Chemistry: molecular biology and microbiology inventions 08/07

20070202516 - Gene detection assay for improving the likelihood of an effective response to an egfr antagonist cancer therapy: The invention provides a method for more effective treatment of patients susceptible to or diagnosed with tumors overexpressing EGFR, as determined by a gene amplification assay, with an EGFR antagonist. Such method comprises administering a cancer-treating dose of the EGFR antagonist, preferably in addition to chemotherapeutic agents, to a subject... Agent: Genentech, Inc.

20070202522 - Isothermal screening of tumor cell related nucleic acids: The presently described technology relates generally to the art of molecular diagnostics and more particularly to point-of-care diagnostic methods and materials. The diagnostic methods and materials of the presently described technology are suitable for a variety of uses including but not limited to the bedside or field diagnosis of infectious... Agent: Mcandrews Held & Malloy, Ltd

20070202508 - Novel thermophilic proteins and the nucleic acids encoding them: The disclosed invention relates to the fields of molecular biology and biochemistry. Thermophilic proteins and the nucleic acids encoding them are disclosed. The thermophilic proteins are from, or derived from, a bacteriophage, YS40, that infects the thermophilic bacterium Thermus thermophilus. These proteins have enhances stability, particularly at high temperatures.... Agent: Polsinelli Shalton Flanigan Suelthaus PC

20070202507 - Utilization of nucleotide probes in elisa procedure for the quantitative determination of plasmodium falciparum dna in malaria: The present invention is the development of a simple and specific quantitative method for the determination of P. falciparum DNA in malaria that involves the direct detection of the highly 42-kDa conserved C-terminal region of P. falciparum merozoite surface protein (MSP1) gene. This procedure entails the amplification of the 42-kDa... Agent: Dr. Mai Nguyen

20070202555 - Method for judging feature of malignant tumor: A method for judging feature of malignant tumor is described. The method comprises obtaining step, first comparing step, second comparing step and judging step. The obtaining step comprises obtaining a first parameter based on activity and expression level of a first cyclin dependent kinase (first CDK) contained in a tumor... Agent: Sughrue Mion, PLLC

20070202562 - Flux limiting membrane for intravenous amperometric biosensor: A flux limiting layer for an intravenous amperometric biosensor is formed on a substrate to limit a diffusion rate of an analyte from blood to an enzyme electrode. The layer may be formed from ethylene vinylacetate (EVA) dissolved in a solvent such as paraxylene, spray-coated to cover a portion of... Agent: Edwards Lifesciences Corporation

20070202570 - Enzyme composition, low molecular weight hyaluronan and process for preparing the same: The present invention is to provide a low molecular weight hyaluronan by acting a hyaluronidase derived from a microorganism belonging to the genus Penicillium on a hyaluronan and a process for preparing the same, and an enzyme composition which can be suitably used for the preparation of the low molecular... Agent: Birch Stewart Kolasch & Birch

20070202485 - Methods and apparatus for preserving the endothelium in isolated hollow organs and biological vessels: The invention relates to a method and an apparatus for the endothelium-preserving treatment of isolated hollow organs, especially biological vessels such as blood vessels and lymphatic vessels by means of endothelium-protective perfusates or incubation solutions containing at least 0.1 percent by weight of native albumin and a nutrient substrate, preferably... Agent: Mayer, Brown, Rowe & Maw LLP

20070202487 - Assay for phospholipidosis: Cell based assays for phospholipidosis are provided. The assays employ image and data analysis technology to provide an indication of whether a population of cells exhibits phospholipidosis. Methods to assess the effect of a stimulus on inducing phospholipidosis in a population of cells are also provided.... Agent: Beyer Weaver LLP

20070202486 - Method of assaying substance capable of changing mitochondrial membrane potential: The present invention aims to provide a convenient and high precision evaluation method of a pharmaceutical agent that changes the mitochondrial membrane potential, using a mitochondrial membrane potential of a cultured cell as an index. The present invention provides a method for evaluating the ability of a test substance to... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C.

20070202488 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg.

20070202489 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg.

20070202490 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg.

20070202491 - Methods for determining the relative benefits and/or evaluating quantitative changes of products on epithelial tissue: A method for determining the relative benefits of products which affect animal epithelial tissue is provided. Also provided is a method for evaluating quantitative changes on one or more affected surfaces of epithelial tissue of a subject caused by a test product.... Agent: The Procter & Gamble Company Intellectual Property Division - West Bldg.

20070202494 - Development of diagnostic kit for the detection of chrysanthemum virus b: The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1:Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer:TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies... Agent: Sughrue Mion, PLLC

20070202493 - Device and method for maintaining a plurality of beads in suspension: A device and a method for maintaining a plurality of beads in suspension in a fluid are provided. The device includes a container having a chamber in fluid communication with an inlet and an outlet. The chamber is configured to hold the plurality of beads and the fluid therein. Each... Agent: Patrick W. Rasche Armstrong Teasdale LLP

20070202496 - Liver cancer biomarkers: A method of detecting whether a subject is afflicted with or at increased risk of developing liver cancer is carried out by detecting cleavage of a marker in a sample such as a blood sample from the subject. Suitable markers include but are not limited to, calreticulin, calreticulin precursor, protein... Agent: Myers Bigel Sibley & Sajovec

20070202495 - Use of resistive-pulse sensing with submicrometer pores or nanopores for the detection of the assembly of submicrometer or nanometer sized objects: Methods and compositions for detecting the assembly of complexes include providing a solution where a first portion is separated from a second portion via a submicrometer pore, submicrometer tube or channel, nanopore, or nanotube or channel. One or more submicrometer or nanometer sized object(s) is added to the first portion... Agent: Harness, Dickey & Pierce, P.L.C

20070202492 - Viral assay: The application relates to an assay method for studying the effect of at least one compound on RN virus replication and transcription comprising the steps of providing a synthetic RN molecule encoding at least a portion of the genome of an RN virus of interest and a copy of a... Agent: Birch Stewart Kolasch & Birch

20070202500 - Acylglycerol acyltransferase-like protein mgat-x2 and uses thereof: The present invention is directed to a polynucleotide and polypeptide sequence of a novel acylglycerol acyltransferase-like protein MGAT-X2. The invention also provides the human MGAT-X2 associated with the cardiovascular diseases, metabolic diseases, muscle-skeleton disorders or dermatological diseases. The invention also provides assays for the identification of compounds useful for the... Agent: Banner & Witcoff, Ltd.

