To detach a plate bottom, the user inserts a key to the plate and makes a 90-degree turn, which breaks a detaching ring and releases the plastic... Agent: Stephen Liye Chen 20070196915 - Cellular tissue culture systems for high-volume processing: Tissue culture medium such as porous frameworks and even open surface multidirectional porous frameworks may be used to provide uniform distribution of nourishment solutions, uniform interstitial voids as well as undistorted transport fields which may facilitate high volume yields of finished plants from cells, such as explants in a tissue... Agent: Santangelo Law Offices, P.C. 20070196914 - Methods for preparing oil bodies comprising active ingredients: The present invention provides novel emulsions that comprise oil bodies. The invention also relates to novel methods for generating formulations comprising oil bodies and active ingredients wherein the active ingredient is partitioned into the oil body. The methods are particularly useful for generating emulsions with either hydrophobic or amphipathic biologically... Agent: Bereskin And Parr 20070196916 - Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment: The present invention encompasses novel antibodies and fragments thereof which immunospecifically bind to one or more RSV antigens and compositions comprising said antibodies and antibody fragments. The present invention encompasses methods preventing respiratory syncytial virus (RSV) infection in a human, comprising administering to said human a prophylactically effective amount of... Agent: Jones Day 20070196917 - Methods of constructing a gene mutation library and compounds and compositions thereof: The invention is directed toward a method of producing a selected cell line or a non-human transgenic animal model for the analysis of the function of a gene comprising introducing into an embryonic stem cell a vector having a selectable marker which, when the vector is inserted within a gene,... Agent: Clark & Elbing LLP 20070196918 - Reprogramming of adult human testicular stem cells to pluripotent germ-line stem cells: Methods for therapeutically programming human adult stem cells into pluripotent cells are provided. Cell therapeutically programmed from adult testicular cells are disclosed. The therapeutically reprogrammed cells are suitable for cellular regenerative therapy and have the potential to differentiate into more committed cell lineages.... Agent: Kirkpatrick & Lockhart Preston Gates Ellis LLP 20070196919 - Method of generating human retinal progenitors from embryonic stem cells: Methods are provided for the in vitro differentiation of human retinal progenitor cells from embryonic stem cells.... Agent: Bozicevic, Field & Francis LLP 20070196921 - Extranuclear rna splicing in neuronal dendrites: The present invention relates to methods of synaptic network remodeling by means of extranuclear RNA splicing. The present invention also provides methods of extranuclear RNA splicing, and methods of protein translation based on extranuclear RNA splicing.... Agent: Drinker Biddle & Reath Attn: Intellectual Property Group 20070196920 - Method and device of metamorphosing cells, and treatment apparatus using the same: A cell metamorphosing device includes micro dishes which serves as diaphragms and hold a mixed medium containing harmful cells and nano-scale particles, an AC voltage supply, a heater and an inductor. The AC voltage supply faces with the micro dishes 2 with a space, and applies a bias to the... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070196922 - Methods and compositions relating to restricted expression lentiviral vectors and their applications: The present invention provides HIV-derived lentivectors which are safe, highly efficient, and very potent for expressing transgenes for human gene therapy, especially, in human hematopoietic progenitor cells as well as in all other blood cell derivatives. The lentiviral vectors comprise promoters active to promote expression specific to cell types or... Agent: Fulbright & Jaworski, L.L.P. 08/16/2007 > patent applications in patent subcategories.20070190521 - High throughput system and methods for analyzing liquid formulations: The present disclosure generally relates to a high throughput system, apparatus, and methods useful for efficiently analyzing experimental liquid formulations applied to plants. In various embodiments, the high throughput system includes a liquid formulation dispensing subsystem (LFDS). The LFDS includes an automated moveable sample plate platform for holding at least... Agent: Harness, Dickey, & Pierce, P.l.c 20070190526 - Methods of extracting nucleic acids: Methods and materials are disclosed for rapid and simple extraction and isolation of nucleic acids, particularly RNA, from a biological sample involving the use of an alkaline reagent followed by an acidic solution and a solid phase binding material that has the ability to liberate nucleic acids from biological samples,... Agent: Handley,richard Lumigen, Inc. 20070190560 - Element-tagged olignucleotide gene expression analysis: Methods and kits for gene expression analysis are disclosed. The methods utilize element-tagged oligonucleotides as probes which are subsequently analyzed by elemental analysis. Also disclosed are methods and kits for the analysis of biological molecules using element labeled supports such as beads, followed by elemental analysis. The elemental analysis can... Agent: Torys LLP 20070190536 - Method for using biomaterials as reagent for nano-patterning: A pattern transfer method includes providing a substrate, forming a first biomaterial over the substrate, exposing the first biomaterial to a pattern writing agent in a manner consistent with a pattern to be transferred, forming a second biomaterial over the first biomaterial, wherein the second biomaterial reacts and bonds with... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070190541 - Microarray substrate, methods of manufacturing and use: A microarray substrate comprising a functionalized (poly)ethyleneglycol compound coated on a solid support having a polyanhydride surface is disclosed. Methods of manufacturing and using the substrate are also disclosed.... Agent: Cantor Colburn, LLP 20070190556 - Selective genome amplification: The invention provides methods and compositions for amplifying selected polynucleotides, especially selected subsets of restriction fragments. Generally, methods of the invention are implemented by ligating adaptors containing at least one promoter sequence to such fragments under conditions that promote the formation of closed single stranded or double stranded structures, which... Agent: Bozicevic, Field & Francis LLP 20070190572 - Methods and kits using a molecular interaction between a smurf-1 ww domain and lim mineralization protein isoforms: The instant application provides kits and methods for identifying agents which induce or inhibit the osteogenic effect of LMP or BMP proteins. The kits are directed to methods which measure either an amount of a complex between a Smurf protein or a fragment thereof and an LMP protein or a... Agent: Fox Rothschild, LLP 20070190588 - Post-translational modifications identified by elemental analysis: Methods and kits for enzymes involved in post-translational modifications are provided. The methods employ elemental analysis, including ICP-MS. The methods allow for the convenient and accurate analysis of post-translation modifications of substrates by enzymes involved in post-translational modifications, including kinase and phosphatase enzymes.... Agent: Torys LLP 20070190590 - Information acquisition apparatus on concentration of thioredoxins in sample, stress level information acquisition apparatus and stress level judging method: The invention is to provide an information acquisition apparatus for acquiring information relating to at least one of an oxidized form concentration, a reduced form concentration and a ratio of the concentrations of thioredoxin, useful for judging a stress level, and a stress level information acquisition apparatus and a stress... Agent: Fitzpatrick Cella Harper & Scinto 20070190594 - Detecting method for the seeds contaminated with plant pathogens: A method of easily detecting a slight percentage of seeds contaminated with a seed-transmissible pathogen as mixed in among a large number of seeds is provided. The method comprises placing a substratum for germination with seeds disposed thereon in a hermetic container, adding an extractant to the hermetic container after... Agent: Akerman Senterfitt 20070190610 - Long-acting epo polypeptides and derivatives thereof and methods thereof: A polypeptide and polynucleotides encoding same comprising at least two carboxy-terminal peptides (CTP) of chorionic gonadotrophin attached to an EPO peptide are disclosed. Pharmaceutical compositions comprising the polypeptide and polynucleotides of the invention and methods of using same are also disclosed.... Agent: Pearl Cohen Zedek Latzer, LLP 20070190611 - Long-acting polypeptides and methods of producing same: A polypeptide and polynucleotides encoding same comprising at least two carboxy-terminal peptides (CTP) of chorionic gonadotrophin attached to a peptide-of-interest are disclosed. Pharmaceutical compositions comprising the polypeptide and polynucleotides of the invention and methods of using same are also disclosed.... Agent: Pearl Cohen Zedek Latzer, LLP 20070190602 - Mutant protein having the peptide-synthesizing activity: p 20070190518 - Hypothermic tooth transport system: The present invention relates to a method, system and container apparatus that enables sustained cellular viability of tooth biology under hypothermic conditions while providing a matrix nutrient specific to teeth environment that autonomously prepares cells and tissues for the cryogenic freezing process, in vitro... Agent: Burns & Levinson, LLP 20070190517 - Methods and compositions for the cryopreservation of organs: Methods and compositions are provided for the introduction and washout of vitrifiable concentrations of cryoprotectant in organs and tissues. The methods comprise cooling the organ to below −10° C. by perfusion with a solution having a freezing point below −10° C., a temperature from −10 to −40° C., and a... Agent: Foley & Lardner LLP 20070190522 - Capsule and tray systems for combined sample collection, archiving, purification, and pcr: The present invention relates to a biological sample collection, archiving, purification, and manipulating system and methods for collecting, archiving, purifying, and manipulating biological samples. The system can include a plurality of devices, each having a species-immobilizing filter within a tubular body. The body includes first and second end openings and... Agent: Kilyk & Bowersox, P.l.l.c. 20070190520 - Method of characterizing a biologically active compound: A method of characterizing a biologically active compound by placing a cell mixture into a rotatable bioreactor to initiate a three-dimensional culture comprising a biological component and at least one cell, controllably expanding the cells in the rotatable bioreactor and testing the biological component to characterize the biologically active compound.... Agent: Ladas & Parry LLP 20070190519 - Test: The present invention relates to a method of measuring pain in an individual, by calculating the percentage ratio of one neurotransmitter to one or more other neurotransmitters, in a sample.... Agent: Elmore Patent Law Group, PC 20070190525 - Assay implementation in a microfluidic format: An assay implementation in a microfluidic format in a cartridge relating to a point-of-care instrument platform for monitoring and diagnosing infectious diseases (e.g., AIDS and malaria). The platform may also provide a complete blood count. The instrument platform may hold the cartridge and a portion of an optical system for... Agent: Honeywell International Inc. 20070190523 - Method and compositions for identifying anti-hiv therapeutic compounds: The invention relates to methods and compositions for identifying compounds having therapeutic activity against human immunodeficiency virus (HIV).... Agent: Gilead Sciences Inc 20070190524 - Non-m, non-o hiv-1 strains, fragments and uses: Retroviral strains of the non-M, non-O HIV-1 group, in particular a strain designated YBF30, its fragments and also its uses as a diagnostic reagent and as an immunogenic agent. The HIV-1 viruses which differ both from the M group and the O group exhibit the following characteristics: little or no... Agent: Morgan Lewis & Bockius LLP 20070190565 - 2150, human protein kinase family member and uses therefor: The invention provides isolated nucleic acids molecules, designated 2150 nucleic acid molecules, which encode novel protein kinase family members. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing 2150 nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in... Agent: Millennium Pharmaceuticals, Inc. 20070190532 - Assay for identifying compounds which affect stability of mrna: The present invention relates to an assay for the identification of biologically active compounds, in particular to a reporter gene assay for the identification of compounds, which have an effect on mRNA stability. More particularly, the present invention relates to a reporter gene expression system and cell lines comprising said... Agent: Sheridan Ross PC 20070190548 - Capture and detection of target nucleic acid in dipstick assays: Use of helper probes in dipstick assays is described. In a dipstick assay to test for the presence of a target nucleic acid in a sample solution, the sample solution is contacted with the contact end of the dipstick to cause the sample solution to move by capillary action to... Agent: Proskauer Rose LLP 20070190558 - Cationic steroid antimicrobial compositions and methods of use: The invention provides methods for decreasing or inhibiting herpesviridae (HV) infection or pathogenesis of a cell in vitro, ex vivo or in vivo, a symptom or pathology associated with a herpesviridae (HV) infection or pathogenesis in vitro, ex vivo or in vivo, or an adverse side effect of herpesviridae (HV)... Agent: Pillsbury Winthrop Shaw Pittman LLP 20070190538 - Chimeric polymerases: Disclosed herein are chimeric polymerases and methods of making and using same.... Agent: Dechert LLP 20070190543 - Coded molecules for detecting target analytes: The present disclosure relates to methods of detecting target analytes based on single molecule detection of coded molecules.... Agent: Dechert LLP 20070190533 - Effectors of innate immunity: The present invention provides a method of identifying agents that enhance innate immunity in a subject. The invention further provides a method of selectively supresses sepsis by suppressing expression of a proinflammatory gene while maintaining expression of an anti-inflammatory gene. Also provided are methods of identifying a polynucleotide or pattern... Agent: Dla Piper US LLP 20070190539 - Human mlr single nucleotide polymorphisms associated with dose-dependent congestive heart failure and methods of use thereof: The invention provides novel polynucleotides and polypeptides associated with the incidence of PPAR-agonist induced congestive heart failure. The invention also provides polynucleotide fragments corresponding to the genomic and/or coding regions of these polynucleotides which comprise at least one polymorphic locus per fragment. Allele-specific primers and probes which hybridize to these... Agent: Louis J. Wille Bristol-myers Squibb Company 20070190542 - Hybridization assisted nanopore sequencing: A method of employing a nanopore structure in a manner that allows the detection of the positions (relative and/or absolute) of nucleic acid probes that are hybridized onto a single-stranded nucleic acid molecule. In accordance with the method the strand of interest is hybridized with a probe having a known... Agent: Barlow, Josephs & Holmes, Ltd. 20070190559 - Isolation of nucleic acid: The present invention provides a method of isolating nucleic acid from a sample, said method comprising contacting said sample with a detergent and a solid support, whereby soluble nucleic acid in said sample is bound to the support, and separating said support with bound nucleic acid from the sample. Where... Agent: Invitrogen Corporation C/o Intellevate 20070190549 - Label-free optical sensing and characterization of biomolecules by d8 or d10 metal complexes: The present invention provides a composition for detecting and/or characterizing a multiple-charged biomolecule comprising a charged d8 or d10 metal complex, wherein the metal complex electrostatically binds to the multiple-charged biomolecule to induce aggregation and self-assembly of the metal complex through metal . . . metal interactions, π . .... Agent: Cooper & Dunham, LLP 20070190530 - Method for bisulfite treatment: The invention is related to the detection of a methylated cytosine in a nucleic acid wherein guanidinium hydrogen sulfite is used for the preparation of a solution containing guanidinium ions and sulfite ions and subsequent modification of the nucleic acid. Thereby, a non-methylated cytosine is converted to uracil. The invention... Agent: Roche Molecular Systems Inc Patent Law Department 20070190568 - Method for detecting at least one designated genetic sequence: The present invention provides a method to rapidly provide genotype screening of a plurality of biological samples in a designated well of a microwell container for remote user by a screening laboratory. The screening method can be used to determine if a biological sample is heterozygous, homozygous or wild for... Agent: Butler, Snow, O'mara, Stevens & Cannada PLLC 20070190529 - Method for detecting neoplastic disorders in a solubilized body sample: The present invention relates to a method for the early diagnosis of neoplastic disorders such as cancers as well as their precursor stages, particularly cancers of the respiratory tract, the urinary system, the reproductive tract, cancer associated with HPV infection or cancer of the anogenital tract, from solubilized body samples.... Agent: Howrey LLP 20070190531 - Method of amplifying nucleic acid and method of detecting mutated nucleic acid using the same: A primer set that allows a target nucleic acid to be amplified specifically and efficiently. The primer set of the present invention includes at least two primers that allow a target nucleic acid sequence to be amplified. A first primer included in the primer set contains, in its 3′ end... Agent: Hamre, Schumann, Mueller & Larson, P.C. 20070190528 - Method of judging imflammatory disease by using single nucleotide polymorphism in galectin -2 gene: An object of the present invention is to identify a novel single nucleotide polymorphism (SNP) associated with the onset and development of inflammatory diseases such as myocardial infarction. The present invention provides a method for judging inflammatory diseases which comprises detecting at least one gene polymorphism in the galectin-2 gene.... Agent: Greenblum & Bernstein, P.L.C 20070190546 - Methods and compositions for sequencing a nucleic acid: The invention provides a family of nucleotide analogs useful in sequencing nucleic acids containing a homopolymer region comprising, for example, two or more base repeats, and to sequencing methods using such nucleotide analogs.... Agent: Sughrue Mion, PLLC 20070190540 - Methods for the amplification, quantitation and identification of nucleic acids: The invention relates to improved methods of amplifying and optionally quantifying and/or identifying a plurality of selected nucleic acid molecules from a pool of nucleic acid molecules. A first round of multiplex amplification used where the amplification reaction is allowed to proceed to a point prior to that at which... Agent: Edwards Angell Palmer & Dodge LLP 20070190555 - Methods of detecting mutations associated with ataxia-ocular apraxia 2 (aoa2): Methods of identifying polymorphisms associated with ataxia-ocular apraxia 2 (AOA2), are described. The polymorphisms associated with AOA2 include specific mutations in the senataxin (SETX) gene. Also described are methods of diagnosis of AOA2, as well as methods of assessing an individual for carrier status for AOA2.... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070190544 - Methods of screening for resistance to microtuble-targeting drugs: The invention relates to methods for determining resistance or responsivity to microtubule-targeting drug treatment in cancer patients. The methods comprise obtaining a tumor cell sample from a cancer patient and analyzing DNA in the tumor cell sample to determine the presence or absence of a loss of heterozygosity (LOH) at... Agent: Alston & Bird LLP 20070190534 - Mitochondrial sites and genes associated with prostate cancer: A cluster analysis of mutations in the mitochondrial genomes from malignant, adjacent benign and distant benign tissues from a sample of men having prostate cancer has determined that mutations in ND1, ND2, COX1 and CytB are indicative of prostate cancer. 97% (30/31) of the samples contained synonymous and non-synonymous mutations... Agent: Torys LLP 20070190545 - Multiplex pcr assay: This invention relates to a multiplex PCR assay capable of screening or detecting the relevant microbial organism specific to Mycobacterium tuberculosis, Toxoplasma gondii in a sample, comprising a reaction mixture of a combination of 3 sets of primers, one pair of said primers for detection of Mycobacterium tuberculosis, a second... Agent: Venable LLP 20070190551 - Non-alloying core shell nanoparticles: The present invention relates composite core/shell nanoparticles and a two-step method for their preparation. The present invention further relates to biomolecule-core/shell nanoparticle conjugates and methods for their preparation. The invention also relates to methods of detection of biomolecules comprising the biomolecule-core/shell nanoparticle conjugates.