20070202502 - Assay for bipolar affective disorder: The present invention provides a method of diagnosing bipolar affective disorder (BAD) and for determining a predisposition of a subject to bipolar affective disorder. In particular, the methods of the present invention comprise detecting a marker that comprises one or more polymorphisms at position 4q35.2 of the human genome and/or... Agent: Knobbe Martens Olson & Bear LLP

20070202534 - Cd38 as a prognostic indicator in b cell chronic lymphocytic leukemia: The subject invention discloses a method for determining the prognosis and probable clinical course of a subject diagnosed with B-CLL. Specifically, the invention involves comparing CD38 expression in a biological sample from the subject containing B-CLL cells to a baseline level of CD38 expression, wherein an elevated level of CD38... Agent: Amster, Rothstein & Ebenstein LLP

20070202529 - Compositions and methods for labeling of nucleic acid molecules: The present invention is generally related to compositions, kits and methods for labeling nucleic acid molecules using reverse transcriptases, preferably multi-subunit reverse transcriptases such as ASLV reverse transcriptases. Specifically, the invention relates to methods, kits and compositions for fluorescently labeling nucleic acid molecules during nucleic acid synthesis. The labeled nucleic... Agent: Invitrogen Corporation C/o Intellevate

20070202530 - Devices and methods for isolating and recovering target cells: A cell isolating device and method is provided to concentrate or isolate cells with specific characteristics from a mixture of different cell types. One embodiment may comprise two subtypes of antibodies that are directly conjugated to biotin (Abb) and conjugated to a fluorescent molecule (Abf). The conjugated antibodies (Abb+Abf) bind... Agent: Inskeep Intellectual Property Group, Inc

20070202514 - Dna diagnostics based on mass spectrometry: Fast and highly accurate mass spectrometry-based processes for detecting a particular nucleic acid sequence in a biological sample are provided. Depending on the sequence to be detected, the processes can be used, for example, to diagnose a genetic disease or chromosomal abnormality; a predisposition to a disease or condition, infection... Agent: Grant Anderson LLP C/o Portfolioip

20070202519 - Domain segmentation and analysis: Methods and apparatus, including computer program products, implementing and using techniques for analysis of images of cells and extraction of biologically significant features from the cell images, such as features located in cell boundary regions and cell-cell junctions. The extracted features may be correlated with particular conditions induced by biologically-active... Agent: Beyer Weaver LLP

20070202526 - Genotyping result evaluation method and system: A method and a system for evaluating results of differentiating genotype signals and noise signals when a DNA fragment containing a gene to be analyzed is amplified by PCR and detected by electrophoresis are provided. An outlier of genotyping results is detected based on the fact that, when using the... Agent: Reed Smith LLP

20070202533 - High speed dna sequencer and method: This invention relates to a device for the determination of the sequence of nucleic acids and other polymeric or chain type molecules. Specifically, the device analyzes a sample prepared by incorporating fluorescent tags at the end of copies of varying lengths of the sample to be sequenced. The sample is... Agent: Dewalch Technologies, Inc.

20070202512 - Human single nucleotide polymorphisms associated with dose-dependent weight gain and methods of use thereof: The invention provides novel polynucleotides and polypeptides associated with the incidence of PPAR-agonist associated weight gain and lower HbA1C levels. The invention also provides polynucleotide fragments corresponding to the genomic and/or coding regions of these polynucleotides which comprise at least one polymorphic locus per fragment. Allele-specific primers and probes which... Agent: Louis J. Wille Bristol-myers Squibb Company

20070202498 - Light emitting probes: This invention relates to a composition comprising at least two chemically different fluorophores, providing a donor and an acceptor respectively, connected together by at least one linker moiety and bonded to a binder moiety.... Agent: Law Office Of Duncan Palmatier

20070202527 - Method and device for producing vaccine: A method of making a vaccine using animal derived component free (ADCF) cell culture technology, including the steps of attaching ADCF-adapted cells to a microcarrier including an attachment mechanism for attaching filipodia of the cells, the microcarrier being in a culture, growing the cells in ADCF maintenance media, infecting the... Agent: Kenneth I. Kohn Kohn & Associates, PLLC

20070202504 - Method of searching specific base sequence: It is intended to efficiently determine a base sequence specifically appearing in an expression gene. For this, providing that the expression gene consists of exons (301) . . . (306) and especially that exon (301) is united with exon (302) and exon (302) with exon (303), an aggregate of base... Agent: Day Pitney LLP

20070202511 - Methods and compositions for the rapid isolation of small rna molecules: The present invention provides extraction compositions and methods for the rapid and efficient isolation of small RNA molecules from a biological sample. In particular, the extraction compositions, when contacted with a biological sample, releases the small RNA molecules from the other molecules in a biological sample, and the released small... Agent: Polsinelli Shalton Welte Suelthaus PC

20070202523 - Methods and kits for amplifying dna: Novel methods of synthesizing multiple copies of a target nucleic acid sequence which are autocatalytic are disclosed (i.e., able to cycle automatically without the need to modify reaction conditions such as temperature, pH, or ionic strength and using the product of one cycle in the next one). In particular, methods... Agent: Gen Probe Incorporated

20070202510 - Methods for diagnosing and treating kidney cancer: Methods, reagents and kits for diagnosing and treating kidney cancer are disclosed. An immunoassay for detecting kidney cancer is based on the relative change of the CELSR1 protein in urine or blood compared with normal tissue. An immunohistochemical assay for detecting kidney cancer is based on the relative absence of... Agent: Perkins Coie LLP

20070202513 - Methods for disease detection: The present invention provides methods for detecting disease by analysis of a patient sample to determine the integrity of nucleic acids in the sample.... Agent: Wolf Greenfield & Sacks, P.C.

20070202505 - Methods for gene function analysis: The present invention provides methods for analysis of gene function using effector libraries.... Agent: Moser, Patterson & Sheridan, LLP

20070202528 - Methods for modulating proteins not previously known as proteases: The present invention relates to the proteins not previously identified as proteases; the use of those peptides in screening for compounds that modulate protease activity; treating individuals in need of treatment with the compounds or proteases; and in methods for diagnosing a disease or disorder associated with a protease of... Agent: Genencor International, Inc. Attention: Legal Department

20070202499 - Methylated gene biomarkers for detecting cancer: The present invention includes methods diagnosising of cancer by analysis of a patient sample, particularly for the presence of a methylated SPARC nucleic acid molecule, and particularly for the diagnosis of pancreatic cancer. The invention also includes therapeutic methods for treating cancers by administering to cancers patients therapeutically effective amounts... Agent: Edwards Angell Palmer & Dodge LLP

20070202509 - Microarray having a base cleavable sulfonyl linker: The present invention provides a microarray having base cleavable, sulfonyl-containing linkers and a process to make the microarray. Oligonucleotides of any sequence may be synthesized on the microarray having the cleavable linker. The oligonucleotides may be cleaved and recovered as a pool of oligonucleotides having a three prime phosphate moiety.... Agent: Combimatrix Corporation

20070202525 - Non-invasive fetal genetic screening by digital analysis: The present methods are exemplified by a process in which maternal blood containing fetal DNA is diluted to a nominal value of approximately 0.5 genome equivalent of DNA per reaction sample. Digital PCR is then be used to detect aneuploidy, such as the trisomy that causes Down Syndrome. Since aneuploidies... Agent: Peters Verny , L.L.P.

20070202517 - Novel acid detection assays employing blocker oligonucleotides: The present invention provides methods, compositions, and kits for detecting the presence or absence of target sequences in a sample, where the sample also contains interfering sequences that are similar or identical to the target sequences. In particular, the present invention provides blocker oligonucleotides that at least partially inhibit the... Agent: Medlen & Carroll, LLP

20070202520 - Novel lipase: A novel phospholipase A1 (PLA1) having a substrate specificity to phosphatidic acid (PA); a peptide or a polypeptide originating in the above novel PLA1; a polynucleotide encoding the peptide or polypeptide originating in the novel PLA1; a process for producing the peptide or polypeptide originating in the novel PLA1; an... Agent: Sughrue Mion, PLLC

20070202532 - Nucleic acid purification method and purification apparatus: The object of the present invention is to provide a nucleic acid purification method and purification apparatus characterized by high washing efficiency where contamination does not occur and liquid does not remain in the nozzle tip. The present invention provides a tip containing the solid phase capturing a nucleic acid... Agent: Dickstein Shapiro LLP

20070202497 - One step oligochromatographic device and method of use: The present invention relates to methods and devices for detecting one or more analytes in a biological sample, preferably a clean liquid sample. This invention in particular relates to improved rapid tests such as “dipsticks”, “lateral flow” devices and “flow-through” devices. The invention in particular relates to oligochromatographic devices that... Agent: Fitch Even Tabin And Flannery

20070202503 - Pharmaceutical composition of (+)-erythro-mefloquine and its use: A pharmaceutical composition is in the form of a unit dosage comprising 1 to 60 mg (+)-erythro-mefloquine. This is intended for daily dosing.... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association

20070202518 - Physiogenomic method for predicting statin injury to muscle and muscle side effects: The present invention relates to the use of genetic variants of associated marker genes to predict an individual's susceptibility to muscular injury and muscular side effects in response to statin therapy. The present invention further relates to analytical assays and computational methods using the novel marker gene set. The present... Agent: Morgan & Finnegan, L.L.P.

20070202515 - Promac signature application: The present invention is directed to ProMac signature genes and methods and kits for using the ProMac signature genes for diagnostic, prognostic, or monitoring ProMac associated diseases.... Agent: Cooley Godward Kronish LLP Attn: Patent Group

20070202501 - Proteins expressed in ink cells: Purified immunocytes were analyzed for expression frequencies, and the NKIR gene expressed specifically in natural killer (NK) cells was successfully identified. The NKIR gene encodes a receptor. Agonists and antagonists for the receptor can be identified by using the receptor.... Agent: Fish & Richardson PC

20070202521 - Single molecule dna sequencing using fret based dynamic labeling: Some of the subject methods may be used to sequence single molecules of polynucleotides of interest. The methods of the invention employ fluorescent intercalators as a donor in FRET (fluorescence resonance energy transfer). Fluorescent intercalators intercalate within the double-stranded region of the primed template. The intercalators may be used as... Agent: Mila Kasan, Patent Dept. Applied Biosystems

20070202506 - Single nucleotide polymorphisms predicting cardiovascular disease: The present invention relates to an isolated polynucleotide encoding a Na+/K+ ATPase polypeptide useful in methods to identify therapeutic agents useful for treating cardiovascular diseases, the polynucleotide is selected from the group consisting of: SEQ ID 4 and SEQ ID 5 (baySNP-1765) with allelic variation G in position 240 contained... Agent: Palmer & Dodge, LLP Kathleen M. Williams

20070202524 - Targeted vectors: This invention provides therapeutic and diagnostic agent delivery vehicles, including viral vectors, that are complexed to a targeting moiety by coordinate covalent linkages mediated by a transition metal ion. The complex is typically formed with a transition metal ion that is in a kinetically labile oxidation state; after the complex... Agent: Townsend And Townsend And Crew, LLP

20070202531 - Thermal cycling device: Multi-layer devices suitable for thermal cycling processes. The devices are particularly suitable for performing polymerase chain reactions (PCR). One embodiment includes a first conducting layer, a second conducting layer adjacent to the first layer, and a third conducting layer adjacent to the second layer opposite the first layer. Insulating layers... Agent: Dickinson Wright PLLC

20070202538 - Assay modules having assay reagents and methods of making and using same: We describe assay modules (e.g., assay plates, cartridges, multi-well assay plates, reaction vessels, etc.), processes for their preparation, and method of their use for conducting assays. Reagents may be present in free form or supported on solid phases including the surfaces of compartments (e.g., chambers, channels, flow cells, wells, etc.)... Agent: Nixon & Vanderhye, PC

20070202537 - Biomarkers for als: Provided are methods for diagnosing sporadic and familial forms of amyotrophic lateral sclerosis (“ALS”) that detect conformers or conformer patterns of the copper-zinc superoxide dismutase-1 (“SOD-1”) enzyme that are common to sporadic or familial ALS individuals but distinct from SOD-1 conformers of normal individuals. Methods of identifying candidate drugs that... Agent: Foley And Lardner LLP Suite 500

20070202542 - Disposable immunodiagnostic test system: A disposable immunodiagnostic test system tests for marker proteins in a sample and includes intimately contacting passage, protein, and absorbent layers. The passage layer is non-porous and has an aperture therethrough. The protein layer is porous, has combinable proteins immobilized thereon, and enables passage of the sample therethrough. The protein... Agent: Lang Michener LLP

20070202536 - Methods and compositions for separating rare cells from fluid samples: The present invention includes methods of enriching rare cells, such as cancer cells, from biological samples, such as blood samples. The methods include performing at least one debulking step on a blood sample and selectively removing at least one type undesirable component from the blood sample to obtain a blood... Agent: David R Preston & Associates Apc

20070202535 - Methods for analyzing interactions between proteins and sugar chains: As a result of investigating the optimum conditions of methods for immobilizing proteins that interact with sugar chains onto a substrate, it was revealed that coating the surface of a slide glass with GTMS enables immobilization at a higher S/N ratio than conventionally possible. Moreover, by using a substrate to... Agent: Darby & Darby P.C.