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070190554 - Novel binding site for retigabine on kcnq5: Disclosed herein are nucleic acid and polypeptide sequences of mutated KCNQ5 potassium channels which lack responsiveness to the potassium channel activator retigabine. Also disclosed herein are methods and kits related to the use of the aforementioned mutated KCNQ5 potassium channels.... Agent: Potter Anderson & Corroon LLP/wyeth 20070190550 - Novel compositions and methods for the identification, assessment, prevention, and therapy of human cancers: The present invention is directed to the identification of markers that can be used to determine whether tumors are sensitive or resistant to a therapeutic agent. The present invention is also directed to the identification of therapeutic targets. The invention features a number of “sensitivity markers.” These are markers that... Agent: Lahive & Cockfield, LLP 20070190553 - Novel rat voltage-gated potassium channel: Disclosed herein are nucleic acid and polypeptide sequences of a novel rat voltage-gated potassium channel, KCNQ5. Also disclosed herein are methods related to the use of the aforementioned potassium channel.... Agent: Potter Anderson & Corroon LLP/wyeth 20070190563 - Primer and primer set for amplification of cea nucleic acid, and method for assisting cancer diagnosis: The prdsent invention provides a nucleic acid amplification primer which can detect CEAmRNA with sufficient reproducibility than the Conventional nualeic acid amplification primer for carcinoeibryonic antigen: CEA detection, nucleic acid amplification primer sets, and methods... Agent: Sughrue Mion, PLLC 20070190562 - Programmable molecular manipulating processes: A system manipulates molecules using a set of proximal probes such as those used in atomic force microscopes. An electrostatic pattern is placed on a set of proximal probes such that each proximal probe may exert an electrostatic force. A molecule is captured using those electrostatic forces, after which the... Agent: Ibm Corp. (wip) C/o Walder Intellectual Property Law, P.C. 20070190552 - Purification methods and uses thereof: This invention relates to the use of thermophilic proteases in combination with mesophilic enzymes, including such use in improved methods for isolation, purification, diagnostic, analytical and manufacturing techniques. In particular, the uses and methods of the invention will facilitate improved purification, diagnostic, analytical and manufacturing techniques, especially those in the... Agent: Jacobson Holman PLLC 20070190566 - Quantified fluorescence microscopy: The present invention relates to calibration apparatuses, methods or tools used in microscopy. A calibration tool for fluorescent microscopy includes a support, a solid surface layer including a fluorescent material, and a thin opaque mask of non-fluorescent material defining reference feature openings having selected dimensions exposing portions of the surface... Agent: Affymetrix, Inc Attn: ChiefIPCounsel, Legal Dept. 20070190547 - Results for quality characteristic values for nucleic acid preparations: The invention provides a method for producing improved quality characteristic results for purified nucleic acid preps of virtually any kind. Such results include the quantitation, purity, integrity, and functional homogeneity, quality characteristic results. Further, the invention provides a method for producing improved application results for applications which utilize nucleic acid... Agent: Wesley B. Ames 20070190561 - Segments of the human gene for telomerase reverse transcriptase: The invention provides compositions and methods related to human telomerase reverse transcriptase (hTRT), the catalytic protein subunit of human telomerase. The polynucleotides and polypeptides of the invention are useful for diagnosis, prognosis and treatment of human diseases, for changing the proliferative capacity of cells and organisms, and for identification and... Agent: Geron Corporation 20070190535 - Size fractionation of nucleic acid samples: Methods for size fractionating nucleic acid molecules, using glass fiber filtration columns are described. The methods are useful in many downstream applications including array-based comparative genomic hybridization (aCGH), PCR-based sequencing, somatic genotypic with polymorphic markers, etc.... Agent: Agilent Technologies Inc. 20070190537 - Solid phase synthesis: The present invention relates to a method for synthesis of a polynucleotide on a dendron-modified surface of a substrate, and a method for stably maintaining a polynucleotide immobilized on a solid surface.... Agent: Jhk Law 20070190557 - Systems and methods of analyzing nucleic acid polymers and related components: Systems and methods of identifying, sequencing and/or detecting nucleic acid polymers, as well as related components (e.g., substrates, software and the like) are disclosed.... Agent: Wolf Greenfield & Sacks, P.C. 20070190567 - Treatment for asthma and allergy: Several genes are upregulated in the lung of asthma or allergy sufferers. Many of the genes up-regulated in asthma are involved in arginine metabolism in the lung. Moreover, a set of 291 signature genes was found that can be used to indicate a patient's predilection for developing asthma or the... Agent: Knobbe Martens Olson & Bear LLP 20070190564 - Universal nucleotides for nucleic acid analysis: The invention includes methods and kits for making and analyzing primer extension products incorporating one or more universal bases, including methods and kits for nucleic acid sequencing and microsatellite analysis.... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070190527 - Use of single nucleotide polymorphism in the coding region of the porcine leptin receptor gene to enhance pork production: The instant invention is drawn to the identification and use of information regarding one or more porcine leptin receptor (pLEPR) gene polymorphisms as a marker to identify animals to serve as breeding stock for enhanced pork production. One particular polymorphism of pLEPR gene results in either a methionine or a... Agent: Howrey LLP 20070190577 - Biologically active synthetic thyrotropin and cloned gene for producing same: Substantially pure recombinant TSH has been prepared from a clone comprising complete nucleotide sequence for the expression of the TSH. Diagnostic and therapeutic applications of the synthetic TSH are described.... Agent: Knobbe, Martens, Olson & Bear, LLP 20070190569 - Detecting molecules: A process for increasing the relative abundance of a molecule having a low relative abundance in a test sample.... Agent: Morgan, Lewis & Bockius, LLP 20070190571 - Detection of an exogenous ligand in biological fluid: Methods of and screens for detection of exogenous ligands in a biological sample without prior knowledge of the chemical structure of the ligand are disclosed. The novel screens and methods may be used to detect Illicit use of performance-enhancing steroids, which use has proliferated among a wide range of professional... Agent: Perkins Coie LLP 20070190573 - Diagnosing risk of cardiovascular complications using natiuretic peptides: The present invention relates to the use of cardiac hormones, particularly natriuretic peptides, for diagnosing the risk of suffering from a cardiovascular complication, particularly heart disease or acute coronary syndrome, as a consequence of cardiotoxic medication, in particular chemotherapeutics, including anthracyclines. In particular, the invention relates to a method for... Agent: Roche Diagnostics Operations Inc. 20070190574 - Diagnostic method for identifying carriers of the marburg i variant of factor vii-activating protease (fsap) on the basis of differential modulation of fsap activity: The present invention relates to a diagnostic method for identifying persons with genetically related hetero- or homozygous expression of the MR I variant of factor VII-activating protease (FSAP). The heterozygous or homozygous presence of an MR I polymorphism can be identified by a differential modulation of the FSAP activity.... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070190576 - Mitogenic oxygenase regulators: The present invention relates to new genes encoding for the production of novel nox enzyme proteins involved in generation of reactive oxygen intermediates that affect cell division. The present invention also provides vectors containing these genes, cells transfected with these vectors, antibodies raised against these novel proteins, kits for detection,... Agent: Klarquist Sparkman, LLP 20070190570 - Molecular spacer arm, process for the production thereof and uses on an analytical chip comprising molecules or biomolecules: in which X0, X4=C, O, S, Se, N, P, As; X1-3=C, O, N, S, Se, P, As, or C1-6 aryl or heteroaryl; Z1-2=C—R, Si—R, N, P and As, where R=C1-6 alkyl; R1-3=H, or C1-6 alkyl, aryl or heteroaryl; [Gp]=protective group for >N; n, m and p=integers≧1; [Sup]=H or a silanized... Agent: Hutchison Law Group PLLC 20070190575 - Osteoactivin protein and nucleic acids encoding the same, compositions and methods of stimulating bone differentiation: The invention provides osteoactivin proteins and nucleic acid molecules that encode the same, as well as biologically functional expression vectors containing nucleic acid molecules encoding osteoactivin proteins, and antibodies specific for osteoactivin proteins. The invention also provides therapeutic and diagnostic compositions and methods for utilizing the proteins, antibodies, nucleic acids,... Agent: Clark & Elbing LLP 20070190582 - Platelet surface pf4 antigenic complexes as a diagnostic indicator in heparin-induced thrombocytopenia: A method for diagnosing a predisposition for developing HIT is provided.... Agent: Dann, Dorfman, Herrell & Skillman 20070190584 - Method of separating cells from a sample: Rare cells are separated from a sample fluid by a positive selection or negative selection antibody by centrifuging in a tube containing a harvesting float. The harvesting float has an axial passage and a density to settle in the sample fluid and expand the layer of the target component. The... Agent: David W. Highet, Vp And ChiefIPCounsel Becton, Dickinson And Company 20070190583 - Predicitive biomarkers in cancer therapy: The use of various biomarkers to assess a subject's suitability for treatment with a EGFR/ErbB2 kinase inhibitor for a solid tumor are described. The biomarkers include TGFalpha, pS6, IGF-1R and levels of apoptosis occurring in tumor tissue.... Agent: Glaxosmithkline Corporate Intellectual Property, Mai B475 20070190578 - Method of site specific labeling of proteins and uses therefor: Methods for site-specific modification of protein are provided. These methods modify proteins which have been labeled at a particular site by the reaction of a transglutaminase with a glutamine peptide sequence which has been engineered into the protein. The site-specific modification methods of the invention are useful for producing reagents... Agent: Glaxosmithkline Corporate Intellectual Property - Uw2220 20070190579 - Preparation method of biotinylated protein and detection method using the same: The present invention presents construction of a detection method requiring no step of removing free biotin during preparation of a biotinylated protein having a biotin tag, in a detection method of a substance interacting with a protein, and studied various preparation methods of the biotinylated protein. In order to solve... Agent: Kilyk & Bowersox, P.l.l.c. 20070190581 - Density enhanced protein tyrosine phosphatases: Novel Type III density enhanced protein tyrosine phosphatases are disclosed and exemplified by human DEP-1 enzyme. Polynucleotides encoding huDEP-1 are disclosed, along with methods and materials for production of the same by recombinant procedures. Binding molecules specific for DEP-1 are also disclosed as useful for modulating the biological activities of... Agent: Seed Intellectual Property Law Group PLLC 20070190580 - Immunoassay of fragments of insulin-like growth factor binding proteins: An immunoassay of proteolytic protein fragments is described, including immunoassays of proteolytic fragments of Insulin-like Growth Factor Binding Proteins (IGFBPs). In one embodiment, a sandwich-type “two-site” immunoassay involves two different recognition antibody partners, in which one antibody is specific for a proteolytic epitope of a protein fragment, and the other... Agent: Beckman Coulter, Inc. 20070190585 - Antibody profiling sensitivity through increased reporter antibody layering: A method is disclosed for analyzing a biological sample by antibody profiling for identifying forensic samples or for detecting the presence of an analyte. In an embodiment of the invention, the analyte is a drug, such as marijuana, cocaine, methamphetamine, methyltestosterone, or mesterolone. The method comprises attaching antigens to the... Agent: Battelle Energy Alliance, LLC 20070190586 - Detection and determination of the stages of coronary artery disease: A method having clinically sufficient degree of diagnostic accuracy for detecting the presence of coronary artery disease in a human patient from the general population and for distinguishing between the stages of the disease in that patient is disclosed. The stages are, first, the non-acute stage, which is either asymptomatic... Agent: Stephen P. Gilbert, Esq. Bryan Cave LLP 20070190587 - Isolated luciferase gene of l. italica: The present invention relates to an isolated nucleic acid and polypeptide sequence that encodes for a luciferase of Luciola italica, as well as mutants thereof. The luciferase proteins of the present invention have been found to have extended bioluminescence emission that is red- or blue-shifted, and are useful as a... Agent: Wiggin And Dana LLP Attention: Patent Docketing 20070190589 - Enzymatic fluorometric assay for camp and adenylate cyclase: The present invention relates to a method for quickly determining CAMP content or an adenylate cyclase activity in a biological sample containing non-cyclic adenine nucleotides without the use of radioactive agents. Particularly, the present invention provides a method of determining CAMP content or an adenylate cyclase activity in a biological... Agent: Bacon & Thomas, PLLC 20070190591 - Microbial compositions and methods of use in water: Methods and compositions using an isolate Bacillus subtilis strain for treating a sample are disclosed. The methods and compositions disclosed are used in samples to affect a change in the sample such as cleaning the samples of unwanted elements or organisms (e.g., the presence or overgrowth of algae or fungi).... Agent: Perkins Coie LLP 20070190592 - Device and method for detecting antibiotic inactivating enzymes: The present invention provides a method of detecting production of antibiotic-inactivating factor and for determining the antibiotic susceptibility of a microorganism comprising the following steps. a culture of the microorganism suspected of producing inactivating factors and/or whose susceptibility is to be determined is admixed with an antibiotic to which susceptibility... Agent: Stinson Morrison Hecker LLP Attn: Patent Group 20070190593 - Methods for detecting and characterizing microorganisms: The invention provides methods, reagents, and devices for rapid detection and characterization of live bacteria.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070190595 - Process for obtaining zeaxanthin from algae: A process of obtaining zeaxanthin in a high yield from blue-green algae is de-scribed. Zeaxanthin and zeaxanthin-enriched products obtained by the process, which are suitable for use as dietary supplements and/or food additives, are also described.... Agent: Cognis Corporation Patent Department 20070190596 - Synthesis of (6s)-5-methyl-5,6,7,8-tetrahydrofolic acid: A process for the large-scale chemoenzymatic production of (6S)-5-methyl-5,6,7,8-tetrahydrofolic acid, also known as (6S)-5-methylTHFA, the process comprising the steps of: (1) reducing folic acid (FA) so as to yield dihydrofolic acid (DHFA); (2) stereoselectively reducing DHFA with dihydrofolate reductase (DHFR) in the presence of NADP/NADPH, glucose and GluDH so as... Agent: Mark J. Pandiscio Pandiscio & Pandiscio, P.C. 20070190598 - Method of reducing leachate from protein a affinity media: Disclosed are methods and compositions that may be used for purifying antibodies.... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070190597 - Oligosaccharide modification and labeling of proteins: The present invention generally relates to methods of functionalizing proteins, particularly antibodies, at oligosaccharide linkages, methods of humanizing antibodies by modifying glycosylation, as well as to novel antibodies linked to modified oligosaccharides. The invention further relates to kits that may be used to produce the antibodies of the invention.... Agent: Invitrogen Corporation C/o Intellevate 20070190612 - 31 human secreted proteins: The present invention relates to novel human secreted proteins and isolated nucleic acids containing the coding regions of the genes encoding such proteins. Also provided are vectors, host cells, antibodies, and recombinant methods for producing human secreted proteins. The invention further relates to diagnostic and therapeutic methods useful for diagnosing... Agent: Human Genome Sciences Inc. Intellectual Property Dept. 20070190599 - Anti-glypican 3 antibody: An antibody capable of binding to a specific region of glypican 3, as well as a humanized antibody created based on that antibody are disclosed. The anti-GPC3 antibody of the invention has a higher ADCC activity and CDC activity compared with those of a conventional antibody. The antibody of the... Agent: Fish & Richardson PC 20070190605 - Gene products of bacillus licheniformis which form odorous substances and improved biotechnological production methods based thereon: The present invention relates to 25 hitherto undescribed genes of B. licheniformis and gene products derived therefrom and all sufficiently homologous nucleic acids and proteins thereof. They occur in five different metabolic pathways for the formation of odorous substances. The metabolic pathways in question are for the synthesis of: 1)... Agent: Paul & Paul 20070190607 - Identification of a novel domain in the tumor necrosis factor receptor family that mediates pre-ligand receptor assembly and function: The present invention provides a polypeptide comprising the isolated amino acid sequence of a pre-ligand assembly domain (PLAD) of a TNF-like receptor. Also provided by this invention is a polypeptide comprising the isolated amino acid sequence of a pre-ligand assembly domain (PLAD), wherein the PLAD is selected from the group... Agent: National Institute Of Health C/o Needle & Rosenberg, P.C. 20070190600 - Mechanosensitive ion channels and methods of use: The present invention provides methods for identifying agents that decrease the activity of a mechanosenitive ion channels, preferably, a mechanosensitive Ca2+-permeable channel (MscCa) channel. The present invention also provides methods for using agents that decrease the activity of mechanosenitive ion channels, including, for instance, methods for treating cancer, methods for... Agent: Mueting, Raasch & Gebhardt, P.A. 20070190606 - Methods for production of proteins: The current invention provides methods for producing a polypeptide as inclusion bodies in bacterial host cells. The present methods are carried out by forming a gene construct comprising the genetic sequence encoding a polypeptide operatively linked to that of an inclusion partner protein, such as E. coli thioredoxin or a... Agent: Invitrogen Corporation C/o Intellevate 20070190601 - Modified integrase and methods of use: The invention includes modified enzymes such as integrases which maintain all or part of their enzymatic activity and can localize to the nucleus.... Agent: Avigenics, Inc. 20070190604 - Novel gene products from bacillus licheniformis forming or decomposing polyamino acids and improved biotechnological production methods based thereon: The invention relates to five or four novel genes and the gene products thereof from Bacillus licheniformis and sufficiently similar genes and proteins which are involved in vivo in the formation of polyamino acids. The gene in question is ywsC, ywsC′, ywtA, ywtB and ywtD or proteins coded thereby. The... Agent: Paul & Paul 20070190609 - Nucleic acid encoding an interleukin-9 receptor variant: This invention relates to the diagnosis, treatment and methods for discovery of new therapeutics for atopic asthma and related disorders based on variants of Asthma Associated Factor 2. One embodiment of the invention is a variant of AAF2 wherein codon 173 is deleted resulting in the loss of glutamine 173... Agent: Morgan Lewis & Bockius LLP 20070190603 - Stable macroscopic membranes formed by self-assembly of amphiphilic peptides and uses therefor: Described herein is the self-assembly of amphiphilic peptides, i.e., peptides with alternating hydrophobic and hydrophilic residues, into macroscopic membranes. The membrane-forming peptides are greater than 12 amino acids in length, and preferably at least 16 amino acids, are complementary and are structurally compatible. Specifically, two peptides, (AEAEAKAK)2 (ARARADAD)2, were shown... Agent: Choate, Hall & Stewart LLP 20070190608 - Thermostable alpha-amylases: b) a polypeptide comprising an amino acid sequence which has at least 70% identity with the polypeptide encoded by the amylase encoding part of the polynucleotide inserted into a plasmid present in the E. coli host deposited under the Budapest Treaty with DSMZ under accession number DSM 15334; c) a... Agent: Novozymes North America, Inc. 20070190613 - Novel essential fungal polynucleotides, polypeptides, and methods of use: The present invention provides essential fungal polynucleotides and their encoded polypeptides, homologues thereof and their uses. Additionally, the invention provides methods for the identification of essential polynucleotides and fungal strains which may be used for drug screening.... Agent: Louis J. Wille Bristol-myers Squibb Company 20070190614 - Methods and compositions for vitamin k epoxide reductase: The present invention provides a method of identifying a human subject having increased or decreased sensitivity to warfarin, comprising detecting in the subject the presence of a single nucleotide polymorphism in the VKOR gene, wherein the single nucleotide polymorphism is correlated with increased or decreased sensitivity to warfarin, thereby identifying... Agent: Myers Bigel Sibley & Sajovec 20070190616 - Method of cross-linking peptides: A method of cross-linking a peptide to form a homopolymer of the peptide, to immobilize the peptide on a solid phase and to enhance antigenicity of the peptide is disclosed. The method comprises the steps of preparing a fusion peptide by incorporating a cross-linking segment including a tetrapeptide sequence Q-X-K-(S/T)... Agent: Cohen Pontani Lieberman & Pavane LLP 20070190615 - Use of a gene coding for the c4bp protein beta chain for producing recombinant dimeric proteins: A method for preparing recombinant dimeric proteins using a nucleic acid coding for the C-terminal fragment of the C4BP protein β chain including amino acid residues 193 to 252 or a functional variant of the fragment, wherein the fragment enables covalent bonding of the heterologous polypeptides to which it is... Agent: Young & Thompson 20070190617 - Dna vaccine for japanese encephalitis virus: A DNA vaccine of Japanese encephalitis virus (JEV) of the present invention comprises at least one vector encoding a membrane protein and an envelope protein gene of JEV. Furthermore, the DNA vaccine contains a cytomegalovirus early promoter sequence, an enhancer sequence, a chimeric intron, a bovine growth hormone polyadenylation sequence... Agent: Frenkel & Associates, P.C. 20070190618 - Methods and compositions for detecting viral nucleic acid in a cell: Methods and compositions for identifying or detecting viral nucleic acids in a host cell are described. DNA fragments are bound to DNA-binding protein in a host cell and enriched using immunoprecipitation. The enriched fragments are then hybridized to a microarray containing sequences complementary to proviral DNA and genomic DNA.... Agent: Agilent Technologies Inc. 20070190619 - Oxidation of carbohydrates by means of peroxidases and nitroxy radicals: A method of oxidising carbohydrates and/or carbohydrate derivatives having primary alcohol groups comprising contacting a reaction medium containing said carbohydrates and/or carbohydrate derivatives with a nitroxy radical mediator and a peroxidase enzyme, characterised in that the initial reaction medium contains at least 10% by weight carbohydrates and/or carbohydrate derivatives, in... Agent: Fish & Richardson P.C. 20070190620 - Saccharification processes: The present invention provides improved process of enzymatic saccharification or pre-saccharification of liquefied starch-containing material, by treating said liquefied material with glucoamylase activity at a pH from 5.5 to 6.2.... Agent: Novozymes North America, Inc. 20070190621 - Synthesis of oseltamivir carboxylates: Enzymatic pathways for production of aminoshikimate, kanosamine, intermediates, and derivatives thereof; nucleic acid encoding and cells containing the enzymes; compositions containing aminoshikimate, kanosamine, an intermediate or derivative thereof; and use of the cells and pathways for biosynthetic production of aminoshikimate, kanosamine, intermediates, and derivatives thereof.... Agent: Harness, Dickey & Pierce, P.L.C 20070190622 - Method for production of methionine from homoserine: The invention relates to a method for production of D- and/or L-methionine via D- and/or L-homoserine with subsequent chemical transformation to give methionine.... Agent: Law Office Of Michael A. Sanzo, LLC 20070190623 - Process for purification and recovery of paclitaxel compounds: A method for producing paclitaxel from a broth of cell cultures includes the steps of (a) providing an aqueous broth of cell cultures including cells having intracellularly associated paclitaxel; (b) contacting the broth with a hydrophobic resin; (c) adsorbing the intracellularly associated paclitaxel onto the resin; and (d) separating the... Agent: Louis J. Wille Bristol-myers Squibb Company 20070190624 - Method for the separation of intermediates which may be used for the preparation of escitalopram: The invention relates to a method of separating and isolating an acylated derivative of 4-[(S)-4-dimethylamino-1-(4-fluorophenyl)-1-hydroxybutyl]-3-hydroxymethylbenzonitrile by reaction of a mixture of the 4-[(S)-4-dimethylamino-1-(4-fluorophenyl)-1-hydroxy-butyl]-3-hydroxymethylbenzonitrile and an acylated derivative thereof with a compound which form a derivative of the 4-[(S)-4-dimethylamino-1-(4-fluorophenyl)-1-hydroxy-butyl]-3-hydroxymethylbenzonitrile containing a carboxylic acid group. The acylated derivative containing a carboxylic acid... Agent: Darby & Darby P.C. 20070190625 - Detergent made use of fermentation technology and production method thereof: Regarding a detergent made using fermentation technology and its production method, in a production process of soap, effective microorganisms (EM) and EM-X ceramic powder are added to enhance a saponification degree of fat, strengthen a cleaning power as well, and also to realize a detergent capable of proliferating effective microorganisms... Agent: Burr & Brown 20070190629 - Metabolic engineering for improved xylose utilisation of saccharomyces cerevisiae: The present invention relates to a method for preparing an ethanol producing, xylose utilizing strain of Saccharomyces cerevisiae comprising genes for overexpression of xylose reductase, xylitol dehydrogenase and xylulokinase, wherein in addition to said genes for production o phosphoacetyltransferase, and acetaldehyde dehydrogenase are introduced and optionally overexpressed.... Agent: Sikorsky Aircraft Corporation 20070190626 - Methods for producing ethanol and methane from biomass: The present invention relates to methods for producing ethanol and methane from biomass. The clear phase of a pulp obtained by fermentation of milled biomass is used for obtaining methane gas for energy production and for conversion in a combined heat and power production of energy and steam. The anaerobically... Agent: Arnold & Porter LLP Attn:IPDocketing Dept. 20070190627 - Processes for making ethanol: An ergonomic chair system constructed from a stable base holding a rocking balanced seating structure, provided with an adjustable suspended relaxing supple seat, allowing an independent balanced controlled and secured inclination by body weight only without help, effort or locking device. This chair system is especially intended for the use... Agent: Novozymes North America, Inc. 20070190628 - Yeast food composition for fuel ethanol production: A method for producing a defined yeast food composition for supplementing a complex fermentation feedstock used for ethanol production. The method comprises selecting a complex fermentation feedstock and conducting a first series of steps wherein aliquots of the feedstock are supplemented with selected concentrations of selected individual nutritive elements. The... Agent: Kirby Eades Gale Baker 20070190630 - Process for producing biogas: A production method of a biogas of the present invention comprises carrying out hydrogen fermentation of a subject solution containing organic matter with the use of a hydrogen fermentation microorganism, in which according to a correlation between a concentration of a predetermined substrate in a liquid to be processed containing... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070190632 - Alpha-amylase variants having an elevated solvent stability, method for the production thereof and detergents and cleansers containing these alpha-amylase variants: The present invention relates to α-amylase variants that are stabilized to solvent-exerted hydrolysis, in particular at elevated temperatures or high pH, by point mutagenesis of asparagine (N) or glutamine (Q) residues located on the surface of the molecule to give other amino acid residues. The invention further relates to methods... Agent: Paul & Paul 20070190631 - Catalyzed method for forming products from a liquid reactant: A reaction product is made by flowing a liquid containing a reactant through a porous ceramic honeycomb wherein the porosity of the walls of the honeycomb are such that the liquid containing the reactant substantially penetrates into the walls and the reactant reacts as the liquid containing the reactant flows... Agent: The Dow Chemical Company 20070190633 - Endophytic streptomycetes from higher plants with biological activity: The present invention relates to isolated strains of a Streptomyces spp. which are endophytes of dicotyledonous plants and to methods for selecting such strains. The present invention also relates to compounds having biological activity selected from the group consisting of munumbicin A, munumbicin B, munumbicin C and munumbicin D, kakadumycin... Agent: Klarquist Sparkman, LLP 20070190634 - Compositions useful as inhibitors of protein kinases: The present invention relates to compounds useful as inhibitors of protein kinases. The invention also provides pharmaceutically acceptable compositions comprising said compounds and methods of using the compositions in the treatment of various disease, conditions, or disorders.... Agent: Vertex Pharmaceuticals Inc. 20070190635 - Percussion mechanism for a gene gun: A percussion mechanism for a gene gun has a gun body, a percussion assembly and a trigger assembly. The gun body has a trigger chamber, a tubular channel having a valve seat and communicating with the trigger chamber. The percussion assembly is mounted in the tubular channel and has a... Agent: Thomas E. Sisson Jackson Walker, LLP 20070190636 - Systems and methods for ex-vivo organ care: The invention provides, in various embodiments, systems, devices and methods relating to ex-vivo organ care. In certain embodiments, the invention relates to maintaining an organ ex-vivo at near-physiologic conditions.... Agent: Fish & NeaveIPGroup Ropes & Gray LLP 20070190637 - Apparatus for handling fluids: An apparatus and method for performing immunoturbidimetric measurements of plasma proteins on an apparatus used for measuring plasma and serum interferents are described. Immunoturbidimetric measurements are made on a sample in a disposable dispensing tip which acts as cuvette and reaction chamber. These features allow tests which are not available... Agent: Hovey Williams LLP 20070190640 - Device and method for the detection of an analyte: A device and a method are disclosed for the detection and/or for the quantification of an analyte. In at least one embodiment, the device includes a basic matrix and magnetized nanoparticles, which are arranged in moveable fashion in or at the basic matrix and to which catcher molecules that bind... Agent: Harness, Dickey & Pierce, P.L.C 20070190638 - Plasmon tomography: Plasmon energy is produced by exciting a plasmon resonance at least one excitation position on a first surface of a first material, and the plasmon energy is detected at at least one measurement position on the first surface after the plasmon energy has propagated from the at least one excitation... Agent: Searete LLC 20070190639 - Plasmon tomography: Plasmon energy is produced by exciting a plasmon resonance at at least one excitation position on a first surface of a first material, and the plasmon energy is detected at at least one measurement position on the first surface after the plasmon energy has propagated from the at least one... Agent: Searete LLC Clarence T. Tegreene 20070190641 - Mesoscale polynucleotide amplification device and method: Disclosed are devices for amplifying a preselected polynucleotide in a sample by conducting a polynucleotide polymerization reaction. The devices comprise a substrate microfabricated to define a sample inlet port and a mesoscale flow system, which extends from the inlet port. The mesoscale flow system includes a polynucleotide polymerization reaction chamber... Agent: Dann, Dorfman, Herrell & Skillman 20070190642 - Concentrators for luminescent emission: System and methods for concentrating collected flux in the form of excitation light or luminescence. The collected flux may be directed, propagated, and concentrated in various manners and may be localized into a generally small area. Concentrators may be advantageously implemented in flexible and efficient manners relative to conventional configurations... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070190643 - Angled reaction vessel: The invention is an apparatus and a process for treating biomass bearing material including municipal solid waste (MSW). The apparatus includes a reaction vessel held at an angle and configured for rotation and steam injection, with helically arranged internal flights, a self-aligning door closure, and a swing-away door assembly. It... Agent: Robert L. Shaver Dykas, Shaver & Nipper, LLP 20070190644 - Treatment of spinal cord injury: The present invention relates to the treatment of spinal cord injury with a vaccinia virus complement control protein (VCP).... Agent: Fish & Richardson P.C. 20070190650 - Composite body of inorganic compound and cells and production method thereof: A composite body of an inorganic compound and cells includes animal cells filled with fine particles of the inorganic compound, and the fine particles of the inorganic compound adhered to an outer portion of the animal cells. A method of producing a composite body of an inorganic compound and cells... Agent: Greenblum & Bernstein, P.L.C 20070190647 - Isolation and use of solid tumor stem cells: A small percentage of cells within an established solid tumor have the properties of stem cells. These solid tumor stem cells give rise both to more tumor stem cells and to the majority of cells in the tumor that have lost the capacity for extensive proliferation and the ability to... Agent: Medlen & Carroll, LLP 20070190648 - Microaggregates including endothelial cells: Microaggregates which mimic the native environment of cells contained in biopsied tissue are used to assess and predict the effects of various treatments on the viability of cell types contained in the microaggregate.... Agent: Morrison & Foerster LLP 20070190651 - Myogenic development and protection of stem cells against inflammation and apoptosis by statins and isoprenoid pathway inhibitors: A method of enhancing survival and differentiation of stem cells, and cells of myogenic lineage derived from said stem cells, when the cells are exposed to an inflammatory or apoptotic stimulus comprises culturing stem cells in vitro in a medium containing a statin, to produce statin-pretreated cells with enhanced resistance... Agent: Conley Rose, P.C. David A. Rose 20070190649 - Pulsatile perfusion extraction method for non-embryonic pluripotent stem cells: A method for extracting stem cells from a non-embryonic stem cell source, including providing a non-embryonic stem cell source including stem cells; perfusing the non-embryonic stem cell source with a pulsatile flow of a perfusion solution to produce a perfusate including stem cells and a perfused non-embryonic stem cell source;... Agent: Nath & Associates 20070190646 - Regulating stem cell differentiation by controlling matrix elasticity: Provided are methods for the selection and regulation of the mechanical properties of substrates or tissue microenvironments as a technique to regulate in vitro differentiation, cell shape and/or lineage commitment of anchorage-dependent cells, such as mesenchymal stem cells into, e.g., neurogenic-, myogenic-, and osteogenic-type cells. Substrate mechanical properties include elasticity,... Agent: Montgomery, Mccracken, Walker & Rhoads, LLP 20070190645 - Vascular cell culture patterning substrate: A vascular cell culture patterning substrate, which can efficiently form a plurality of blood vessels on one substrate. The vascular cell culture patterning substrate includes: a base material; a vascular cell adhesion portion formed in at least two substantially parallel lines on the base material, and having adhesive properties to... Agent: Ladas & Parry LLP 20070190652 - Anti-hiv agent: Disclosed are anti-HIV agents which comprise a mannose binding protein (MBP) as an active component and are useful for effectively inhibiting progress of diseases state in and useful in therapy for individuals infected with human immunodeficiency virus (HIV). Also disclosed are a method for evaluating an anti-HIV activity of MBP... Agent: Marshall, Gerstein & Borun LLP 20070190653 - Device and method for isolating cells, bioparticles and/or molecules from liquids: The invention describes an appliance and a method, with the help of which specific bio-particles, but also dissolved bio-molecules can be recognised in and separated from fluids making use of suitable carriers and known immobilisation methods. The appliance can be used both discontinuously and also for direct and continuous treatment... Agent: Duane A. Stewart Iii Buchanan Ingersoll & Rooney PC 08/09/2007 > patent applications in patent subcategories.20070184479 - Method for hybridizing nucleic acids and hybridization apparatus: A method for hybridizing a target nucleic acid and a probe nucleic acid that can specifically bind to the target nucleic acid and that is immobilized on a substrate includes a first reaction step of allowing the target nucleic acid contained in a sample solution to react with the probe... Agent: Fitzpatrick Cella Harper & Scinto 20070184495 - Rapid nasal assay kit: The present invention relates to an assay which can be used on nasal secretions. The assay is used to determine the cause of nasal secretions, for example whether the secretions are due to an allergic reaction or a non-allergic reaction.... Agent: Greenberg Traurig, LLP 20070184512 - Mass spectrometry techniques for determining the status of sepsis in an individual: Mass spectrometry techniques for determining the status of sepsis in an individual are provided. A biomarker profile resolved from a biological sample, taken from the individual, using a mass spectrometry technique is compared to a reference biomarker profile. A single such comparison classifies the individual as belonging to or not... Agent: Becton, Dickinson And Company Attn: David W. Highet 20070184431 - Automated microscopic sperm indentification: A method and device for automatically identifying sperm cells in a smear on a microscope slide, including capturing a first digital color image within an area of interest on the microscope slide. The first digital color image is split into a plurality of component color space images and stored into... Agent: Patterson, Thuente, Skaar & Christensen, P.A. 20070184430 - Method for analysing a tissue sample: A method of analyzing a patient tissue sample to determine its diseased tissue fraction while essentially preserving the genomic and/or proteomic and/or epigenomic and/or biophysical properties of the tissue sample. The method includes preparing sections from the tissue sample, subjecting at least one of the sections to a histological/cytological examination,... Agent: Cohen, Pontani, Lieberman & Pavane 20070184429 - Method for measuring aromatase activity: The present invention relates to compounds useful for measuring aromatase activity. The invention further provides methods for measuring aromatase activity and for screening test agents which modulate aromatase activity. A kit is also provided for use in such screening methods.... Agent: Ge Healthcare Bio-sciences Corp. Patent Department 20070184432 - Microsample treatment apparatus: The present invention aims at providing a structure whereby, in the step of injecting a sample in a microquantity into a well, the migration of the sample into another well or overflow thereof can be prevented; and a structure whereby the position of the injected sample can be adjusted in... Agent: Birch Stewart Kolasch & Birch 20070184434 - Compositions for use in identification of influenza viruses: The present invention provides oligonucleotide primers, compositions, and kits containing the same for rapid identification of viruses which are members of the influenza virus family by amplification of a segment of viral nucleic acid followed by molecular mass analysis.... Agent: Medlen & Carroll LLP 20070184435 - Methods of screening apoptosis modulating compounds, compounds identified by said methods and use of said compounds as therapeutic agents: A method of screening cellular polypeptides for pro-apoptotic or anti-apoptotic activity in a cell of a particular cell-type, said method comprising: (a) culturing cells of said particular cell-type under non apoptotic conditions and culturing cells of said particular cell-type under apoptotic conditions, and (b) determining subcellular localisation of said cellular... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070184433 - Microparticle based biochip systems and uses thereof: This invention relates generally to the field of analyte assays. In particular, the invention provides a device for analyzing an analyte, which device comprises, inter alia, various means for moving analytes and other items to facilitate binding between analytes and their binding reagents immobilized on a surface and to facilitate... Agent: Morrison & Foerster LLP 20070184445 - photochromic relaxation kinetic method: The invention is related to a method for determining a characteristic kinetic quantity of a chemical reaction in a sample involving a plurality of chemical species, at least one of said species including at least one fluorophore, the method comprising the steps of: generating, by impinging light on said sample,... Agent: Akerman Senterfitt 20070184450 - Agents for and method of quantifying binding: The present invention provides a presentation system and method of use for quantifying a target moiety in a sample which may contain the target moiety, the method comprising using a specified concentration or varying the concentration of a presentation system in order to generate a comparison point or calibration curve... Agent: Myers Bigel Sibley & Sajovec 20070184471 - Analyte assay using particulate labels: Method for specific detection of one or more analytes in a sample. The method includes specifically associating any one or more analytes in the sample with a scattered-light detectable particle, illuminating any particle associated with the analytes with light under conditions which produce scattered light from the particle and in... Agent: Invitrogen C/o Intellevates Sughrue Mion PLLC 20070184477 - Anti-hiv agent: Disclosed are anti-HIV agents which comprise a mannose binding protein (MBP) as an active component and are useful for effectively inhibiting progress of diseases state in and useful in therapy for individuals infected with human immunodeficiency virus (HIV). Also disclosed are a method for evaluating an anti-HIV activity of MBP... Agent: Marshall, Gerstein & Borun LLP 20070184462 - Apparatus and method for solid-phase kinetic analysis of templated elongation reactions: Disclosed is an elongation reaction system that includes a membrane compatible with binding an elongation complex and an elongation complex compatible with binding the membrane. The elongation complex includes the biological template (e.g., DNA or RNA), a polymerizing agent (e.g., RNA polymerase, DNA polymerase, or a ribosome), and a primer... Agent: Price Heneveld Cooper Dewitt & Litton, LLP 20070184481 - Assay for transcriptionally active methylated promoters: A method of identifying genes that can be activated when methylated; as well as proteins that mediate such activation. The method allows identification of HLA-DRA silencing agents expected to be of therapeutic value in the treatment of inflammation associated with HLA-DRA expression.... Agent: Smith Hopen, Pa 20070184469 - Attenuated flavivirus strains containing a mutated m-ectodomain and their applications: The present invention relates to nine residue peptides (ApoptoM) from flavivirus M ectodomain able to modulate specifically the apoptotic activity of diverse flavivirus, to pharmaceutical composition comprising the same and their use for the treatment and/or the prevention of flavivirus-linked infections and cancers.... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070184483 - Biochemical analysis unit and method of producing thereof: The biochemical analysis unit has a base plate and absorptive regions. The absorptive regions are surrounded by the base plate formed of materials which shield a radioactive ray and a light. In the absorptive regions are applied and absorbed specific binding substances to be bound with substances derived from a... Agent: Sughrue Mion, PLLC 20070184476 - Biomarkers for liver fibrotic injury: The present invention provides a method for detecting liver fibrotic injury, including fibrosis and/or cirrhosis, by assaying biological samples for differential expression of at least one gene encoding a protein chosen from SEQ ID NO: 1-SEQ ID NO: 63 and human orthologs thereof, wherein differential expression of at least one... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070184480 - Card domain containing polypeptides, encoding nucleic acids, and methods of use: The invention provides caspase recruitment domain (CARD)-containing polypeptides, CARD, NB-ARC, ANGIO-R, LRR and SAM domains therefrom, as well as encoding nucleic acid molecules and specific antibodies. The invention also provides related screening, diagnostic and therapeutic methods.... Agent: Mcdermott, Will & Emery 20070184447 - Chemo-centric selection of disease-related genetic profiles: Methods for the identification of disease-related gene sets and expression nprofiles, based on common chemical modulation using a specific chemical compound are disclosed.... Agent: Carella, Byrne, Bain, Gilfillan, Cecchi, Stewart & Olstein 20070184444 - Compositions and methods for the treatment of immune related diseases: The present invention relates to composition containing novel proteins and method of using those compositions for the dignosis and treatment of immune related diseases.... Agent: Genentech, Inc. 20070184451 - Compounds and methods for molecular biology: The present invention provides materials and methods for the utilization of the specific interaction of replication termination sequences with their binding proteins in molecular biology applications.... Agent: Invitrogen Corporation C/o Intellevate 20070184466 - Detection, generation and uses of atherosclerosis-protective endothelium: The present invention is based upon the discovery that endothelial cells exposed to atheroprotectiveflow increase expression of the transcription factor KLF2 via a distinct flow-mediated signaling pathway and that this, in turn, modulates the activity of a series of genes that are responsible for maintaining the cells in an atherosclerosis-resistant... Agent: Law Office Of Michael A. Sanzo, LLC 20070184460 - Diagnostic assay for orientia tsutsugamushi by detection of responsive gene expression: The inventive subject matter relates to a method for the diagnosis of Orientia tsutsugamushi infection by measuring the increased or decreased expression of specific human genes following infection by microarray or polymerase chain reaction analysis. The method employs the creation of gene modulation profiles in patients suspected to be infected... Agent: Naval Medical Research Center Attn: (code 00l) 20070184455 - Evaluation of spectra: Systems, methods, products and analyzers that allow evaluation of spectra of molecules, including proteins, nucleic acids and small molecules, are provided. The spectra that may be evaluated by the systems, methods, products and analyzers include, for example, spectra collected by the techniques of NMR, mass spectrometry, infrared and RAMAN spectroscopy,... Agent: Foley Hoag, LLP Patent Group, World Trade Center West 20070184453 - Fret process: The present invention is directed to hybridization probes hybridizing adjacently to another at a target nucleic acid sequence, wherein one member of said hybridization probes comprises (i) a nucleotide sequence entity which is substantially complementary to the sequence of the target nucleic acid, (ii) a fluorescent entity being either a... Agent: Roche Molecular Systems Inc Patent Law Department 20070184436 - Generic capture probe arrays: The invention provides generic capture probe arrays, methods of making generic capture probe arrays, and methods of using these arrays to detect target analytes in samples.... Agent: Agilent Technologies, Inc. Legal Department, Dl429 20070184441 - Genetic markers of food allergy: A genetic marker of food allergy is disclosed. The marker comprises variants of IL-4 receptor alpha, IL13 and CD14.... Agent: Wood, Herron & Evans, LLP 20070184452 - Identification of a gene and mutation responsible for autosomal recessive congenital hydrocephalus: The invention relates to the polynucleotide sequence of the Hydrocephalus-associated gene (Hydin), the polypeptide it encodes and uses therefore. The invention also relates to the mutation in the Hydin gene that is responsible for the development of hydrocephalus. The invention provides for methods of diagnosing hydrocephalus and cilia dysfunction-related disorders.... Agent: Marshall, Gerstein & Borun LLP 20070184473 - Immunostimulatory compositions and methods: The invention provides conjugates comprising an immune co-stimulatory polypeptide and an antigen or infectious agent. The conjugates are useful for generating or enhancing an immune response against the antigen or infectious agent. The invention also provides immune cells modified with a conjuagte that are useful for generating or enhancing an... Agent: Foley And Lardner LLP Suite 500 20070184442 - Lafora's disease gene: A novel gene (EPM2B) that is mutated in humans and dogs with Lafora's disease is described.... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070184439 - Markers for detection of gastric cancer: Early detection of tumors is a major determinant of survival of patients suffering from tumors, including gastric tumors. Members of the GTM gene family can be over-expressed in gastric tumor tissue and other tumor tissue, and thus can be used as markers for gastric and other types of cancer. GTM... Agent: Gates & Cooper LLP Howard Hughes Center 20070184457 - Method for long range allele-specific pcr: The present invention is directed to a method and kit for determining the molecular haplotype of a gene in a diploid DNA sample. The method discriminates between two haplotypes on the basis of a difference of one or more nucleotides using allele-specific PCR amplification in combination with long range PCR,... Agent: Brinks Hofer Gilson & Lione Utah Office 20070184437 - Method for the detection of legionella-type bacteria: e 20070184449 - Method for the identification of a metabolic pathway family by means of positive selection: The invention relates to the direct selection of metabolic pathways having a determined function in the transformation of a substrate {Ai} into a target product {B}, which is of interest in the industrial, pharmaceutical or agri-food sectors. More specifically, the invention relates to the detection, within metagenomic libraries, of novel... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070184448 - Method of judging biological activity in bioremediation site and polynucleotide for detecting microorganism to be used therein: It is an object to provide a method whereby with respect to a microorganism present in an environment contaminated with tetrachloroethylene (PCE) and trichloroethylene (TCE), capability of the microorganism to degrade contaminants can be judged promptly. In order to achieve the above-described object, a biological activity judging method according to... Agent: Hamre, Schumann, Mueller & Larson P.C. 20070184472 - Method of purifying environmental dna and method of efficiently screening for protein-encoding gene from environmental dna: The method of purifying environmental DNA and the method of screening for a gene encoding a functional protein from environmental DNA are provided. DNA from a environmental sample is purified by recovering DNA from an environmental sample and allowing the thus recovered DNA to be subjected to gel filtration chromatography... Agent: Westerman, Hattori, Daniels & Adrian, LLP 20070184446 - Method of stretching single-stranded nucleic acid, single-stranded nucleic acid stretching system and dna chip: To verify an action of a high-frequency ac electric field on a single-stranded nucleic acid existing in an aqueous solution. This action is used to improve the efficiency of hybridization to which the single-stranded nucleic acid is subjected as a complementary strand. Provided are a method and system for stretching... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070184470 - Method to measure gene expression ratio of key genes: The invention is a method to determine the amounts, in particular the relative amounts, of nucleic acids in complex biological samples by means of real-time PCR. According to the invention the biological sample is systematically diluted and each dilution is studied by real-time PCR for all genes of interest. From... Agent: Gauthier & Connors, LLP 20070184454 - Methods and compositons for enhancing discrimination between perfect match and mismatch hybridization: Methods and compositions are provided for enhancing discrimination between perfect match and mismatch hybridization. The methods and compositions are particularly useful for genotyping analyses, gene expression analyses and diagnostic applications.... Agent: Affymetrix, Inc Attn: ChiefIPCounsel, Legal Dept. 20070184438 - Methods and nucleic acids for the analysis of colorectal cell proliferative disorders: Various aspects of the present invention provide novel diagnostic and prognostic methods for detecting, or for detecting and differentiating between or among colorectal cell proliferative disorders. Preferably, said colorectal cell proliferative disorders are selected from the group consisting of colorectal carcinoma, colon adenomas, and colon polyps. The inventive methods are... Agent: Davis Wright Tremaine, LLP 20070184468 - Methods for detecting and localizing dna mutations by microarray: This disclosure provides methods for detecting and localizing DNA mutations by DNA microarray. In various embodiments, the described methods include use of restriction endonuclease(s) and/or mismatch-recognition nuclease(s) to detect and/or localize mutations. In one representative method, reference and target DNA are digested using one or more restriction endonucleases, resultant DNA... Agent: Klarquist Sparkman, LLP 20070184465 - Methods for regulating hematopoiesis using cpg-oligonucleotides: The invention relates to methods for regulating hematopoiesis using CpG containing oligonucleotides. In particular, the invention relates to methods of treating thrombopoiesis and anemia by regulating hematopoiesis. The invention also relates to methods of regulating immune system remodeling by administering CpG oligonucleotides to control hematopoiesis.... Agent: Wolf Greenfield & Sacks, P.C. 20070184459 - Methods of inhibiting cancer growth by binding to nuclear receptors: The present invention provides methods for identifying agents useful for inhibiting cancer cells by binding to various nuclear receptor proteins, or to the genes or RNA encoding such proteins.... Agent: David Spolter Law Office Of David Spolter 20070184482 - Methods of random mutagenesis and methods of modifying nucleic acids using translesion dna polymerases: The invention is related generally to methods of amplifying or synthesizing or producing nucleic acid molecules using Translesion DNA polymerases. In particular, the invention relates to methods of introducing a random mutation into a nucleic acid and encoded polypeptide using Translesion DNA polymerases. The invention also relates to methods of... Agent: Invitrogen Corporation C/o Intellevate 20070184440 - Methods of screening for useful proteins: Objectives of the present invention are achieved through, for example, methods for identifying useful proteins by synthesizing a protein that randomly comprises a disulfide bond/disulfide bonds, via random introduction of cysteine residues into the amino acid sequence, and analyzing the function of the protein, wherein the method comprises the steps... Agent: Sterne, Kessler, Goldstein & Fox P.l.l.c. 20070184463 - Microfluidic device for purifying a biological component using magnetic beads: A method of purifying a biological component found in a biological sample by extracting the biological component from the biological sample. The method is performed using a microfluidic device having at least one well for receiving the biological sample and at least one channel for introducing and removing fluids. A... Agent: Caliper Life Sciences, Inc. 20070184461 - Novel polypeptide hormone phosphatonin: The present invention relates to a novel human protein called phosphatonin, and isolated polynucleotides encoding this protein. Also provided are vectors, host cells, antibodies, and recombinant methods for producing this human protein. The invention further relates to diagnostic and therapeutic methods useful for diagnosing and treating disorders related to this... Agent: Bozicevic, Field & Francis LLP 20070184474 - Process for amplifying dna: The present invention has an object of providing a process for amplifying DNA. The present invention provides a process for amplifying DNA, comprising providing a primer in which a compound such as LC-Red 705 is added to the 5′ terminus; and amplifying said target DNA fragment via PCR using said... Agent: Cohen, Pontani, Lieberman & Pavane 20070184478 - Process for detecting a plurality of target nucleic acids: A process and a kit for detecting a plurality of target nucleic acids are disclosed. In at least one embodiment, the process and/or kit includes using primers coupled to a semi-solid phase support.... Agent: Harness, Dickey & Pierce, P.L.C 20070184458 - Rna complexes methods of their production and sensors and analytical methods involving same: The invention includes RNA complexes comprising at least three monomeric units of an RNA molecule, each monomeric unit comprising an RNA polymer having first and second helical domains that have respective first and second binding sites, wherein the first binding sites are adapted to binding to one another and are... Agent: Roger A. Gilcrest 20070184464 - Rna probes: The invention is based in part on the generation of a double stranded RNA molecule substantially covering the whole transcribed region of a gene, and cleaving this using an RNA endonuclease to generate small RNA molecules which are already or may be subsequently labelled. The invention provides small labelled ribonucleic... Agent: Novartis Corporate Intellectual Property 20070184475 - Sequence determination by direct detection: A sequencing methodology is disclosed that allows a single DNA or RNA molecule or portion thereof to be sequenced directly and in substantially real time. The methodology involves engineering a polymerase and/or dNTPs with atomic and/or molecular tags that have a detectable property that is monitored by a detection system.... Agent: Robert W Strozier, P.l.l.c 20070184443 - Streptococcus pneumoniae knockout mutants: 91 genes have been identified in Streptococcus pneumoniae that, when knocked out, result in a lethal phenotype. A further 10 genes have been identified that, when knocked out, result in poor growth characteristics when cultured in the absence of blood. These 101 genes are essential to bacterial growth and are... Agent: Novartis Vaccines And Diagnostics Inc. 20070184467 - System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals: A system and method for determining the genetic data for one or a small set of cells, or from fragmentary DNA, where a limited quantity of genetic data is available. Genetic data for the target individual is acquired and amplified using known methods, and poorly measured base pairs, missing alleles... Agent: Zachary P. Demko 20070184456 - Use of microfluidic systems in the detection of target analytes using microsphere arrays: The invention relates generally to methods and apparatus for conducting analyses, particularly microfluidic devices for the detection of target analytes.... Agent: Knobbe Martens Olson & Bear LLP 20070184484 - Anti-abnormal type prion monoclonal antibody, process for producing the same, and immunoassay of abnormal type prion protein using the same: A monoclonal antibody which recognizes abnormal type prion protein alone is disclosed. By the present invention, an anti-abnormal type prion monoclonal antibody whose corresponding antigen is an abnormal type prion protein, and which does not substantially react with normal type prion protein was first provided. Since the corresponding antigen of... Agent: Birch Stewart Kolasch & Birch 20070184488 - Beta-secretase substrates and uses thereof: The present invention provides synthetic β-secretase peptide substrates useful in various assays for measuring β-secretase activity. Antibodies that recognize the synthetic substrates and uses of the antibodies in various assays are disclosed. The herein disclosed peptide substrates are hydrolyzed at rates substantially faster than the attendant Swedish mutant APP from... Agent: Merck And Co., Inc 20070184489 - Compartmentalised combinatorial chemistry by microfluidic control: The invention describes a method for the synthesis of compounds comprising the steps of: (a) compartmentalising two or more sets of primary compounds into microcapsules; such that a proportion of the microcapsules contains two or more compounds; and (b) forming secondary compounds in the microcapsules by chemical reactions between primary... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.C. 20070184487 - Compositions and methods for design of non-immunogenic proteins: Provided are methods for de novo design of proteins that are non-immunogenic when administered for therapeutic purposes. The methods involve protein design based on combinations of peptide fragments naturally encountered by the immune system.... Agent: Fish & NeaveIPGroup Ropes & Gray LLP 20070184492 - Delayed and diffused flow rapid confirmatory immunological testing apparatus and method: A self-contained apparatus using a gravitationally encouraged, interrupted, downward, diffusive and programmed flow of fluid to provide for rapid confirmatory immunological testing (“RCIT”) in, for example, a clinical, point-of-care setting. A fluid specimen such as blood, saliva or urine is deposited into a first chamber carrying a source of conjugate... Agent: Charmasson, Buchaca & Leach, LLP 20070184491 - Dendritic chemiluminescent substrates: Chemiluminescent substrate delivery systems comprising a conjugate a dendrimer and at least one chemiluminescent substrate are provided. The substrate delivery systems can also include a chemiluminescence enhancer. The dendrimer/chemiluminescent substrate conjugates can be used in kits including an enzyme capable of activating the chemiluminescent substrate to produce a peroxygenated intermediate... Agent: Merchant & Gould PC 20070184486 - Diagnosis or treatment of endothelial cell dysfunction related diseases: The present invention provides a method of determining the disease state of a disease or condition associated with EC dysfunction in a subject. An exemplary method screens for elevated profilin-1 levels as a marker for DVD and other vascular diseases such as atherosclerosis, cerebrovascular disease, CVD or peripheral vascular disease.... Agent: Weingarten, Schurgin, Gagnebin & Lebovici LLP 20070184485 - Method of diagnosing diseases relating to endometriosis: The level of a histamine-releasing factor (HRF) protein in a biological sample of a subject is measured and the HRF protein level is compared with that of a normal biological sample. A significantly higher HRF protein level compared with that of the normal biological sample is used as an indicator... Agent: Wenderoth, Lind & Ponack, L.L.P. 20070184490 - Neuronal nicotinic receptor ligands and their use: The invention relates to neuronal nicotinic receptor ligands, methods of identifying such ligands for neuronal nicotinic receptor modulation, particularly such ligands demonstrating beneficial side effect tolerability, and methods of using such neuronal nicotinic receptor ligands to provide pharmaceutical compositions and products.... Agent: Robert Deberardine Abbott Laboratories 20070184493 - Visualization and quantitation of cellular cytotoxicity using cell-permeable fluorogenic protease substrates and caspase activity indicator markers: This invention provides a non-radioactive assay to monitor and quantify the target-cell killing activities mediated by cytotoxic T lymphocytes (CTLs). This assay is predicated on the discovery that apoptosis pathway activation and, in particular, granzyme B activity, provides a measure of cytotoxic effector cell activity. In one embodiment, measurement of... Agent: Beyer Weaver LLP 20070184496 - Monocyte activation test better able to detect non-endotoxin pyrogenic contaminants in medical products: An improved monocyte activation test is described that is better able to detect non-endotoxin pyrogens in medical products, in which a sample is incubated with a monocyte-containing reagent in an assay system comprising at least one surface comprising polypropylene. The invention also concerns assay systems for use in these tests... Agent: Baxter Healthcare Corporation 20070184497 - Clinical diagnostic reagent and diagnostic method for testing infection of adult taenia solium and taenia saginata: Present invention provides a diagnostic means for testing infection of adult in humans parasitized with adult Taenia solium and Taenia saginata. It was found that a hydrophobic ligand binding protein (HLBP) derived from an adult separated from tapeworms has an antigenicity. The present invention is a clinical diagnostic reagent for... Agent: Drinker Biddle & Reath (dc) 20070184498 - Protein rs15a as a marker for colorectal cancer: The present invention relates to the diagnosis of colorectal cancer. It discloses the use of protein RS15A (ribosomal protein S15a) in the diagnosis of colorectal cancer. It relates to a method for diagnosis of colorectal cancer from a liquid sample, derived from an individual by measuring RS15A in said sample.... Agent: Roche Diagnostics Operations Inc. 20070184499 - Use of transthyretin as a biomarker for colorectal adenoma and/or carcinoma; method for detection and test system: The invention is directed to a method for detecting colorectal adenoma and/or colorectal carcinoma comprising the steps: a) providing an isolated sample material which has been taken from an individual, b) determining the level of transthyretin in said isolated sample material, and c)comparing the determined level of transthyretin with a... Agent: Raymond J Lillie Carella Byren Bain Gilfillan 20070184500 - Host receptor for pathogenic bacteria: A polypeptide, called Tir (for translocated intimin receptor, which is secreted by attaching and effacing pathogens, such as the enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli. These bacterial pathogens inserts their own receptors into mammalian cell surfaces, to which the bacterial pathogen then adheres to trigger additional host signaling events... Agent: Woodcock Washburn LLP 20070184494 - Assay method and apparatus: The present invention relates to an apparatus for use in