20070202539 - Methods for quantitative proteome analysis of glycoproteins: The invention provides a method for identifying and quantifying polyglycopeptides in a sample. The method can include the steps of immobilizing glycopolypeptides to a solid support; cleaving the immobilized glycopolypeptides, thereby releasing non-glycosylated peptides and retaining immobilized glycopeptides; releasing the glycopeptides from the solid support; and analyzing the released glycopeptides.... Agent: Mcdermott, Will & Emery

20070202543 - Optical reader system and method for monitoring and correcting lateral and angular misaligments of label independent biosensors: An optical reader system and method are described herein that can detect a lateral and/or angular misalignment of one or more biosensors so that the biosensors can be properly re-located after being removed from and then reinserted into the optical reader system. In one embodiment, the biosensors are incorporated within... Agent: Corning Incorporated

20070202540 - Tape stripping methods for analysis of skin disease and pathological skin state: The present invention provides non-invasive methods for detecting, monitoring, and diagnosing skin disease and pathological skin states such as irritated skin and psoriasis. The methods include using tape stripping to analyze expression in epidermal samples, of one or more skin markers. In illustrative examples, the tape stripping is performed using... Agent: Lisa A. Haile, J.d., Ph.d. Dla Piper US LLP

20070202541 - Test system for measuring the interaction of stat 6 with ncoa-1: The present invention relates to a method to identify substances and a use of such substances which can modulate IL-4 dependent signaling involved in tumor diseases, preferably Hodgkin Lymphomas or inflammatory airway diseases, preferably asthma and a method for determining whether a substance can modulate the interaction of STAT6 with... Agent: Michael P. Morris Boehringer Ingelheim Corporation

20070202546 - Immunoassay carrier: An immunoassay in provided which comprises (a) providing an assay plate having a plurality of recesses, the recesses having solid supports therein having antibody bound thereto; (b) carrying out an assay in one or more of the recesses but not in all of the recesses having antibody bound thereto; (c)... Agent: Clark & Elbing LLP

20070202545 - Method for evaluating kidney function in a feline: Methods for (1) evaluating feline kidney function by determining ghrelin level in feline tissue or biofluid and correlating the ghrelin level directly to kidney function and (2) diagnosing kidney disease in a feline comprises determining an observed ghrelin level in a tissue or biofluid of the feline and comparing the... Agent: Colgate-palmolive Company

20070202544 - Methods for diagnosing and treating endoplasmic reticulum (er) stress diseases: The present invention provides methods and reagents to quantify endoplasmic reticulum stress (ER stress) levels, and methods and compounds for treating ER stress disorders such as diabetes. Methods for quantifying ER stress in mammalian cells are exemplified.... Agent: Fish & Richardson PC

20070202549 - Assessing risk of cerebrovascular thrombosis by measuring c4d on platelets: This invention provides for a convenient, economical, and sensitive test for assessing the risk of a person suffering from a thrombotic stroke. More specifically, it has been determined that persons at risk for cerebrovascular thrombosis have an elevated deposition of C4d on their platelets.... Agent: Townsend And Townsend And Crew, LLP

20070202550 - Novel g protein-coupled receptor protein, its dna and ligand thereof: The polypeptides in the present invention possess the effects of promoting and inhibiting the secretion of prolactin, and are thus useful as drugs for the prevention and treatment of various diseases, in terms of prolactin secretion stimulants, which are associated with the secretion of prolactin, such as hypoovarianism, spermatic underdevelopment,... Agent: Edwards Angell Palmer & Dodge LLP

20070202552 - Binding polypeptides and uses thereof: The invention provides antibodies or antigen binding fragments thereof to DR5 and HER-2. The antibodies and/or antigen binding fragments thereof comprise variant CDRs comprising highly restricted amino acid sequence diversity. The invention also provides these polypeptides as fusion polypeptides to heterologous polypeptides such as at least a portion of phage... Agent: Merchant & Gould PC

20070202553 - Dominant b cell epitopes and methods of making and using thereof: Disclosed are methods for obtaining at least one epitope suitable for detecting the presence of an antibody against a tumor associated antigen of a cancer in a sample. Kits, assays, and substrates employing the epitopes of the present invention are disclosed. Also disclosed are epitopes of NY-ESO-1 and XAGE-1b and... Agent: Smith, Gambrell & Russell, LLP (uc) Suzannah K. Sundby

20070202554 - Method for determining degree of negative effect of macrophages on vertebrate: The present invention provides a method for determining the degree of macrophage-associated negative effects on a vertebrate including a human, the method including assaying diacetylpolyamine contained in a sample collected from the vertebrate. According to the method of the present invention, metabolic conditions of macrophages can be monitored, and the... Agent: Wenderoth, Lind & Ponack, L.L.P.

20070202551 - Tgfbeta: Latent TGFβ induces constitutive activation of NF-κB but does not activate Smad signaling. Latent TGFβ may be used to identify modulators of signaling pathways that are essential for tumor maintenance. Latent TGFβ may also be used to protect a patient from treatments that induce apoptosis.... Agent: Polsinelli Shalton Flanigan Suelthaus PC

20070202547 - Methods for detecting substances which bind to the amyloid precursor protein or beta amyloid fragments, and binding compounds: Disclosed are methods for identifying and evaluating the binding properties of substances to the amyoid precursor protein (APP) or to β-amyloid (Aβ fragments of APP. Also disclosed is a class of benzofuran derivatives of formula (I), which interact specifically with APP or Aβ, and block interaction of APP or Aβ... Agent: Merck And Co., Inc

20070202548 - Screening assay to identify inhibitors of the murd enzyme using an activator-independent murd enzyme: The use of an activator-independent MurD enzyme in a screening assay to identify inhibitors of the enzyme, which assay comprises contacting the enzyme with a test compound in the presence of enzyme substrates and appropriate buffers and detecting any modulation of enzyme activity by the test compound.... Agent: Astrazeneca R&d Boston

20070202557 - Enzyme immunoassay chip and method: An enzyme immunoassay chip having, as micro channels, a reaction liquid leading-in flow passage part, a reaction flow passage part, and detection flow passage part sequentially disposed on a substrate continuously to each other, comprising an installed part for bead-bodies supporting antibodies and the bead-body flow stopping part formed in... Agent: Wenderoth, Lind & Ponack, L.L.P.

20070202556 - Methods and kits for detection of thromboxane a2 metabolites: Methods, compositions and kits are provided for measuring aspirin's anti-thrombotic effectiveness on a subject. Included are a novel assay for quickly and specifically measuring TxA2 metabolite levels in urine and correlating the levels with aspirin dose in a subject. The methods, compositions and kits utilize a novel anti TxA2 metabolite... Agent: Swanson & Bratschun, L.L.C.

20070202558 - Elisa for vegf: The vascular endothelial growth factor (VEGF) activity in a patient's bloodstream or other biological sample can serve as a diagnostic and prognostic index for cancer, diabetes, heart conditions, and other pathologies. Antibody-sandwich ELISA method and kits for VEGF as an antigen were developed to detect VEGF levels in biological samples... Agent: Merchant & Gould PC

20070202559 - Chemical sensor enhanced by direct coupling of redox enzyme to conductive surface: The invention provides a method, apparatus and system for detecting electrochemical oxidoreduction activity mediated by a redox enzyme at a site remote from the enzyme. In one embodiment, the method comprises immobilizing the redox enzyme on a first region of a conductive surface and contacting a substrate capable of producing... Agent: Karen S. Canady Canady & Lortz LLP

20070202561 - Electronic detection immunoassays that utilize a binder support medium: A binder support medium-based immunoassay device and method is provided, utilizing the catalyzed formation of dopants and their subsequent effects on electroconductive polymers to detect an analyte of interest.... Agent: David W. Highet, Vp And ChiefIPCounsel Becton, Dickinson And Company

20070202560 - Resin microchannel array, method of manufacturing the same and blood test method using the same: A resin microchannel array includes a first substrate having a plurality of depressions, each depression having an inlet port at one end and an outlet port at another end, and walls sectioning the depressions, each wall having a micro groove connecting the depressions, and a second substrate having a flat... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C.

20070202563 - Chondroitinase abc i and methods of analyzing therewith: The invention relates to chondroitinase ABC I and uses thereof. In particular, the invention relates to recombinant and modified chondroitinase ABC I, their production and their uses. The chondroitinase ABC I enzymes of the invention are useful for a variety of purposes, including degrading and analyzing polysaccharides such as glycosaminoglycans... Agent: Wolf Greenfield & Sacks, P.C.

20070202564 - Microbial streaking device: A streaker device for streaking a microbial inoculum for single colonies on the surface of a solid growth medium. The streaking device has a row of spaced apart contact surfaces for contact with the surface of the solid growth medium. The spaced apart contact surfaces are resiliently flexibly supported by... Agent: Dykas, Shaver & Nipper, LLP

20070202565 - Growth plotter: A digital growth plotter according to the present invention includes a housing for being conveniently and ergonomically held by a caregiver. The growth plotter includes a processor, input devices, a data storage device, and a display. The housing may include a battery for energizing the electronic components. The input device... Agent: Harshaw Research, Inc.

20070202567 - Diagnostics and therapeutics for diseases associated with arginyl aminopeptidase rnpep (rnpep): The invention provides a human RNPEP which is associated with the cardiovascular diseases, cancer, dermatological diseases, hematological diseases, neurological diseases, urological diseases, respiratory diseases. The invention also provides assays for the identification of compounds useful in the treatment or prevention of cardiovascular diseases, cancer, dermatological diseases, hematological diseases, neurological diseases,... Agent: Banner & Witcoff, Ltd.

20070202566 - Hydrolases, nucleic acids encoding them and methods for making and using them: The invention provides hydrolases, polynucleotides encoding them, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides, e.g., enzymes, having a hydrolase activity, e.g., an esterase, acylase, lipase, phospholipase (e.g., phosphlipase A, B, C and D activity, patatin activity, lipid acyl... Agent: Diversa C/o Mofo S.d.

20070202568 - Insertion of furin protease cleavage sites in membrane proteins and uses thereof: Cleavage site for the protease furin is inserted between domains of a membrane glycoprotein. Upon cleavage by furin in the trans-Golgi network, the protein is separated into individual membrane-free domain that retains its native conformation. This protocol can be used to produce virus membrane protein domains for structural analysis and... Agent: Fulbright & Jaworski, L.L.P.

20070202571 - Method for microbial production of amino acids of the spartate and/or glutamate family and agents which can be used in said method: e

20070202572 - Microorganisms for therapy: Therapeutic methods and microorganisms therefor are provided. The microorganisms are designed to accumulate in immunoprivileged tissues and cells, such as in tumors and other proliferating tissue and in inflamed tissues, compared to other tissues, cells and organs, so that they exhibit relatively low toxicity to host organisms. The microorganisms also... Agent: Fish & Richardson, PC

20070202569 - Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby: Namely, the present invention includes a protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein; a gene coding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this... Agent: Kilyk & Bowersox, P.l.l.c.

20070202573 - Soluble fusion proteins comprising heterologous polypeptides: A soluble fusion protein is disclosed. The soluble fusion protein comprises at least one soluble polypeptide and a heterologous polypeptide being fused thereto, the heterologous polypeptide being normally insoluble and/or suboptimally expressed when expressed in a cell, wherein the at least one soluble polypeptide has an amino acid sequence at... Agent: Martin D. Moynihan Prtsi, Inc.

20070202574 - Novel saccharothrix strain an antibiotics derived therefrom, i.e. mutactimycins and aldgamycins: The invention relates to a novel strain Saccharothrix actinomycete SA 103 deposited at CNCM on 16 Feb. 2004, number 1-3160 or a mutant strain thereof; a method and a medium for selection of said strain; and a method for the production of a broth, active concentrate and active compounds from... Agent: Foley And Lardner LLP Suite 500

20070202575 - Oligodeoxynucleotide and its use to induce an immune response: wherein the central CpG motif is unmethylated, R is A or G, and Y is C or T, as well as an oligodeoxynucleotide delivery complex and a pharmacological composition comprising the present inventive oligodeoxynucleotide, and a method of inducing an immune response by administering the present inventive oligodeoxynucleotide to a... Agent: Klarquist Sparkman, LLP

20070202576 - Detectable labeled nucleoside analogs and methods of use thereof: The invention relates to detectable labels useful for detection of nucleotide sequences. Specifically, the invention relates to labeled-imidazole-PEG compounds, such as nucleosides, nucleotides, and nucleic acids incorporating such compounds, and methods utilizing such compounds. The invention further relates to kits comprising labeled imidazole-PEG compounds.... Agent: Roche Molecular Systems Inc Patent Law Department

20070202577 - Method for the production of hyperbranched polysaccharide fractions: The invention relates to a method for producing hyperbranched amylopectin having a mean molecular weight ranging between 2,000 and 29,000 Dalton and an average degree of branching of more than 10 percent and less than 20 percent, said degree of branching being expressed in mole percent of the anhydroglucose units... Agent: Hamilton, Brook, Smith & Reynolds, P.C.