an assay comprising: (a) at least one first receptacle comprising a fluid inlet and a fluid outlet, (b) a porous membrane, and (c) at least one analyte-specific binding agent, characterised in that said at least one analyte-specific binding agent is... Agent: Thomas W Adams Renner Otto Boisselle & Sklar 20070184504 - Assay for anti-ingap antibodies: A solid phase assay is used for detecting antibodies to INGAP104-118 peptide, a 15-amino acid peptide that is the biologically active portion of islet neogenesis associated protein (INGAP). The isotype of the antibodies to INGAP104-118 peptide can be determined. A kit can also be used in the detection of anti-INGAP104-118... Agent: Lott & Friedland, P.A. 20070184501 - Blocker reagent for reduction of heterophile interferences: A specific blocking reagent, method of manufacture thereof and methods of use are provided. The blocking reagent uses the specific antibody structure recognized by the target, e.g., analyte, and any interfering substances, e.g., heterophile molecules. The blocking reagent is, however, an inactivated form of the target-specific antibody. Thus, the blocking... Agent: Beckman Coulter, Inc. 20070184503 - Cytochrome c and leucine-rich alpha-2-glycoprotein-1 assays, methods and antibodies: The present invention relates generally to assays and methods involving Cytochrome c (Cyt c) and leucine-rich alpha-2-glycoprotein-1 (LRG), and related antibodies. In an embodiment, the invention includes a method of detecting LRG in a sample, the method including disposing Cyt c on a substrate; contacting the sample with the Cyt... Agent: Pauly, Devries Smith & Deffner, L.L.C. 20070184505 - Method for stabilization of proteins in solution: The present invention relates to a method for stabilization of analytes in solutions of solubilized body samples. The method comprises the steps of solubilizing the body samples obtained from a subject in a suitable sample medium and stabilizing said body sample contained within the sample medium by heating said sample... Agent: Howrey LLP 20070184502 - Method of diagnosing sjogren's syndrome: The invention relates to a method of diagnosing Sjögren's syndrome and to a suitable kit of reagents.... Agent: Millen, White, Zelano & Branigan, P.C. 20070184506 - Immunological test element with improved control zone: The invention concerns a test element for carrying out an immunological sandwich test for determining an analyte from a liquid sample containing a reagent zone or conjugate zone which contains a conjugate of an analyte binding partner and a label which can be detected directly or indirectly by visual, optical... Agent: Roche Diagnostics Operations Inc. 20070184507 - Methods for predicting outcome in traumatic brain injury: The invention describes methods for predicting outcome for patients suffering from traumatic brain injury (TBI) by evaluating levels of markers commonly associated with cellular damage in bodily fluids. Utilization of such methods improves diagnosis and treatment of patients suffering from traumatic brain injury, thus potentially minimizing and/or eliminating long-term adverse... Agent: Mchale & Slavin, P.A. 20070184508 - Method of evaluating patient hemostasis: A hemostasis analyzer, such as the Thrombelastograph® (TEG®) hemostasis analyzer is utilized to measure continuously in real time, the hemostasis process from the initial fibrin formation, through platelet-fibrin interaction and lysis to generate blood hemostasis parameters. The measured blood hemostasis parameters permit evaluation of a patient hemostasis condition.... Agent: Marshall, Gerstein & Borun LLP 20070184509 - Methods for transferases: Methods for detecting transferase activity of a sample are provided. Transferase activity detected includes kinase and phosphatase activity. The method includes providing a substrate having a reporter compound conjugated thereto. A quantity of the substrate is added to a solution containing the sample. The sample is incubated with the substrate... Agent: Whyte Hirschboeck Dudek S.c. 20070184510 - Method and apparatus for monitoring enzyme mixtures: The present invention provides a method for simultaneously detecting the presence of at least two enzymes in a sample. The method includes the steps of: i) providing a first substrate for a first enzyme, the first substrate being labeled with a first fluorophore; ii) providing a second substrate for a... Agent: Patent Administrator Katten Muchin Rosenman LLP 20070184511 - Method for diagnosing a person having sjogren's syndrome: Described is a method for diagnosing a person having or being at risk of developing Sjögren's Syndrome and excluding patients with symptoms similar to Sjögren's Syndrome but with a different etiology, comprising the following steps: providing a sample of a body fluid or tissue from said person, said sample containing... Agent: Lawson & Weitzen, LLP 20070184514 - Methods and compositions for detecting active components using bioluminescent bacteria and thin-layer chromatography: Disclosed are methods and compositions for the detection of compounds.... Agent: Needle & Rosenberg, P.C. 20070184513 - Substrates for beta-lactamase and uses thereof: in which one of X and Y is a fluorescent donor moiety and the other is a quencher (which may or may not re-emit); R′ is selected from the group consisting of H, lower (i.e., alkyl of 1 to about 5 carbon atoms) and (CH2)nOH, in which n is 0... Agent: Townsend And Townsend And Crew, LLP 20070184515 - Method to determine 3-d elemental composition and structure of biological and organic materials via atom probe microscopy: Disclosed are methods to prepare a specimen for microanalysis, the specimens so prepared, and methods to analyze the specimens by atom probe microscopy. The specimens are prepared by embedding a specimen within an electrically conductive matrix to yield an embedded specimen; and then forming regions on the embedded specimen into... Agent: Perkins Coie LLP Patent-sea 20070184517 - Glycoprotein synthesis: Methods for making glycoproteins, both in vitro and in vivo, are provided. One method involves incorporating an unnatural amino acid into a protein and attaching one or more saccharide moieties to the unnatural amino acid. Another method involves incorporating an unnatural amino acid that includes a saccharide moiety into a... Agent: Quine Intellectual Property Law Group, P.C. 20070184516 - Method for the poduction of cyclic molecules: The invention at hand describes a method for the cyclization of peptides and proteins in which linear thioesters serve as substrates. The cyclization is catalyzed by thioesterase domains of NRPS or PKS cyclases. The substrates according to the present invention are composed of one linear peptide on which a charge-stabilized... Agent: Clark & Brody 20070184518 - Stabilized proteins: Isolated polypeptides or polypeptide chains are modified by di-tyrosine cross-linking such that they retain at least one functional activity. In one embodiment, the isolated polypeptide or polypeptide chains comprise at least one di-tyrosine cross-link, wherein at least one tyrosine of the di-tyrosine cross-link originates from a point mutation to tyrosine,... Agent: Wilmer Cutler Pickering Hale And Dorr LLP 20070184524 - 3-hydroxypropionic acid and other organic compounds: Methods and materials related to producing 3-HP as well as other organic compounds are disclosed. Specifically, isolated nucleic acids, polypeptides, host cells, and methods and materials for producing 3-HP and other organic compounds are disclosed.... Agent: Cargill, Incorporated 20070184522 - Cell death modulation via antagonists of fasl and fas activation: The invention provides a polypeptide that attenuates the activation of Fas, TNFR1, or both. The polypeptide can be used to treat conditions associated with dysregulation of the cell death or inflammatory pathway and can be formulated into pharmaceutical compositions for medical or veterinary use.... Agent: Leydig Voit & Mayer, Ltd 20070184526 - Functional influenza virus like particles (vlps): The present invention discloses and claims virus like particles (VLPs) that express and/or contains seasonal influenza virus proteins, avian influenza virus proteins and/or influenza virus proteins from viruses with pandemic potential. The invention includes vector constructs comprising said proteins, cells comprising said constructs, formulations and vaccines comprising VLPs of the... Agent: Cooley Godward Kronish LLP Attn: Patent Group 20070184531 - Gene encoding cyclododecanone monooxygenase: The invention relates to a new strain of Pseudomonas putida (designated as HI-70) and to the isolation, cloning, and sequencing of a cyclododecanone monooxygenase-encoding gene (named cdnB) from said strain. The invention also relates to a new cyclododecanone monooxygenase and to a method of use of the cyclododecanone monooxygenase-encoding gene.... Agent: David S. Resnick Nixon Peabody LLP 20070184528 - Induction and stabilization of enzymatic activity in microorganisms: The present invention is directed to methods for inducing desired activity in enzymes or microorganisms capable of producing the enzymes. The invention is further directed to methods of stabilizing activity in microorganisms. In specific embodiments, the invention provides methods for inducing and stabilizing nitrile hydratase activity, amidase activity, and asparaginase... Agent: Alston & Bird LLP 20070184530 - Long-acting veterinary polypeptides and methods of producing and administering same: A polypeptide and polynucleotides comprising at least two carboxy-terminal peptides (CTP) of chorionic gonadotrophin attached to a non-human peptide-of-interest are disclosed. Pharmaceutical compositions comprising the non-human polypeptides and polynucleotides of the invention and methods of using both human and non-human polypeptides and polynucleotides are also disclosed.... Agent: Pearl Cohen Zedek Latzer, LLP 20070184529 - Mammalian cell culture process: The present invention relates to novel process for the preparation of glycoproteins by mammalian-cell culture wherein the sialic acid content of the glycoprotein' produced is controlled over a broad range of values by manipulating the cell culture environment. The invention provides for processes in which the sialic acid content of... Agent: Heller Ehrman LLP 20070184523 - Method for making multispecific antibodies having heteromultimeric and common components: The invention relates to a method of preparing heteromultimeric polypeptides such as bispecific antibodies, bispecific immunoadhesins and antibody-immunoadhesin chimeras. The invention also relates to the heteromultimers prepared using the method. Generally, the method provides a multispecific antibody having a common light chain associated with each heteromeric polypeptide having an antibody... Agent: Heller Ehrman LLP 20070184525 - Method of producing proteins: The present invention provides a method for efficiently producing an industrially useful protein in coryneform bacteria, and more particularly, a method for efficiently producing a protein for which secretion was difficult using conventional protein secretion pathways. In particular, the present invention provides a method for efficiently producing heterologous proteins comprising... Agent: Cermak & Kenealy LLP Acs LLC 20070184527 - Methods for production of proteins: The current invention provides methods for producing a polypeptide as inclusion bodies in bacterial host cells. The present methods are carried out by forming a gene construct comprising the genetic sequence encoding a polypeptide operatively linked to that of an inclusion partner protein, such as E. coli thioredoxin or a... Agent: Invitrogen Corporation C/o Intellevate 20070184521 - Novel phytase and gene: The invention relates to a novel phytase excreted by an isolated fungal strain, nucleic acids encoding the phytase, prokaryotic and eukaryotic host cells transformed by the nucleic acids, and methods for producing the phytase.... Agent: Davis, Brown, Koehn, Shors & Roberts, P.C. The Financial Center 20070184519 - Peptides, polypeptides, and proteins of reduced immunogenicity and methods for their production: The subject invention provides peptides, polypeptides, proteins and/or antibodies of reduced immunogenicity. Also provided are methods of reducing the immunogenicity of peptides, polypeptides, proteins and/or antibodies. In certain embodiments, the immunogenicity of therapeutic peptides, polypeptides, proteins, and/or antibodies such as hormones, growth factors, and cytokines is reduced.... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070184520 - Reduction of spontaneous mutation rates in cells: The present invention relates to processes for reducing the spontaneous mutation frequencies in cells or organisms and for producing such cells and organisms, to cells and/or organisms with reduced spontaneous mutation frequencies and to processes for the generation of expression systems for proteins, for the production of proteins and for... Agent: Glaxosmithkline Corporate Intellectual Property, Mai B475 20070184532 - Method for producing l-histidine using bacteria of enterobacteriaceae family: A method is provided for producing L-histidine using bacterium of the Enterobacteriaceae family, wherein the L-amino acid productivity of said bacterium is enhanced by enhancing an activity of the transaldolase encoded by the talB gene.... Agent: Cermak & Kenealy LLP Acs LLC 20070184533 - Microbial transformation method for the preparation of an epothilone: A microbial method for the preparation of an epothilone containing a terminal hydroxyalkyl group, comprising contacting at least one epothilone having a terminal alkyl group with an enzyme or microorganism capable of catalyzing the selective hydroxylation of said alkyl group to a hydroxyalkyl group, and effecting said hydroxylation.... Agent: Louis J. Wille Bristol-myers Squibb Company 20070184534 - Microbial production of l-ascorbic acid: The present invention discloses an isolated polynucleotide molecule derived from a polynucleotide encoding a polypeptide having L-sorbosone dehydrogenase activity comprising a partial nucleotide sequence of at least 20 consecutive nucleotides of SEQ ID NO:1. The present invention further relates to a process for the production of L-ascorbic acid in high... Agent: Stephen M Haracz Bryan Cave 20070184535 - Process for preparing unsaturated amides and carboxylic acids: A process of producing an amide from a nitrile by the action of a nitrile hydratase enzyme or ammonium salt of an ethylenically unsaturated carboxylic acid from an amide by the action of amidase respectively in which enzymes are obtainable from a microorganism of the Dietzia genus.... Agent: Ciba Specialty Chemicals Corporation Patent Department 20070184536 - Process of producing polymers: A process for preparing a polymer of an ethylenically unsaturated monomer, in which the monomer is obtainable from a biocatalysed reaction or a fermentation process, and wherein the monomer contains cellular material and/or components of a fermentation broth, forming the polymer by polymerising the ethylenically unsaturated monomer or a monomer... Agent: Ciba Specialty Chemicals Corporation Patent Department 20070184537 - Method for the linkage of bifunctional chelating agents and (radioactive) transition metal complexes to proteins and peptides: The present invention relates to a method for radioactive labeling of a protein or peptide, by providing a protein or peptide having at least one glutamine or lysine residue; adding a metal chelating agent having at least one lysine or glutamine residue, respectively, which metal chelating agent is optionally complexed... Agent: Siemens Schweiz Ag I-47, Intellectual Property 20070184538 - Mortierella alpina lysophosphatidic acid acyltransferase homolog for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms: Lysophosphatidic acid acyltransferase (LPAAT) participates in the second step of oil biosynthesis and is expected to play a key role in altering the quantity of long-chain polyunsaturated fatty acids produced in oils of oleaginous organisms. The present application provides a nucleic acid fragment (identified as “LPAAT2”) isolated from Mortierella alpina... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070184539 - Mutant e. coli strain with increased succinic acid production: The invention relates to a mutant strain of bacteria, which either lacks or contains mutant genes for several key metabolic enzymes, and which produces high amounts of succinic acid under anaerobic conditions.... Agent: Baker & Mckenzie LLP 20070184540 - Metabolically engineered bacterial strains having enhanced 2-keto-d-gluconate accumulation: The present invention relates to a method of altering bacterial host cells to accumulate 2-keto-D-gluconic acid (2-KDG) by inactivating an endogenous membrane bound 2-keto-D-gluconate dehydrogenase (2-KDGDH), which prior to inactivation catalyzed the conversion of 2-KDG to 2,5-diketogluconate (2,5-DKG).... Agent: Genencor International, Inc. 20070184541 - Corn fractionation method: An improved method for processing corn into ethanol and other valuable co-products. The invention generally involves a multi-step process which produces germ (or oil), protein, and feed yeast as its co-products while maintaining or enhancing the provision of fermentable sugar to ethanol fermentation. This is accomplished by fundamentally altering the... Agent: Gray, Plant, Mooty, Mooty & Bennett, P.A. 20070184542 - Method, a device and an additive for digesting organic matter: A method of producing biogas by anaerobic digestion of organic matter is disclosed. The method includes, in at least one embodiment, adding cobalt, iron and hydrochloric acid to an organic matter; bringing the organic matter in contact with biogas-producing bacteria; and digesting the organic matter under anaerobic conditions in a... Agent: Harness, Dickey & Pierce, P.L.C 20070184543 - Induction and stabilization of enzymatic activity in microorganisms: The present invention is directed to methods for inducing desired activity in enzymes or microorganisms capable of producing the enzymes. The invention is further directed to methods of stabilizing activity in microorganisms. In specific embodiments, the invention provides methods for inducing and stabilizing nitrile hydratase activity, amidase activity, and asparaginase... Agent: Alston & Bird LLP 20070184544 - Culturing circular ssdna viruses for the production of vaccines: The present invention relates to the use of interferon in the in vitro cultivation of animal circular ssDNA virus such as Porcine Circovirus 2 or human TT virus in an animal cell line. Increased titres of animal circular ssDNA virus are obtained by addition of interferons or agents which ensure... Agent: Clark & Elbing LLP 20070184545 - Portable preservation apparatus for a donor organ: A portable preservation apparatus of the cold storage type for a donor organ, comprising a cooling box provided with an organ chamber for receiving a donor organ in preservative fluid and a lid, wherein, on the side which operatively faces the organ chamber, the lid is provided with a connector... Agent: Pearne & Gordon LLP 20070184546 - Systems and methods for automated proteomics research: A robotic laboratory automation workcell preferably includes instruments and equipment that are integrated by using conveyor or track elements and a robotic arm. The automation workcell is controlled by a centralized or main controller or processor using specialized control software to automate the proteomics research process. The automated workcell is... Agent: Lerner, David, Littenberg, Krumholz & Mentlik 20070184547 - Polynucleotide sample preparation device: Methods and systems for preparing polynucleotide samples are disclosed. The invention includes a microfluidic system for converting a sample containing one or more polynucleotides into a form suitable for analyzing the polynucleotides, comprising: a cartridge receiving element, an insertable and removable cartridge, a heating element configured to heat one or... Agent: Fish & Richardson P.C. 20070184548 - Device for carrying out chemical or biological reactions: The invention relates to a device for carrying out of chemical or biological reactions with a reaction vessel receiving element for receiving a microtiter plate with several reaction vessels, wherein the reaction vessel receiving element has several recesses arranged in a regular pattern to receive the respective reaction vessels, a... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070184550 - Artificial cartilage tissue and production method thereof: To obtain an artificial cartilage tissue having high strength and biocompatibility. There is provided an artificial cartilage tissue which is substantially free of heterologous protein and is substantially free of scaffold derived from non-cartilage-derived cells, but contains mammalian cartilage-derived cells and an extracellular matrix formed by the cartilage-derived cells, where:... Agent: Young & Thompson 20070184549 - Method of inducing fenestrae: The present invention relates to a method of inducing fenestrae in an endothelial cell line. More particularly, the present invention relates to inducing fenestrae in a bEND5 cell line or a Py4.1 cell line utilizing latrunculin A or cytochalasin B as an inducing agent.... Agent: (osi) Eyetech, Inc. 08/02/2007 > patent applications in patent subcategories.20070178437 - Methods and compositions for the production of high concentration alloxazine solutions: Methods are provided for preparation of compositions having an enhanced level of soluble alloxazine, as compared to compositions prepared using conventional techniques. Compositions and a riboflavin form having higher solubility in solution is also provided.... Agent: Dorsey & Whitney, LLP Intellectual Property Department 20070178450 - Method and apparatus for determining level of microorganisms using bacteriophage: A predetermined amount of parent bacteriophage capable of infecting a target microorganism is added to a sample to create a bacteriophage-exposed sample; the sample is incubated for a defined incubation time and assayed to determine the level of a bacteriophage or bacterial marker in the sample; and if the measured... Agent: Patton Boggs LLP 20070178480 - Extended dynamic range reading of chemical arrays: Methods of reading chemical arrays are provided. Aspects of the methods include reading an array at a first and second detector gain setting to produce linked data sets of an array, where each reading may be made using a different detector gain setting. Aspects of the methods further include extracting... Agent: Agilent Technologies Inc. 20070178507 - Method and apparatus for detection of molecules using nanopores: A molecular analysis device comprises a molecule sensor and a nanopore that passes through, partially through, or substantially near the molecule sensor. The molecule sensor may comprise a single electron transistor including a first terminal, a second terminal, and a nanogap or at least one quantum dot positioned between the... Agent: Hewlett Packard Company 20070178513 - Nucleic acid amplification apparatus and method: A nucleic acid amplification apparatus for amplifying a target nucleic acid derived from living organism, comprising: a measurement unit for amplifying the target nucleic acid in a measuring sample prepared from the living organism, and measuring a product of the amplification of the target nucleic acid; a measurement value obtaining... Agent: Sughrue Mion, PLLC 20070178434 - Biological material and methods and solutions for preservation thereof: A preservation solution for preserving a biological material at a low temperature including one or more polyphenols, and a method for preserving a biological material are provided. The method includes adding the preservation solution to a biological material, cooling the biological material and storing it under appropriate storing conditions. The... Agent: Nath & Associates 20070178435 - Composition for maintaining organ and cell viability: The present invention is directed to methods of preserving mammalian heart, ex vivo. Nanoparticle compositions for carrying out the invention are also disclosed.... Agent: Lucas & Mercanti, LLP 20070178436 - Method of inactivating virus in circular blood and its applications in treating viral diseases: The present invention relates to a method for illuminating the viruses in a circulatory blood, comprising the following steps of: 1) Adding an anticoagulant into a whole blood source and establishing a circulation system for the whole blood source; 2) Withdrawing the whole blood with the anticoagulant into a plasma-separating... Agent: Woodcock Washburn LLP 20070178438 - Apolipoprotein c-1 induced apoptosis: The present invention provides methods and compositions for identifying compounds which inhibit ApoCI and which are useful in the treatment or prevention of atherosclerosis, plaque rupture, apoptosis, or myocardial infarction. The invention further provides methods for treating subjects suffering from or at risk of developing atherosclerosis, plaque rupture, apoptosis, or... Agent: Edwards Angell Palmer & Dodge LLP 20070178439 - Control of es cell self renewal and lineage specification, and medium therefor: Self renewal of pluripotent cells in culture is promoted using a combination of an Id gene product and an activator of a gp130 downstream signalling pathway.... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070178440 - Inhibitors of gob-4 protein as asthma therapeutics: Methods of screening for agents for treating asthma are provided. The methods involve screening for agents that decrease the production or activity of a Gob-4 protein that has been discovered herein to play a role in producing the symptoms and pathological complications involved in asthma. Methods of treating asthma, as... Agent: Wilmerhale/wyeth 20070178442 - Method for diagnosing liver fibrosis: A method for the detection of the presence and/or the severity of a liver disease in a patient comprising measuring in an isolated sample TIMP-1 (tissue inhibitor of metalloproteinase I), ferritin, at least one additional parameter selected from the group consisting of A2M (alpha-2-macroglobulin) and PI (prothrombin index) and optionally... Agent: Roche Diagnostics Operations Inc. 20070178443 - Method for diagnosing liver fibrosis: The invention concerns a method for the detection of the presence and/or the severity of a liver disease in a patient comprising measuring in an isolated sample TIMP-1 (Tissue Inhibitor of Metalloproteinase I), A2M (a-2-macroglobulin), PLT (number of blood plateletes, PI (prothrombin index), optionally at least one additional parameter selected... Agent: Roche Diagnostics Operations Inc. 20070178441 - Method of drug interaction: A method of interacting a drug with an in vivo system having multiple cell types to model a drug interaction with a living organism in a cell culture tool having a flat plate segregated into multiple chamber units, each of the chamber units having a chamber wall surrounding multiple wells... Agent: Kevin J. Mcneely, Esq. 20070178449 - Cultispot assay: The invention provides a method for detecting the production by cells in a sample of one or more analyte, which method comprises: (a) providing (i) a first binding protein which specifically binds to a first analyte; and (ii) optionally a second binding protein which specifically binds to second analyte; wherein... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070178446 - Measuring contamination: Disclosed is a convenent sample preparation method for a medium suspected of containing contaminants, the method comprising a) passing a known volume of said medium through a filter from an influent side to an effluent side thereby concentrating the contaminants on the influent side of the filter, b) contacting the... Agent: Harness, Dickey & Pierce, P.L.C 20070178447 - Method for decreasing interference in results of immunochemical methods: Methods and materials are provided for decreasing or eliminating interference from molecules resulting from upstream immunochemical procedures, such as Immunoprecipitation, that employ an Immunoglobulin Binding Molecule (an IBM, e.g., Protein A) in subsequent downstream methods, such as Western Blot. An effective amount of a ligand of the IBM is used... Agent: Burleson Cooke L.L.P. 20070178445 - Methods for the detection of nucleic acid differences: The invention provides methods permitting the detection of small amounts of different nucleic acids in the presence of an excess amount of wild-type nucleic acids. Also provided herein are method so detecting infectious disease minority variants, methods of forensic identification, methods of diagnosing cancer and monitoring disease progress.... Agent: Edwards Angell Palmer & Dodge LLP 20070178444 - Screening method for a ribonuclease h in hibitor of a reverse transcriptase: (wherein, Y hybridizes to X of a template, N is 13-19 mer DNA, RNA or a chimeric nucleic acid, R is RNA, W is DNA or a chimeric nucleic acid, X is 15 mer or more DNA, RNA or a chimeric nucleic acid, Y is a same length DNA, RNA... Agent: Birch Stewart Kolasch & Birch 20070178448 - Selective posttranslational modification of phage-displayed polypeptides: The invention relates to posttranslational modification of phage-displayed polypeptides. These displayed polypeptides comprise at least one unnatural amino acid, e.g., an aryl-azide amino acid such as p-azido-L-phenylalanine, or an alkynyl-amino acid such as para-propargyloxyphenylalanine, which are incorporated into the phage-displayed fusion polypeptide at a selected position by using an in... Agent: Quine Intellectual Property Law Group, P.C. 20070178515 - 3714, 16742, 23546, and 13887 novel protein kinase molecules and uses therefor: The invention provides isolated nucleic acids molecules, designated 3714, 16742, 23546, or 13887 nucleic acid molecules, which encode novel protein kinases. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing 3714, 16742, 23546, or 13887 nucleic acid molecules, host cells into which the expression vectors have been... Agent: Millennium Pharmaceuticals, Inc. 20070178487 - Active-site engineering of nucleotidylyltransferases and general enzymatic methods for the synthesis of natural and \"unnatural\" udp- and tdp-nucleotide sugars: The present invention provides mutant nucleotidylyl-transferases, such as Ep, having altered substrate specificity; methods for their production; and methods of producing nucleotide sugars, which utilize these nucleotidylyl-transferases. The present invention also provides methods of synthesizing desired nucleotide sugars using natural and/or modified Ep or other nucleotidyltransferases; and nucleotide sugars sythesized... Agent: Godfrey & Kahn, S.c. 20070178493 - Alterations in the copy number of the sult1a1 gene: Methods are described for determining sulfonator status of a patient and determining dosages of drugs based on copy number of the SULT1A1 gene.... Agent: Fish & Richardson P.C. 20070178461 - Cancer diagnostic method: To provide a cancer diagnostic method capable of detecting evidence presenting the presence of cancer cells in early stage cancer. Cancer diagnostic method comprised of; a process to obtain the sample containing RNA only as a somatic cell and cancer cell fraction from body fluid and a process having a... Agent: Armstrong, Kratz, Quintos, Hanson & Brooks, LLP 20070178466 - Composition for deaminating dna and method of detecting methylated dna: (1) A sulfite composition having a sulfite concentration of more than 6.2 M, (2) a method for deaminating DNA using a sulfite composition described in (1), (3) a method for detecting methylated DNA using a sulfite composition described in (1), (4) a kit for deaminating DNA or for detecting methylated... Agent: Leydig Voit & Mayer, Ltd 20070178489 - Compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis: The present invention relates to polypeptides, compositions and methods for enhancing synthesis of nucleic acid molecules. In a preferred aspect, the invention relates to inhibition or control of nucleic acid synthesis, sequencing or amplification. Specifically, the present invention discloses polypeptides having affinity for double-stranded and/or single-stranded nucleic acid molecules and/or... Agent: Invitrogen Corporation C/o Intellevate 20070178491 - Compositions and methods for synthesizing nucleic acids: Disclosed are compositions preferably for use in nucleic acid synthesis that include one or more anti-reverse transcriptase (RT) antibodies and/or one or more anti-DNA polymerase (DNAP) antibodies and/or single strand binding proteins (SSBs). Some of the disclosed compositions include one or more anti-DNAP antibodies and/or one or more anti-RT antibodies... Agent: Invitrogen Corporation C/o Intellevate 20070178486 - Compositions and methods for the diagnosis and treatment of tumor: The present invention is directed to compositions of matter useful for the diagnosis and treatment of tumor in mammals and to methods of using those compositions of matter for the same.... Agent: Genentech, Inc. 20070178454 - Context sensitive paralell optimization of zinc finger dna binding domains: The present invention relates to methods of identifying multi-finger Zf polypeptides that bind to a sequence of interest. Zf polypeptides identified using the methods described herein can have affinity and specificity for their target sites that is superior to those produced by alternative methods.... Agent: Edwards Angell Palmer & Dodge LLP 20070178476 - Detection of oligonucleotides by dual hybridization: The invention provides methods and compositions for detecting and/or quantifying modified nucleic acid oligonucleotides. These methods and compositions are useful for detecting and quantifying diagnostic and/or therapeutic synthetic modified oligonucleotides, such as aptamers, RNAi, siRNA, antisense oligonucleotides or ribozymes in a biological sample.... Agent: (osi) Eyetech, Inc. 20070178479 - Direct multiplex characterization of genomic dna: The invention is directed to novel methods of multiplexing nucleic acid reactions, including amplification, detection and genotyping. The invention relies on the use of precircle probes that are circularized in the presence of the corresponding target nucleic acids, cleaved, and then amplified.... Agent: Fish & NeaveIPGroup Ropes & Gray 20070178473 - Drug discovery methods: Methods for identifying disease-related pathways that can be used to identify drug discovery targets, to identify new uses for known drugs, to identify markers for drug response, and related purposes.... Agent: Wilson Sonsini Goodrich & Rosati 20070178467 - Gm1 promoter and use thereof: The present invention relates to a polynucleotide comprising a nucleotide sequence of a promoter region of a gene encoding α subunit Gm1 of trimeric G-protein, more specifically, said polynucleotide, wherein the nucleotide sequence of a promoter region is, for example, any of the following nucleotide sequences (1) and (2): (1)... Agent: Akin Gump Strauss Hauer & Feld L.L.P. 20070178490 - Hega endonuclease: An endonuclease which recognizes a specific nucleotide sequence, a gene coding for the endonuclease, a recombinant vector comprising the gene, a host cell comprising the vector, a process for producing the endonuclease, and methods of using the endonuclease are described.... Agent: Howrey LLP 20070178469 - High efficiency gene transfer and expression in mammalian cells by a multiple transfection procedure fo mar sequences: The present invention relates to purified and isolated DNA sequences having protein production increasing activity and more specifically to the use of matrix attachment regions (MARs) for increasing protein production activity in a eukaryotic cell. Also disclosed is a method for the identification of said active regions, in particular MAR... Agent: Joyce Von Natzmer Hvp LLP 20070178492 - Human tumor necrosis factor receptor polynucleotides: Tumor necrosis factors and their receptors have proven usefulness in both basic research and as therapeutics. The present invention provides a new human tumor necrosis factor receptor designated as “Ztnfr12.”... Agent: Zymogenetics, Inc. Intellectual Property Department 20070178497 - Identification: The invention provides a method for obtaining additional information about DNA mixtures arising from a variety of sources and/or a variety of concentrations. In particular, the invention provides a method for indicating the likelihood that a DNA mixture arose from sources of a defined type where: the DNA mixture is... Agent: Merchant & Gould PC 20070178503 - In-situ genomic dna chip for detection of cancer: An in situ genomic DNA chip can be used directly on clinical specimens in situ for detecting, diagnosing and/or predicting diseases, especially diseases characterized by a genetic aberration such as cancers, by simultaneous detection of one or more unique genetic aberrations using one or more multiple specific probes. The present... Agent: Dla Piper US LLP Attn: Patent Group 20070178518 - Kits and methods for assessing skin health: The invention relates to kits and methods for assessing skin health for a human and the human's susceptibility to skin disorders. The methods involve assessing occurrence in the human's genome of one or more polymorphisms (e.g., single nucleotide polymorphisms) that occur in one or more genes associated disclosed herein and... Agent: Duane Morris, LLPIPDepartment 20070178481 - Kits for multiplexed nucleic acid analysis by capture of single-stranded dna produced from double-stranded target fragments: A method of fragmentation of double stranded DNA is disclosed for use in nucleic acid analysis, notably in the multiplexed analysis of polymorphisms and mutations. The method produces a multiplicity of labeled sense and anti-sense fragments which are not complementary, and thus do not significantly re-anneal under conditions suitable for... Agent: Eric P. Mirabez 20070178519 - Length determination of nucleic acid repeat sequences by discontinuous primer extension: Disclosed is a method for determining the number of repeat units in a repeat region of a target nucleic acid. In a first aspect, the method of the invention includes the steps of annealing a primer to a target nucleic acid; performing a first primer extension reaction using a first... Agent: Kalow & Springut LLP 20070178509 - Metastatic breast and colon cancer regulated genes: Gene sequences as shown in SEQ ID NO:1-18 have been discovered and isolated, and found to be significantly associated with metastatic spread of breast and colon cancer cells to other organs. Methods are provided for determining the risk of metastasis of a breast or colon tumor, which involve determining whether... Agent: Novartis Vaccines And Diagnostics Inc. 20070178453 - Method for amplification of nucleic acids of low complexity: The invention describes a method for amplifying nucleic acids, such as DNA with means of an enzymatic amplification step, such as a polymerase chain reaction, specified for template nucleic acids of low complexity, e.g. pre-treated DNA, like but not limited to DNA pre-treated with bisulfite is disclosed. The invention is... Agent: Kriegsman & Kriegsman 20070178452 - Method for analyzing a nucleic acid: Disclosed is a method in which DNA sequences derived from microsome-associated mRNA sequences in a mixed sample or in an arrayed single sequence clone can be determined and classified without sequencing. The methods make use of information on the presence of carefully chosen target subsequences, typically of length from 4... Agent: Jenell Lawson Intellectual Property 20070178482 - Method for preparing single-stranded dna: The invention is a method and a kit for preparing single-stranded DNA from double-stranded DNA and the purification of single-stranded DNA derived from double-stranded DNA. A single-stranded-DNA binding substance is used in combination with a double-strand-specific endonuclease for the removal of undesired double-stranded DNA from a single-stranded DNA preparation and... Agent: Alston & Bird LLP 20070178460 - Method for the identification of suitable fragmentation sites in a reporter protein: The invention concerns a combinatorial method for the generation of new split-protein sensors, and its application towards the (β/αa)8-barrel enzyme N-(5′-phosphoribosyl)-anthranilate isomerase Trp1p from Saccharomyces cerevisiae is demonstrated. The generated split-Trp protein sensors allow for the detection of protein-protein interactions in the cytosol as well as the membrane by enabling... Agent: Shoemaker And Mattare, Ltd 20070178508 - Method of effecting lysis of acid-fast bacteria and method of performing gene amplification or detection therewith: A method of effecting lysis of acid-fast bacteria, comprising heating acid-fast bacteria in a liquid containing a non-ionic surfactant at a temperature of below the boiling point of the liquid. This method enables accomplishing secure lysis of acid-fast bacteria in a simple manner within a short period of time without... Agent: Hamre, Schumann, Mueller & Larson, P.C. 20070178510 - Methodologies for the diagnosis and treatment of gastroesophageal reflux disease: A novel methodology for diagnosing and treating gastroesophageal reflux disease is provided. These methodologies are based on the discovery of a new disease mechanism called hereinafter “reflux carditis”, which is a novel mechanistic view of reflux disease that recognizes cardiac mucosa, which has heretofore been regarded as a normal epithelium... Agent: Christie, Parker & Hale, LLP 20070178506 - Methods and compositions for determining methylation profiles: Methods and compositions for determining the methylation profile of individuals and using the profiles to identify clones with desired traits.... Agent: Townsend And Townsend And Crew, LLP 20070178495 - Methods and compositions for identifying bacteria associated with bacterial vaginosis: The present invention provides methods and compositions for identifying bacteria associated with bacterial vaginosis and diagnosing bacterial vaginosis in a subject.... Agent: Myers Bigel Sibley & Sajovec 20070178455 - Methods and compositions for optical detection of single-stranded polynucleotides: The invention relates to products and methods for determining, localizing, and quantitating single-stranded polynucleotides. The methods of the invention include the use of Gp32F protein and mutant Gp32F protein to monitor polynucleotide reactions such as DNA replication, annealing, and excision and to determine single-stranded polynucleotide structures such as gaps, flaps,... Agent: Wolf Greenfield & Sacks, P.C. 20070178504 - Methods and marker combinations for screening for predisposition to lung cancer: The present invention relates to certain immunoreactive polypeptides, methods for aiding in the diagnosis of lung cancer in a subject and kits for performing said methods.... Agent: Dykema Gossett PLLC 20070178488 - Methods for detecting modulators of cytokine receptor zalpha11: Novel polypeptides, polynucleotides encoding the polypeptides, and related compositions and methods are disclosed for zalpha11, a novel cytokine receptor. The polypeptides may be used within methods for detecting ligands that stimulate the proliferation and/or development of hematopoietic, lymphoid and myeloid cells in vitro and in vivo. Ligand-binding receptor polypeptides can... Agent: Zymogenetics, Inc. Intellectual Property Department 20070178478 - Methods for detection of genetic disorders: The invention provides a method useful for detection of genetic disorders. The method comprises determining the sequence of alleles of a locus of interest, and quantitating a ratio for the alleles at the locus of interest, wherein the ratio indicates the presence or absence of a chromosomal abnormality. The present... Agent: Morrison & Foerster LLP 20070178502 - Methods for determining the prognosis for cancer patients using tucan: The invention provides methods for determining a prognosis for survival for a cancer patient. One method involves (a) measuring a level of a TUCAN in a neoplastic cell-containing sample from the cancer patient, and (b) comparing the level of TUCAN in the sample to a reference level of TUCAN, wherein... Agent: Mcdermott, Will & Emery 20070178457 - Methods for genome amplification: A method for whole genome amplification comprising (a) treating genomic DNA with a modifying agent which modifies cytosine bases but does not modify 5′-methyl-cytosine bases under conditions to form single stranded modified DNA; (b) providing a population of random X-mers of exonuclease-resistant primers capable of binding to at least one... Agent: Knobbe Martens Olson & Bear LLP 20070178494 - Methods for prediction and prognosis of cancer, and monitoring cancer therapy: The present invention also relates to biomarkers and the use of biomarkers for the prediction and prognosis of cancer as well as the use of biomarkers to monitor the efficacy of cancer treatment. Specifically, this invention relates to the use of VEGF and sVEGFR as a biomarker for subjects treated... Agent: Millen, White, Zelano & Branigan, P.C. 20070178500 - Methods of determining relative genetic likelihoods of an individual matching a population: Provided are methods of determining an individual's relative likelihood of having a genetic match with one or more local populations as compared to a generic index population. Also provided are systems, apparatuses, kits, and machine-readable medium relating to such methods. The methods may be used for example, to identify an... Agent: Castellano PLLC 20070178458 - Methods of diagnosis and prognosis of ovarian cancer ii: The present invention provides novel genes and proteins for diagnosing ovarian cancer and/or a