20070202578 - Production of globosides oligosaccharides using metabolically engineered microorganisms: The present invention relates to the large scale in vivo synthesis of globosides oligosaccharides; especially globotriose, globotetraose and globopentaose, which are the carbohydrate portions of globotriosylceramide (Gb3Cer), globotetraosylceramide (Gb4Cer) and globopentaosylceramide (Gb5Cer) respectively. It also relates to high yield production of potential anticancer vaccines of the globo-series glycosphingolipids, including the... Agent: Foley And Lardner LLP Suite 500

20070202579 - Production of isoprenoids: The present invention relates to a process for the production of isoprenoids Coenzyme Q-10 by microorganisms. More particularly, the present invention relates to a process for increased production of Coenzyme Q-10 by microorganisms of the genus Rhodobacter, preferably of the species R. sphaeroides which have been transformed with one or... Agent: Nixon & Vanderhye, PC

20070202580 - Synthesis of mono and di esters from biologically-produced 1,3-propanediol: A process for forming an ester from 1,3-propanediol comprising providing 1,3-propanediol with at least 90% biobased carbon, contacting the 1,3-propanediol with an acid, thereby forming the ester, and recovering the ester is provided. The acid can be an organic acid. Additionally, a process for producing an ester, either or both... Agent: Mccarter & English, LLP Basil S. Krikelis

20070202581 - Method for the production of polyhydroxyalkanoic acid: Embodiments of the invention relate to the microbial production of polyhydroxyalkanoic acids, or polyhydroxyalkanoates (PHA), from substrates which cannot be used as a source of carbon and/or energy for microbial growth or PHA synthesis and which have microbial and environmental toxicity. According to one embodiment of the invention, a process... Agent: Knobbe Martens Olson & Bear LLP

20070202583 - Fermentation process: The present invention provides a process of fermenting starch-containing material, comprising i) fermenting starch-containing material by subjecting said material to a carbohy-drate-source generating enzyme and a fermenting microorganism, ii) reducing the particle size of the starch-containing material obtained from step i) and/or liquefying the starch-containing material obtained from step i),... Agent: Novozymes North America, Inc.

20070202582 - Process for the production of ethanol from algae: The present invention describes a process for the production of ethanol by harvesting starch-accumulating filament-forming or colony-forming algae to form a biomass, initiating cellular decay of the biomass, fermenting the biomass in the presence of a yeast, and the isolating the ethanol produced. The present invention further relates to processing... Agent: Vance Intellectual Property, PC

20070202584 - Chloride ion-resistant sulfur-oxidizing bacteria: A microorganism having an ability to oxidize sulfur even at high chloride ion concentration is provided. Specifically, a microorganism belonging to the genus Acidithiobacillus having the ability to oxidize sulfur even at high chloride ion concentration is provided. A method for bacterial leaching of copper sulfide ores and a method... Agent: Birch Stewart Kolasch & Birch

20070202585 - Microorganism having the improved gene for hydrogen-generating capability, and process for producing hydrogen using the same: A hydrogen producing method by culturing a microorganism having a hydrogenase gene, in which a lactic acid biogenetic path and a succinic acid biogenetic path in anaerobic metabolic paths are inactivated, under an anaerobic condition in the presence of organic substrate. The microorganism may further have a formate dehydrogenase gene.... Agent: Nixon & Vanderhye, PC

20070202586 - Crystal structure of soluble glutaminyl cyclase: The invention relates to a crystalline structure of glutaminyl cyclase (QC). The invention also relates to the methods of preparing the crystalline structure of QC and the methods for identifying candidate inhibitors of QC. This invention further provides a structural basis for the rational design or identification of new inhibitors... Agent: Akin Gump Strauss Hauer & Feld L.L.P.

20070202587 - Recombinant aav production in mammalian cells: The present invention includes methods and compositions for the production of high titer recombinant Adeno-Associated Virus (rAAV) in a variety of mammalian cells. The disclosed rAAV are useful in gene therapy applications. Disclosed methods based on co-infection of cells with two or more replication-defective recombinant herpes virus (rHSV) vectors are... Agent: Edwards Angell Palmer & Dodge LLP

20070202588 - Petroleum biosorbent based on strains of bacteria and yeast: This invention relates to biosorbents used for clean-up of petroleum-based contamination of water. The invention can be used for clean-up of natural and artificial water reservoirs, sewers, and liquid waste that is contaminated with petroleum and petroleum products. The invention absorbs petroleum-based contamination and degrades it using strains of bacteria,... Agent: United States Department Of Energy

20070202589 - Cell culture plate and method of manufacturing the same: A cell culture plate has a plurality of flow channels, uneven pattern areas and through holes. The flow channels are formed between the uneven pattern areas, and culture solution flows from the flow channels into the uneven pattern areas or from the uneven pattern areas into the flow channels. The... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C.

20070202591 - Altered superantigen toxins: The present invention relates to genetically attenuated superantigen toxin vaccines altered such that superantigen attributes are absent, however the superantigen is effectively recognized and an appropriate immune response is produced. The attenuated superantigen toxins are shown to protect animals against challenge with wild type toxin. Methods of producing and using... Agent: Elizabeth Arwine, Esq. U.s. Army Medical Research & Materiel Command

20070202594 - Carrier for cell culture and method for culturing cells: A carrier for cell culture which enables cells to efficiently grow thereon is provided. A carrier comprises a particulate base body mainly formed of a resin material and a coating layer. The coating layer is formed from particles of a calcium phosphate-based compound, and the particles are partially embedded in... Agent: Greenblum & Bernstein, P.L.C

20070202593 - Cell-targeted ikb and methods for the use thereof: Activation of nuclear factor kB (NF-kB) is involved in a number of diseases such as viral and bacterial infections, and cell proliferative disorders such as cancer and autoimmune disease. In certain instances, constitutive NF-kB activity has also been liked to the resistance of certain cancers to chemo and radiation therapy.... Agent: Fulbright & Jaworski L.L.P.

20070202592 - Pluripotent cells distributed ubiquitously in animal tissue, which proliferate selectively in lower-serum culture: It is intended to provide a pluripotent cell having the following properties: (1) being contained in a mixed-cell type population obtained by enzymatic treatment of the tissue collected from an animal; (2) being contained in a sedimented cell population obtained by centrifugating the mixed-cell type population of the property (1);... Agent: Wenderoth, Lind & Ponack, L.L.P.

20070202590 - Process for producing multipotential stem cell origination in testoid cell: The present invention provides a method of producing pluripotent stem cells, which comprises culturing testis cells using a medium containing glial cell derived neurotrophic factor (GDNF) or an equivalent thereto to obtain pluripotent stem cells. The medium can further contain leukemia inhibitory factor (LIF), epidermal growth factor (EGF), basic fibroblast... Agent: Leydig Voit & Mayer, Ltd

20070202595 - Human embryonic stem cell lines and methods of use thereof: The invention provides novel human embryonic stem cell lines. The invention further provides human embryonic stem cell lines that are genetically related and immunologically identical. The invention further provides methods of deriving, propagating and using such lines, optionally under animal-free conditions.... Agent: Wolf Greenfield & Sacks, P.C.