likelihood for survival, or recurrence of disease, wherein the expresson of the genes and proteins is up-regulated or down-regulated or associated with the occurrence or recurrence of a specific cancer sub-type. The ovarian cancer-associated genes and... Agent: Knobbe Martens Olson & Bear LLP 20070178472 - Methods of identifying adipocyte specific genes, the genes identified, and their uses: Disclosed is a method of identifying genes that are over-expressed in adipose tissue as compared to pre-adipocyte tissue or other tissues comprising performing differential gene expression analysis between the white adipose tissue (WAT) or stromal vascular tissue (SVT) from any two different mice selected from the group consisting of wild-type,... Agent: Gary J. Gershik Cooper & Dunham 20070178471 - Methods, kits and compositions pertaining to linear beacons: This invention is directed to methods for determining amplified nucleic acid using Linear Beacons.... Agent: Applied Biosystems 20070178463 - Micro-array substrate for biopolymer, hybridization device, and hybridization method: The invention provides a substrate for biopolymer hybridization, a biopolymer hybridization device, and a biopolymer hybridization method capable of: speeding up hybridization of a biopolymer, by means of dielectrophoresis or electrophoresis by applying an alternating voltage or a direct voltage to a planar electrode, so as to generate an electric... Agent: Sughrue Mion, PLLC 20070178517 - Microarray analysis: A method of analysing microarray images. The method comprises the steps of receiving data from a microarray process, modelling the microarray process to define a microarray model comprising at least one of target distribution defining a first independent sub-model and probe distribution defining a second independent sub-model, comparing the received... Agent: Dykema Gossett PLLC 20070178511 - Modified carbocyanine dyes and their conjugates: Chemically reactive carbocyanine dyes incorporating an indolium ring moiety that is substituted at the 3-position by a reactive group or by a conjugated substance, and their uses, are described. Conjugation through this position results in spectral properties that are uniformly superior to those of conjugates of spectrally similar dyes wherein... Agent: Invitrogen Corporation C/o Intellevate 20070178512 - Modified carbocyanine dyes and their conjugates: Chemically reactive carbocyanine dyes incorporating an indolium ring moiety that is substituted at the 3-position by a reactive group or by a conjugated substance, and their uses, are described. Conjugation through this position results in spectral properties that are uniformly superior to those of conjugates of spectrally similar dyes wherein... Agent: Invitrogen Corporation C/o Intellevate 20070178485 - Molecular beacons, methods and kits for detecting dna damage response: This invention relates to embodiment to a molecular beacon, methods and kits for the detection of expression of p21(Waf1/Cip1), in response to chemotherapy. Specifically, the introduction of a phosphorothioate-modified p21-beacon by transfection in human tumor cells yields increased signal in a dose dependent manner.... Agent: Pearl Cohen Zedek Latzer, LLP 20070178468 - Multicellular organisms derived from normal/nondiseased and diseased mammalian tissues: The present invention relates to pleomorphic cells (“morphotes”), which exhibit morphologic and genetic characteristics of both prokaryotic and eukaryotic cells, including resemblance to prokaryotic cells at the unicellular level, and resemblance to eukaryotic cells at the multicellular level due to their ability to self-organize in vitro into multicellular, mammalian tissue-like... Agent: Kenyon & Kenyon LLP 20070178465 - N,n-dimethylacrylamide-based high molecular weight polymer: The invention relates to water-soluble N,N-dialkylacrylamide-based high molecular weight random polymers and monomers laterally functionalised by molecules of interest and to the use thereof for preparing solid supports provided with at least one surface on which said polymers are adsorbed. Said invention also relates to the thus modified solid supports,... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070178477 - Nanotube sensor devices for dna detection: A nanotube device is configured as an electronic sensor for a target DNA sequence. A film of nanotubes is deposited over electrodes on a substrate. A solution of single-strand DNA is prepared so as to be complementary to a target DNA sequence. The DNA solution is deposited over the electrodes,... Agent: O'melveny & Myers LLP 20070178483 - Novel cell-based assays for g-protein-coupled receptor-mediated activities: Disclosed are compositions and methods for their use, such as in identifying G-protein-coupled receptors, ligands and compounds that modulate the activities of G-protein-coupled receptors. The compositions and methods employ cyclic nucleotide-gated channels and fluorescence dyes in detecting changes of intracellular cAMP levels in response to the stimulation of G-protein-coupled receptors.... Agent: David W. Highet, Vp And Chief Intell. Prop. Cnl. Becton, Dickinson And Company 20070178475 - Novel human polynucleotides and polypeptides encoded thereby: Novel human polynucleotides are disclosed that correspond to human gene trapped sequences, or GTSs. The disclosed GTSs are useful for gene discovery and as markers for, inter alia, gene expression analysis, identifying and mapping the coding regions of the mammalian, and particularly human, genome, forensic analysis, and determining the genetic... Agent: Lexicon Pharmaceuticals, Inc. 20070178459 - Nucleic acid detection assay: A method for determining the methylation status of a potential methylation site in genomic nucleic acid comprising treating genomic nucleic acid with an agent which modifies cytosine bases but does not modify 5methyl-cytosine bases under conditions to form a. modified nucleic acid template containing a potential methylation site; providing a... Agent: Knobbe Martens Olson & Bear LLP 20070178474 - Nucleic acid detection assays: The present invention relates to novel methods of producing oligonucleotides. In particular, the present invention provides an efficient, safe, and automated process for the production of large quantities of oligonucleotides.... Agent: Medlen & Carroll, LLP 20070178462 - Nucleic acid molecules encoding novel murine low-voltage activated calcium channel proteins, designated-alpha1h, encoded proteins and methods of use thereof: Disclosed herein are novel nucleic acid molecules encoding murine low-voltage activated calcium channel proteins, designated-α1H, encoded proteins, vectors, host cells transformed therewith, as well as pharmaceutical compositions. Methods of using any of the foregoing, e.g., methods for screening for candidate agonists or antagonists utilizing the novel protein isoforms are also... Agent: Merck And Co., Inc 20070178451 - Nucleic acid sequences from chlorella sarokiniana and uses thereof: Expressed Sequence Tags (ESTs) isolated from the unicellular green algae, Chlorella sarokiniana, are disclosed. The invention encompasses nucleic acid molecules that encode Chlorella protein homologs and fragments thereof. In addition, antibodies capable of binding the proteins are encompassed by the present invention. The disclosed ESTs have particular utility in isolating... Agent: Monsanto Company 20070178464 - Probes for detecting protein nuclear transport and method for detecting and quantifying protein nuclear transport using the same: A convenient and highly accurate method for detecting protein nuclear transport induced by an endogenous or exogenous substance in local areas of living cells or animals is provided. The method uses a pair of probes for detecting protein nuclear transport, comprising Probe I and Probe II. In Probe I, a... Agent: Wenderoth, Lind & Ponack, L.L.P. 20070178505 - Promoter engineering and genetic control: The present invention relates to expression vectors, wherein each vector comprises at least one gene of interest and a promoter operatively linked thereto wherein each promoter comprises a nucleic acid, whose sequence is randomly mutated with respect to that of the wild-type promoter and cells comprising the same. Methods utilizing... Agent: Pearl Cohen Zedek Latzer, LLP 20070178498 - Protein/solubility folding assessed by structural complementation: Many proteins, when produced recombinantly, suffer from improper processing, folding and lack normal solubility. Modified proteins, including those indicative of disease states, also can have such defects. The present invention is directed to methods of identifying proper and improper protein folding, aberrant processing and/or insolubility. The method relies on the... Agent: Fulbright & Jaworski L.L.P. 20070178484 - Rapid, sensitive and quantitative methods for tissue and cell-based proteomics via consecutive addition of quantifiable extenders: Methods, systems and kits are provided for detecting and quantifying multiple immunogens in a sample via consecutive addition of quantifiable extenders to immunogen bound complexes of immunogen binding agent attached to a DNA containing an RNA polymerase promoter.... Agent: Licata & Tyrrell P.C. 20070178516 - Self-addressable self-assembling microelectronic integrated systems, component devices, mechanisms, methods, and procedures for molecular biological analysis and diagnostics: A method for electronically stabilizing hybridization of nucleic acids bound at a test site of a microelectronic device is described. First and second negatively charged nucleic acids are provided, the second nucleic acid being bound to the test site. A zwitterionic buffer having a conductance of less than 100 mS/cm... Agent: O'melveny & Myers LLP 20070178499 - Specific labeling of protein with zinc finger tags and use of zinc-finger-tagged proteins for analysis: Fusion proteins including zinc finger tags that bind in a sequence-specific manner and a peptide, polypeptide, or protein can be prepared and expressed. Such fusion proteins can be used to generate protein arrays by binding the zinc finger tags to a DNA array. The fusion proteins can also be used... Agent: Catalyst Law Group, Apc 20070178514 - System and method for analyzing a blood sample and disposable cartridge for use in this system or method: A system for analyzing a blood sample comprises an element for nucleic acid (NA) isolation, an element for NA amplification, an incubator and a detector for detecting a parameter of the blood sample. The system comprises a single disposable cartridge having the NA isolation element and the NA amplification element,... Agent: Amster, Rothstein & Ebenstein LLP 20070178501 - System and method for integrating and validating genotypic, phenotypic and medical information into a database according to a standardized ontology: The system described herein enables clinicians and researchers to use aggregated genetic and phenotypic data from clinical trials and medical records to make the safest, most effective treatment decisions for each patient. This involves (i) the creation of a standardized ontology for genetic, phenotypic, clinical, pharmacokinetic, pharmacodynamic and other data... Agent: Zachary P Demko 20070178470 - System for charge-based detection of nucleic acids: This present invention relates methods for detecting the presence of nucleic acids in a sample. In these methods, neutral capture probes are exposed to a sample possibly containing complementary nucleic acid targets. The foregoing mixture is submitted to conditions that provide for the nucleic acid targets to bind with the... Agent: Godfrey & Kahn S.c. 20070178456 - Targeting enzymes of the trna splicing pathway for identification of anti-fungal and/or anti-proliferative molecules: The present invention relates to a method for screening and identifying compounds that modulate the activity of one or more components in the tRNA splicing pathway. In particular the invention relates to a method for screening and identifying compounds that modulate the activity tRNA splicing endonuclease and/or tRNA splicing ligase.... Agent: Jones Day 20070178496 - Thermus thermophilus nucleic acid polymerases: The invention provides novel nucleic acid polymerases from strains GK24 and RQ-1 of Thermus thermophilus, and nucleic acids encoding those polymerases, as well as methods for using the polymerases and nucleic acids.... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070178521 - Assay chip: An integrated assay chip for assaying one or more components of a specimen, which comprises: (1) one or more pretreatment elements for pretreating a specimen; (2) one or more multilayer dry assay elements capable of assaying one or more components of the pretreated specimen; and (3) one or more flow... Agent: Birch Stewart Kolasch & Birch 20070178530 - Detecting and predicting pre-eclampsia: The technology described herein relates to methods of detecting or predicting pre-eclampsia (PE). The technology described herein also relates to commercial packages, such as diagnostic kits, for performing a method of detecting or predicting PE. In particular, the technology described herein provides methods of predicting pre-eclampsia when determining the levels... Agent: Banner & Witcoff, Ltd. 20070178529 - Electromagnetically actuated valves for use in microfluidic structures: Disclosed are micron-sized, electromagnetically actuated tongue valves, which find application in microfluidic devices and apparatuses. The present invention further relates to methods for manipulating fluid flow in a microfluidic assay system and for sorting and capturing target particles in fluid suspensions.... Agent: Seed Intellectual Property Law Group PLLC 20070178522 - Gold-binding protein and use thereof: A protein utilizing an anti-gold antibody and a gold-binding side which is a part of the anti-gold antibody is constructed. This protein is capable of specifically binding to gold. This protein or a complex protein containing such a protein can be used for the detection of a target substance.... Agent: Fitzpatrick Cella Harper & Scinto 20070178527 - Human platelet-derived growth factor receptors: DNA sequences encoding human platelet-derived growth factor receptors (hPDGF-R), and expression constructs comprising sequences which encode a receptor that can be secreted or incorporated into the membrane of a mammalian cell. Peptide fragments with functions equivalent to the wild-type receptor, conferring a PDGF-sensitive mitogenic response on cells lacking the receptor... Agent: Townsend And Townsend And Crew, LLP 20070178525 - Livestock health management: The present invention provides methods for managing livestock to improve performance and health of the general livestock population by reducing the impact of subclinical animals persistently infected with a contagious disease by separating animals into arrival groups, screening all animals for the pathogen of the contagious disease, promptly removing the... Agent: Mirick, O'connell, Demallie & Lougee, LLP 20070178528 - Me-5, me-2, and epp2: human protein antigens reactive with autoantibodies present in the serum of women suffering from endometriosis: Three human endometrial antigens, ME-5, ME-2 and EPP2, and combination thereof have been discovered that are the targets of antibodies present in the serum of women suffering from endometriosis. These protein products and the human antibodies reactive with them are used as tools for diagnostic assays that monitor patients with... Agent: Joseph E. Mueth, Esq. Joseph E. Mueth Law Corporation 20070178524 - Methods for determining and lowering caffeine concentration in fluids: Single-chain, camelized heavy chain antibodies immunospecific for caffeine and stable at high temperatures are useful for analysis and recovery of caffeine in or from fluids. A device that provides a single-step lateral flow assay for caffeine and a useful peptide spacer are also described.... Agent: Morrison & Foerster LLP 20070178523 - Novel druggable regions in set domain proteins, and methods of using the same: The present invention relates to novel druggable regions discovered in histone H3 lysine methyltransferase DIM-5, which is a SET domain protein. The present invention further relates to methods of using the druggable regions to screen potential candidate therapeutics for diseases in which the activity of SET domain proteins are implicated,... Agent: Greenlee Winner And Sullivan P C 20070178531 - Rabbit monoclonal antibodies against mouse/human id3 proteins: The present invention relates to a rabbit monoclonal antibody that binds to human Id3 protein and/or mouse Id3 protein with high specificity and high affinity. The antibody has a binding constant, measured with respect to human Id3 protein or mouse Id3, of greater than 1×108/molar. The antibody has no substantial... Agent: Howrey LLP 20070178520 - Screening assay for modulators of interaction between interleukin-12 and/or -23 with their receptors: The invention relates to a screening assay, e.g. to an assay for identifying an agent that modulates the interaction of interleukin-23 and/or interleukin-12 with a corresponding receptor.... Agent: Novartis Corporate Intellectual Property 20070178526 - Use of protein profiles in disease diagnosis and treatment: Disclosed are methods, systems, and articles of manufacture for using proteomics for the diagnosis and treatment of diseases. The methods may be used to diagnose a particular disease or disease subtype. For example, the methods may be used to diagnose chronic rhinosinusitis and diseases related thereto.... Agent: Kilpatrick Stockton LLP - M0351 20070178532 - Identification, quantification, and characterization of t cells and t cell antigens: Methods of quantifying and/or characterizing antigen-specific T cell populations, identifying T cell antigens and epitopes, and preparing targeted pharmaceutical compositions by (i) introducing a peptide into an antigen-presenting cell (APC) expressing a fusion protein comprising a major histocompatibility complex portion and a reporter peptide portion such that a complex forms... Agent: Leydig, Voit & Mayer, Ltd. 20070178533 - Method and diagnostic tests based on flow cytometric analysis of antigen-specific t lymphocytes: The present invention provides a method for the immuno-diagnosis of diseases with different aetiology (infectious diseases, tumors etc) by measurement of the T cell response J, B and NK lymphocytes) induced by a set of diseasespecific antigens. The method is based on the quantitative determination of antigenspecific T lymphocytes (referred... Agent: Stetina Brunda Garred & Brucker 20070178535 - Methods of identifying agents that modulate mitochondrial function: The present invention provides isolated cells comprising a nucleic acid encoding a toxic form of apoE. The present invention further provides screening methods for identifying compounds that reduce apoE-induced impairment of mitochondrial integrity and/or function. The present invention further provides kits for use in carrying out a subject screening method.... Agent: Bozicevic, Field & Francis LLP 20070178534 - Substrates, devices, and methods for cellular assays: The present invention relates to the field of molecular diagnostics, and in particular to diagnostics based on a liquid crystal assay format. In particular, the present invention provided improved substrates and methods of using liquid crystal assays for quantitating the amount of an analyte in a sample. The present invention... Agent: J Mitchell Jones Medlen & Carroll 20070178536 - Identification and monitoring of systemic lupus erythematosus: A method for identifying or monitoring SLE in an individual is provided. The method includes quantitating complement component C4d on the surfaces of platelets and comparing the amounts of C4d to reference levels of C4d on platelets of individuals without SLE and/or on platelets of the individual obtained at a... Agent: Townsend And Townsend And Crew, LLP 20070178537 - Assays for detection of bioactive compounds that interact with heat shock protein 90: A method for evaluation of molecules to identify those that can act as therapeutic inhibitors of Hsp90 makes use of a fluorescence polarization (FP) assay and a cell based assay, either individually or in combination. The FP assay uses a fluorescently-labeled Hsp90 binding agent and measure the degree of fluorescence... Agent: Marina Larson & Associates LLC Re: Msk 20070178540 - Goodpasture antigen binding protein: The present invention provides isolated nucleic acid sequences and expression vectors encoding the Goodpasture antigen binding protein (GPBP), substantially purified GPBP, antibodies against GPBP, and methods for detecting GPBP.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070178538 - Methods for measuring glycan levels of proteins: The invention includes a high-through-put method of screening for a biomarker indicative of a disease, including the identification of a glycan alteration in a protein of a diseased patient. Further, the invention includes methods utilizing a microarray to measure the glycan level of a protein.... Agent: Price Heneveld Cooper Dewitt & Litton, LLP 20070178539 - Novel cytokine receptors and nucleic acids encoding the same: The present invention is directed to novel cytokine receptors having sequence similarity to AF18497_1 and to nucleic acid molecules encoding those cytokine receptors. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide... Agent: Genentech, Inc. 20070178541 - Method of isolating a protein: The present invention provides a method for isolating and/or identifying an immunogenic protein from a protein complex comprising an immunoglobulin or a mixture thereof or an immunoglobulin-containing fraction.... Agent: Cozen O'connor, P.C. 20070178542 - System and methods for detection of bacillus anthracis related analytes in biological fluids: The invention provides a heterogeneous immunoassay for detection of antibodies and antigens based on specific antigen-antibody immune complex formation with multiple antigen-bearing conjugate components. The invention further provides means for optimizing the assay format for the detection of both low and high-affinity antibodies, and provides means for quantitative detection of... Agent: Foley Hoag, LLP Patent Group, World Trade Center West 20070178544 - Anti fk778antibodies and high sensitive immunoassay methods: This invention relates to antibodies capable of binding to the FK778 substance, to a highly-sensitive immunoassay method, which utilizes an antibody for the FK778 substance, and to a test kit for measuring the concentration of the FK778 substance.... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070178543 - Assay methods and materials: The invention relates to assays in which complexes between an analyte and a binding agent specific for the analyte are detected by a reporter molecule, which is capable of binding to the binding agent when the binding agent is complexed with analyte but not when the binding agent is complexed... Agent: Heller Ehrman LLP 20070178545 - Luminogenic and nonluminogenic multiplex assay: A method to detect the presence or amount of at least one molecule for an enzyme-mediated reaction in a multiplex luminogenic/nonluminogenic assay is provided.... Agent: Schwegman, Lundberg, Woessner & Kluth, P.A. 20070178546 - Stabilized cholinesterase substrate solution: The present invention relates to the use of a polar organic solvent for the stabilization of a cholinesterase substrate solution, wherein at least one substrate is stabilized by at least one species of a polar organic solvent in a buffered solution, and to the use of said solution for determining... Agent: Roche Diagnostics Operations Inc. 20070178547 - Method of measuring glycated protein: A method for measuring a glycated protein, a glycated peptide, or a glycated amino acid is provided. In this method, proteolytic activity of the protease is controlled to thereby realize high accuracy of the measurement. Also provided is a reagent used in such a measurement. More specifically, this invention provides... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070178548 - Method for quantitative and semi-quantitative detection of l-phenylalanine, l-tyrosine, l-3,4-dihydroxyphenylalanine and their corresponding keto-acids, phenylpiruvic acid, 3-hydroxyphenylpyruvic acid and 3,4-dihydroxyphenylpyruvic acid in biological flui: Method for quantitative and semi-quantitative determination of endogenous amino acids L-phenyalanine, L-tyrosine, L-3,4-dihydroxyphenylalanine and their corresponding keto-acids, phenylpiruvic acid, 3-hydroxyphenylpyruvic acid and 3,4-dihydroxyphenylpyruvic in biological fluids useful for diagnosis and monitoring of metabolic disorders of said amino acids or diseases involving said amino acids... Agent: Arent Fox PLLC 20070178549 - Testing body, particularly for verifying the penetration properties of a sterilizing agent in sterilization processes: A testing body (1) that is provided for verifying the penetration properties of a sterilization agent has, with a compact design, a particularly high detection sensitivity and is thus particularly well-suited or use in the sterilization of minimally invasive surgical instruments that are known to be difficult to remove air... Agent: Darby & Darby P.C. 20070178550 - Identification of 3-ketosteroid 9-alfa-hydroxylase genes and microorganisms blocked in 3-ketosteroid 9-alfa-hydroxylase activity: The invention relates to an isolated polynucleotide sequence comprising a nucleic acid sequence encoding the amino acid sequence of KshA protein or of KshB protein, encoded by nucleotides 499-1695 of SEQ ID NO:1 or by nucleotides 387-1427 of SEQ ID NO:2, respectively, and functional homologues thereof. The polynucleotides of the... Agent: Akzo Nobel Inc. 20070178555 - Attenuated rabies virus with nucleoprotein mutation at the phosphorylation site for vaccination against rabies and gene therapy in the cns: A mutant virus is provided which contains a mutation at a phosphorylation site in one or more of the proteins of the virus, which mutation causes the virus to be attenuated, and therefore, an improved vaccine composition can be produced therewith. The invention also relates to vaccine compositions which contain... Agent: Bingham Mccutchen LLP 20070178558 - Cloning, sequencing and expression of a comamonas cyclopentanone 1,2-monooxygenase-encoding gene in escherichia coli: Cyclopentanone 1,2-monooxygenase (CPMO) from Comamonas (previously Pseudomonas) sp. strain NCIMB 9872 carries out the second step of a degradation pathway that allows the bacterium to use cyclopentanol as a sole carbon source for growth. In the present invention there is reported the localization of the CPMO-encoding gene (cpnB) on a... Agent: Ogilvy Renault LLP 20070178556 - Enzymatic production of glycolic acid: Various methods are provided for the enzymatic production of glycolic acid from glycolonitrile. These methods include: 1) use of Acidovorax facilis 72W nitrilase mutants having improved nitrilase activity for converting glycolonitrile to glycolic acid, and 2) methods to improve catalyst stability and/or productivity. The methods to improve catalyst stability/productivity include... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070178553 - Mammalian t-type calcium channels: Sequences and partial sequences for three types of mammalian (human and rat sequences identified) T-type calcium channel subunits which we have labeled as the α1G, α1H and α1I subunits are provided. Knowledge of the sequence of these calcium channel permits the localization and recovery of the complete sequence from human... Agent: Morrison & Foerster LLP 20070178552 - Method for making multispecific antibodies having heteromultimeric and common components: The invention relates to a method of preparing heteromultimeric polypeptides such as bispecific antibodies, bispecific immunoadhesins and antibody-immunoadhesin chimeras. The invention also relates to the heteromultimers prepared using the method. Generally, the method provides a multispecific antibody having a common light chain associated with each heteromeric polypeptide having an antibody... Agent: Heller Ehrman LLP 20070178551 - Methods for producing modified glycoproteins: Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical, to their human counterparts. The lower... Agent: Merck And Co., Inc 20070178557 - Novel n-acetylglucosaminyltransferase, nucleic acid coding for the same, and uses thereof for diagnosis of cancer or tumor: Described are an enzyme having an activity to transfer N-acetylglucosamine to a non-reducing terminal of Galβ1-4Glc or Galβ1-4GlcNAc group through β1,3-linkage; nucleic acid coding for the enzyme; and method for diagnosis of a cancer and/or tumor, especially a cancer and/or tumor of a digestive organ, using the expression amount of... Agent: Birch Stewart Kolasch & Birch 20070178554 - Orthogonal aminoacyl synthetase-trna pairs for incorporating unnatural amino acids into proteins: Methods of incorporating unnatural amino acids into proteins in eukaryotic cells using an orthogonal aminoacyl synthetase and an orthogonal tRNA derived from Lactococcus lactis.... Agent: Sheldon Mak Rose & Anderson PC 20070178559 - Platelet promoting protein and the usage thereof: The present invention discloses a protein that has strong affinity to thrombopoietin receptor (C-MPL) and the nucleotide sequences of the protein. The protein is capable of increasing the numbers of platelets and enhancing the blood clotting in vivo and is named as platelet promoting protein (PPP). The protein and its... Agent: The Webb Law Firm, P.C. 20070178560 - Method for detecting leptin receptor ligands: The present application relates to a method for detecting leptin receptor ligands by measuring the energy transfer between fusion proteins composed of leptin receptors and of energy donor and acceptor proteins. It also relates to fusion proteins for implementing this method.... Agent: Ross J. Oehler Sanofi-aventis U.s. LLC 20070178561 - Anti-hiv-1 compounds based upon a conserved amino acid sequence shared by gp160 and the human cd4 protein: Disclosed are compositions and methods that relate generally to human immunodeficiency virus (HIV), and more particularly to the agents and their identification and use of anti-HIV agents which interfere with binding of a target amino acid sequence within glycoprotein 160 of HIV-1 to its ligand. Further disclosed is a composition... Agent: Needle & Rosenberg, P.C. 20070178562 - Consensus/ancestral immunogens: The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or... Agent: Nixon & Vanderhye, PC 20070178563 - Mosaic infectious bursal disease virus vaccines: The invention relates to Infectious Bursal Disease Virus (“IBDV”) and vaccines therefor. Provided are infectious recombinant Infectious Bursal Disease Virus (“rIBDV”) essentially incapable of growing in a cell that is not derived from a bursa cell, or an infectious rIBDV having retained at least part of the very virulent characteristics... Agent: Trask Britt 20070178564 - Microorganism of the genus corynebacterium having enhanced l-lysine productivity and method of producing l-lysine using the microorganism of the genus corynebacterium: The present invention provides a microorganism that belongs to the genus Corynebacterium and has an inactivated inherent NCgl2053 dehydrogenase gene, and a method of producing L-lysine using the same. By using the microorganism, the yield of L-lysine is increased since an inherent NCgl2053 dehydrogenase gene is inactivated. According to the... Agent: Rothwell, Figg, Ernst & Manbeck, P.C. 20070178565 - Novel carbonyl reductase, gene thereof and method of using the same: The present invention provides a novel polypeptide efficiently forming (R)-N-benzyl-3-pyrrolidinol, a polynucleotide coding for said polypeptide, and use of the same. The present invention relates to a polypeptide having the following physical and chemical properties (1) to (4): (1) activity: acting on N-benzyl-3-pyrrolidinone with NADH or NADPH as a coenzyme,... Agent: Sughrue Mion, PLLC 20070178566 - Oil seed meal preparation: Canola oil seeds are treated for the production of a canola oil seed meal for recovery of canola protein isolates therefrom. The canola oil seeds are heat-treated to inactivate myrosinases and other enzymes and dehulled prior to crushing dehulled canola oil seeds and removing oil therefrom and to provide the... Agent: Sim & Mcburney 20070178567 - Methods and systems for producing ethanol using raw starch and selecting plant material: The present invention relates to methods for producing high levels of alcohol during fermentation of plant material, and to the high alcohol beer produced. The method can include selecting plant material. Selecting can include excluding plant material that has been exposed to high temperatures or that has had high moisture... Agent: Womble Carlyle Sandridge & Rice, PLLC 20070178568 - Process for the continuous production of ethanol: A process for the production of ethanol utilizes a vacuum process and selectively permeable membranes to increase ethanol production efficiency. Yeast converts sugars to ethanol in an anaerobic condition within process chamber void of oxygen and filled with a Nitrogen gas (N2) or any non-oxygen containing gas. A glucose solution... Agent: Carlson, Gaskey & Olds, P.C. 20070178569 - Systems and methods for producing biofuels and related materials: Clostridium phytofermentans cells (American Type Culture Collection 700394T) and all other strains of the species can ferment materials such as biomass into useful products and coproducts, such as ethanol, hydrogen and organic acids. Compositions that include Clostridium phytofermentans are also disclosed.... Agent: Fish & Richardson PC 20070178570 - Sustained microbial production of hydrogen gas from diluted fruit juice: The present invention provides an apparatus and method for the production of hydrogen based on the capture of metabolic by-products of hydrogen-producing microbacteria, in which a bioreactor is maintained in an environment conducive to the growth of hydrogen-producing microbacteria and the production of hydrogen and at the same time is... Agent: Gwen R. Acker Wood, Ph.d., J.d. Eckert Seamans Cherin & Mellott, LLC 20070178571 - Biosynthesis of phloroglucinol and preparation of 1,3-dihydroxybenzene therefrom: The present invention provides methods, enzymes, and cells for the biosynthetic production of phloroglucinol from malonyl-CoA, which is ultimately obtained from simple starting materials such as glucose; also provided are methods for preparing derivatives of biosynthetic phloroglucinol, including, e.g., resorcinol.... Agent: Harness, Dickey & Pierce, P.L.C 20070178573 - Crystal structure of tak1-tab1: The invention relates to molecules or molecular complexes which comprise binding pockets of TAK1 or its structural homologues. The invention relates to crystallizable compositions and crystals comprising TAK1. The present invention also relates to a data storage medium encoded with the structural coordinates of molecules and molecular complexes which comprise... Agent: Vertex Pharmaceuticals Inc. 20070178572 - Protein crystal structure: Disclosed is a crystal comprising at least a catalytically active portion of a SET 7/9 histone methyltransferase, and various uses thereof, and ligands for SET 7/9.... Agent: Morgan Lewis & Bockius LLP 20070178574 - Aggrecanase structure: This invention relates to aggrecanase polypeptides and aggrecanase polypeptide/ligand complexes, crystals of aggrecanase and aggrecanase polypeptide/ligand complexes, and related methods and software systems.... Agent: Fish & Richardson P.C. 20070178575 - Identification of a nitrilase from b. japonicum by rational genome mining and methods of use: The present disclosure relates to methods of rational genome mining. A method may include narrowing the number of clones that would otherwise need to be screened and/or identifying a gene with a desired catalytic activity. The disclosure also relates to a nitrile hydrolase from Bradyrhizobium japonicum USDA110 first identified by... Agent: Baker Botts L.L.P. 20070178576 - Purification of high-molecular compounds by means of affinity membrane chromatography: The invention relates to a method for purifying and/or isolating high-molecular compounds, such as high-molecular proteins or protein-type compounds, contained in a solution or a suspension, by means of affinity chromatography using membranes containing metal ions.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070178577 - Method for effecting the anaerobic biological decomposition of organsiloxanes: Biological decomposition of compounds containing Si-C bands such as PDMS takes place under substantially anaerobic conditions in the presence of an alternative electron acceptor.... Agent: Brooks Kushman P.C. 20070178578 - Biofiltration system for treating airborne volatile organic compounds: A biofiltration system for treating biodegradable airborne contaminants such as VOCS includes a bio-reactor chamber with a sealed housing, and a heater for maintaining a temperature within the chamber. Several fabric-based bio-reactor panels are mounted within the chamber and are kept in a dampened state by means of an applicator... Agent: Jerome R. Drouillard 20070178579 - Circuits and methods for artifact elimination: Disclosed are apparatus and methods that provide the ability to electrical stimulate a physical system, and actively eliminate interference with signal acquisition (artifacts) that arises from the stimulation. The technique implemented in the circuits and methods for eliminating interference connects a discharge path to a physical interface to the system... Agent: Law Offices Of Kenneth W. Float 20070178580 - Sample arraying/assembling device, its method, and apparatus using sample assembly: The present invention relates to a sample arraying/assembling device, its method, and an apparatus using a sample assembly, and has an object of providing a sample arraying/assembling device which is adapted to various microplates of International Standards, and is capable of efficiently and quickly arraying and assembling various samples; its... Agent: Haynes And Boone, LLP 20070178581 - Screening method and apparatus for identifying a reactive compound bonding with a target compound: An screening method and apparatus for online identification of a reactive compound bonding with a target compound includes a first dimension analysis step whereby a sample including a target compound and a reactive compound are injected together into a sample injection port. The sample is led to a first dimension... Agent: Kanesaka Berner And Partners LLP 20070178582 - Microfabricated cellular traps based on three-dimensional micro-scale flow geometries: An improved microfluidic device and method of using the microfluidic device to measure natural motile response of a living moiety to a chemotactic agent. The invention comprises integrating microfluidic containment trenches within the microfluidic devices for cellular trapping, manipulation and real-time analysis of biological phenomena, including chemotaxis. The invention captures... Agent: Arthur G Schaier Carmody & Torrance 20070178583 - Multi-chamber cell culture assembly: A multi-chamber cell culture assembly has provisions for the distribution of nutrient culture medium and gasses throughout each of the chambers. A device is constructed to provide a large surface area for the growth and cultivation of hybridomas, mammalian and insect cells. The device may incorporate macro, micro or nano... Agent: Grossman, Tucker, Perreault & Pfleger, PLLC 20070178584 - Culture device: A culture device to apply uniform stress to cells is proposed. A culture device is formed in a rectangular box shape from a deformable material, comprising a bottom membrane and side walls upstanding from the entire periphery of said bottom membrane, wherein an engaging member is formed in opposing side... Agent: Quarles & Brady LLP 20070178585 - Compositions and methods for non-targeted activation of endogenous genes: The present invention is directed generally to activating gene expression or causing over-expression of a gene by recombination methods in situ. The invention also is directed generally to methods for expressing an endogenous gene in a cell at levels higher than those normally found in the cell. In one embodiment... Agent: Lahive & Cockfield, LLP 20070178589 - Apparatus and method for culturing and preserving tissue constructs: A disclosure is made of various apparatus and methods for culturing and preserving cells and tissue in ways that minimize contamination potential, direct cells to reside in desired areas, allow uniform cell distribution during seeding, provide optimal growth conditions by controlling the amount of medium residing in proximity of cells,... Agent: Patterson, Thuente, Skaar & Christensen, P.A. 20070178587 - Method of culturing embryonic stem cells with the use of amniotic membrane-origin factor: The present invention provides a clinically applicable method of inducing differentiation of the embryonic stem cells. Specifically, the present invention provides a method of culturing embryonic stem cells, which comprises culturing embryonic stem cells in the presence of an amnion-derived factor, a cell culture obtained by the culture method, and... Agent: Leydig Voit & Mayer, Ltd 20070178586 - Methods and apparatuses for growing cells: Methods of culturing stem cells including growing fibroblast cells on a three-dimensional scaffold, perfusing the fibroblast cells with a cell culture medium to form fibroblast cell-conditioned cell culture medium, and growing the stem cells on a three-dimensional scaffold perfused with the fibroblast cell-conditioned cell culture medium are presented. Multi-stage bioreactors... Agent: Calfee Halter & Griswold, LLP 20070178588 - Tissue control rods for sheet-based tissue engineering: The disclosure provides methods and systems for tissue engineering including an apparatus and methods for the growth, maintenance, and use of robust tissue sheets using tissue manipulation devices. The tissue manipulation devices provide a method of anchoring the tissue sheets to the cell culture substrate to promote prolonged maturation and... Agent: Fish & Richardson P.C. 20070178590 - Pluripotential embryonic stem cells and methods of making same: The present invention provides a non-mouse, including human, pluripotential embryonic stem cell which can: (a) be maintained on feeder layers for at least 20 passages; and (b) give rise to embryoid bodies and multiple differentiated cell phenotypes in monolayer culture. The invention further provides a method of making a pluripotential... Agent: Needle & Rosenberg, P.C. 20070178591 - Internally administered therapeutic agents for diseases in central and peripheral nervous system comprising mesenchymal cells as an active ingredient: Intravenous administration of bone marrow cells collected from rat bone marrow to a rat cerebral infarction model was found to be effective in treating cerebral infarction. Human and murine bone marrow stem cells showed similar effects. Mesenchymal cells such as bone marrow cells, cord blood cells, or peripheral blood cells... Agent: Foley And Lardner LLP Suite 500 20070178592 - Lentiviral vectors featuring liver specific transcriptional enhancer and methods of using same: Recombinant lentiviruses and transfer vectors for transgene delivery as well as methods for gene therapy using such vectors are disclosed. The invention provides a third generation lentiviral packaging system and a set of vectors for producing recombinant lentiviruses, as well as novel tissue specific enhancer and promoter elements useful for... Agent: Karen S. Canady Canady & Lortz LLP 20070178593 - Particle preparation for direct-delivery transformation: Methods of preparing microparticles for transformation of plant cells with compositions of interest, and compositions comprising the prepared particles and the associated compound(s) of interest are provided. Further provided are methods to deliver compositions of interest to plant cells for transient or stable incorporation in the genome, and any transformed... Agent: Pioneer Hi-bred International, Inc. 20070178594 - Novel dominant selection marker for the transformation of fungi: The invention relates to a new expression vector for the transformation of eukaryotic cells, in particular fungal cells, or eukaryotic cell organelles as well as to a method for the transformation of eukaryotes, in particular fungi, or eukaryotic cell organelles employing these expression vector. The expression vector comprises at least... Agent: Akerman Senterfitt Previous industry: Education and demonstrationNext industry: Chemistry: analytical and immunological testing ###### RSS FEED for 20091029: Integrate FreshPatents.com into your RSS reader/aggregator or website to track weekly updates. For more info, read this article. ###### Thank you for viewing Chemistry: molecular biology and microbiology patents on the FreshPatents.com website. These are patent applications which have been filed in the United States. There are a variety ways to browse Chemistry: molecular biology and microbiology patent applications on our website including browsing by date, agent, inventor, and industry. If you are interested in receiving occasional emails regarding Chemistry: molecular biology and microbiology patents we recommend signing up for free keyword monitoring by email. ### FreshPatents.com Support Results in 6.02653 seconds |
* Easy, fast online form * Protect your Inventions * US Patent Office filing Provisional Patent Utility Patent - - - - - - - - - - - - - - - - - - - - - - * Fast online form * Protect your Name/Design * US Government filing Trademark Services - - - - - - - - - - - - - - - - - - - - - - PATENT INFO |