20070202596 - Selective antibody targeting of undifferentiated stem cells: This invention provides a system for producing differentiated cells from a stem cell population for use wherever a relatively homogenous cell population is desirable. The cells contain an effector gene under control of a transcriptional control element (such as the TERT promoter) that causes the gene to be expressed in... Agent: Geron Corporation

20070202597 - Process for recycling solid supports for cultivation of anchorage-dependent cells: This invention relates to methods for use in industrial production of proteins. Specifically, the present invention provides a method of recycling solid supports for cultivation of anchorage-dependent cells such as, e.g., microcarriers and Fibra-Cel® disks. Solid supports recycled by a method of the present invention allow obtaining a protein productivity... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association

20070202599 - Composition and method for production of transformed cells: A composition useful for the production of transformed eukaryotic cells is described. The composition comprises submucosal tissue and a nucleic acid sequence. The nucleic acid sequence is typically recombinant DNA including gene(s) encoding for one or more biofunctional proteins. The submucosal tissue component of the present composition comprises the tunica... Agent: Barnes & Thornburg LLP

20070202598 - New transfection reagents: Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)l, or {(CH2)i-Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester,... Agent: Invitrogen Corporation C/o Intellevate

20070202600 - Transfection reagents: Q is selected from the group consisting of N, O and S; L is any bivalent organic radical capable of linking each Q, such as C, CH, (CH2)I, or {(CH2)i—Y—(CH2)j}k, wherein Y is selected from the group consisting of CH2, an ether, a polyether, an amide, a polyamide, an ester,... Agent: Invitrogen Corporation C/o Intellevate

20070202601 - Method for macerating biological material and apparatus for carrying out said method: In order to ensure consistently good maceration of biological material in an electroporation reactor, it is proposed to monitor the conductivity of the mixture therein and to detect any arcing which occurs therein. The results of such monitoring are used to modify the operating voltage of the electroporation reactor and/or... Agent: Factor & Lake, Ltd.

20070196849 - Double-ligation method for haplotype and large-scale polymorphism detection: The present teachings provide methods, compositions, and kits for querying the identity of a target polynucleotide strand comprising. In some embodiments, the present teachings provide a method comprising forming a reaction complex comprising the target polynucleotide strand hybridized to an upstream probe, a middle probe, and a downstream probe, wherein... Agent: Mila Kasan, Patent Dept. Applied Biosystems

20070196830 - Method for identification of medically relevant fungi: Multiple species of fungi in an environment can be identified in one sample by extracting and purifying fungal DNA in the sample. PCR is then performed followed by cloning the amplifed DNA and transforming the DNA into bacteria for purposes of growing the organisms. Colonies of the growth containing transformed... Agent: Glenna Hendricks, Esq.

20070196840 - Method of determining outcome of non small-cell lung cancer according to xrcc3 polymorphism: l

20070196832 - Methods for mutation detection: The invention relates to methods for detecting a mutation in a nucleic acid. Methods of the invention are useful for detecting and identifying mutations that are indicative of disease or the predisposition for disease.... Agent: Goodwin Procter LLP Patent Administrator

20070196861 - Method for forming film, base plate with film, sensor, and liquid composition: A method for forming a film comprises: preparing a liquid composition containing a substance for detecting an object and a polyether derivative having a weight-average molecular weight of 2000 or less; supplying the liquid composition to a side adjacent to a first surface of a base plate by using a... Agent: Oliff & Berridge, PLC

20070196892 - Method of converting a fermentation byproduct into oxygen and biomass and related systems: In one aspect, the invention relates to a method of converting byproducts of a fermentation process into oxygen and biomass. Related methods, systems, and other aspects are also described.... Agent: King & Schickli, PLLC

20070196810 - Polymerized hemoglobin media and its use in isolation and transplantation of islet cells: Solutions and suspensions comprising polymerized hemoglobin derived from human blood are disclosed. The solutions and suspensions may comprise cell culture medium, an enzyme (such as a protease), and/or a buffer. Processes of preparing the solutions and suspensions are also disclosed. The solutions and suspensions may be employed in methods of... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP

20070196811 - Use of flavanol derivatives for the cryopreservation of living cells: A medium for storing a biological sample, in particular sperm, oocytes, embryos and stem cells, in a refrigerated, frozen or vitrified state. The medium includes a balanced salt solution, a cryoprotectant, and a 4-thioderivative of flavan-3-ol of formula (I) with cryoprotective effect... Agent: Berenbaum, Weinshienk & Eason, P.c

20070196812 - Effective method of function analysis and screening of protein utilizing fluorescent light generated by cell-free protein synthesizing system: A method of detecting a reaction between a fluorescently labeled protein synthesized in a cell-free protein synthesizing system and a sample solution simply, in a short time and at high precision is provided. A case of detecting a binding reaction between an antibody fused with GFP and a sugar on... Agent: Scully Scott Murphy & Presser, PC

20070196816 - Engineered stimulus-responsive switches: Ligand-responsive chimeric proteins are engineered to cause a detectable output in response to a preselected stimulus. The engineered chimeric proteins are useful in industrial, commercial, medical, and scientific fields as a tool for programming a cellular response to a stimulus of choice and for use with in vitro assays. The... Agent: Goodwin Procter LLP Patent Administrator

20070196813 - Extraction of substances of interest from blood for mass spectrometric analysis: In a method for preparing a blood sample for subsequent processing in a mass spectrometry laboratory, substances of interest are extracted from whole blood, blood plasma or blood serum immediately after the blood sample has been taken from a subject. The extraction is carried out by means of reversible immobilization... Agent: Law Offices Of Paul E. Kudirka

20070196814 - Method for producing vascular wall lesion using platelets: It is an object of the present invention to provide a cell culture system in which platelet aggregation that is found in lesions of arteriosclerosis, restenosis, and the like is reproduced. The present invention provides a method for producing a cell culture system containing aggregated platelets, which comprises culturing platelets... Agent: Birch Stewart Kolasch & Birch

20070196815 - Positive selection procedure for optically directed selection of cells: Provided are methods and systems that can be used as a means of positive selection by initiating light mediated DNA repair in cells, having photosensitive repair systems, with desired characteristics from libraries of mutants that have been deactivated with a lethal light source.... Agent: Needle & Rosenberg, P.C.

20070196820 - Devices and methods for enrichment and alteration of cells and other particles: The invention features a device for the deterministic separation of analytes coupled to a reservoir containing a reagent that alters a magnetic propert of the analyte. Exemplary methods include the enrichment of a sample in a desired analyte (e.g., using deterministic separation) or the alteration of a desired analyte in... Agent: Clark & Elbing LLP

20070196822 - Method for characterizing compounds: An in vitro method for characterising the activity and/or the function of a test agent on signalling pathways and/or cellular processes within a host cell is disclosed which is conducted on living cells in a none-destructive manner. The method of the invention may be used with an imaging system and... Agent: Ge Healthcare Bio-sciences Corp. Patent Department

20070196821 - Methods for identifying markers for early-stage human cancer, cancer progression and recurrence: A method is described to identify secreted proteins identified with stages of malignancy of cancer. The proteins are initially identified by trapping them with a fluorescent protein containing vector that can insert in any gene. The secreted proteins are initially identified by their fluorescence. Secreted proteins identifying tumors with specific... Agent: Anticancer C/o Mofosd Attn: Denise Caldwell

20070196819 - Patterning method for biosensor applications and devices comprising such patterns: A patterned substrate for biosensing applications, wherein the pattern includes hydrophilic and hydrophobic areas, and selected ones of the areas include at least at least one reporter molecule, a property of which is detectable. A method of making a patterned substrate includes performing a stamping procedure to provide a pattern... Agent: Young & Thompson

20070196817 - Sampling device: A method and a device for collecting a sample of material from a surface. A ball (2) within a socket (3) such that the ball is free to rotate in any direction. As the ball rolls across the surface the sample of material is collected by the ball and is... Agent: Foley And Lardner LLP Suite 500

20070196824 - Simultaneous quantification of nucleic acids in diseased cells: Processes and methods for the simultaneous quantification of nucleic acids in diseased cells that are based on real-time PCR are provided. The real-time PCR protocol is an excellent tool for reliable quantification of in vitro drug screening and evaluation protocols to determine the efficacy of potential anti-viral agents. Quantification using... Agent: Merchant & Gould PC

20070196823 - Surrogate markers for viral infections and other inflammatory responses: Compositions and methods for the detection, diagnosis and treatment of BVDV and other viruses are provided.... Agent: Dann, Dorfman, Herrell & Skillman

20070196818 - Using nucleic acids for clinical microbiology testing: A process for analysing a biological sample, comprising the steps of: (a) identifying a micro-organism present within the sample; and (b) determining the effect of one or more antimicrobial(s) on a micro-organism from the sample, wherein steps (a) and (b) are performed by analysing the micro-organism's nucleic acid. Steps (a)... Agent: Cooley Godward Kronish LLP Attn: Patent Group

20070196855 - Cell migration assay: The present invention is directed to a modified cell migration assay allowing for improved identification and discrimination of chemokine receptor antagonists from non-specific blockers.... Agent: Brinks Hofer Gilson & Lione

20070196839 - Considerations, evaluations, investigations and searching: Methods of considering DNA based links between two or more situations are provided. Amongst the methods is a method including obtaining a plurality of test results, each test result relating to a situation, each test result including information on the DNA from that situation, the plurality of test results providing... Agent: Merchant & Gould PC

20070196848 - Detection of phosphorylated eif2-alpha as a diagnostic test for efficacy and sensitivity of translation initiation inhibitors in the treatment of cancer and other proliferative diseases: The present invention relates to methods for determining the effectiveness of one or more agents for treating one or more disorders associated with aberrant cellular proliferation. Screening assays for the discovery of agents that alter eIF2α phosphorylation, inhibit translation initiation and/or inhibit aberrant cellular proliferation are also provided.... Agent: Banner & Witcoff, Ltd.

20070196829 - Essential and important genes of pseudomonas aeruginosa and the use thereof to design or identify antibacterial agents: The invention includes a database of candidate essential genes in Pseudomonas aeruginosa, as well as other important genes that, when mutated, lead to a growth attenuated phenotype. Such genes and mutants of such genes are important for identifying antibacterial agents suitable for treating and preventing Pseudomonas aeruginosa infections. The invention... Agent: Novartis Vaccines And Diagnostics Inc.

20070196835 - Gene expression profiling for identification monitoring and treatment of rheumatoid arthritis: A method is provided in various embodiments for determining a profile data set for a subject with rheumatoid arthritis or inflammatory conditions related to rheumatoid arthritis based on a sample from the subject, wherein the sample provides a source of RNAs. The method includes using amplification for measuring the amount... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.C.

20070196831 - Human sample matching system: Methods and apparatus for a human sample (S), analyzing the sample (S) and then determining a match with a member of the opposite sex is disclosed. In one embodiment, a customer purchases an AromaMatch™ Test Kit (14), which comprises a bottle of cleaning solution (20), a cotton ball (22) a... Agent: Giaccherini

20070196850 - Identification of aging genes through large-scale analysis: High throughput methods for screening genetic variants that are phenotypically distinguishable are provided. Methods for identifying “long-lived” genetic variants among a set of variants are also provided. Methods for identifying pharmaceutical compounds that can promote longevity in various subjects, including mammals, and that can delay the onset of various diseases... Agent: Woodcock Washburn LLP

20070196852 - Labeling reagent: The current invention restates substituted indole nucleosides as both terminal as well as internal building blocks of labeled oligonucleotide probes for the detection, analysis and quantitation of nucleic acids. The substituent comprises a linker and a detectable group or a linker and a reactive group for post synthesis coupling. These... Agent: Roche Diagnostics Operations Inc.

20070196834 - Method and system for the generation of large double stranded dna fragments: Synthesis of long chain molecules such as DNA is carried out rapidly and efficiently to produce relatively large quantities of the desired product. The synthesis of an entire gene or multiple genes formed of many hundreds or thousands of base pairs can be accomplished rapidly and, if desired, in a... Agent: Foley & Lardner LLP

20070196827 - Method for detecting gene mutation and kit for detecting gene mutation: A solution including a single-stranded nucleic acid (10) having a target base (11) related to SNP or the like is mixed with a solution including two kinds of single-stranded detecting nucleic acids (20a) and (20b) complementary to partial sequences that sandwich the target base (11) between them to hybridize the... Agent: Bell, Boyd & Lloyd, LLP

20070196843 - Method for identification and monitoring of epigenetic modifications: The present invention provides novel methods for identifying and monitoring epigenetic modifications, such as imprinted genes, using microarray based technology. Specifically, the invention detects imprinted genes by the presence of overlapping closed and open chromatin markers. The invention also discloses a method for detecting the loss of imprinting on a... Agent: Quarles & Brady LLP

20070196854 - Method for producing polymers: The invention relates to a method for producing polymers, in particular synthetic nucleic acid double strands of optional sequence, comprising the steps: (a) provision of a support having a surface area which contains a plurality of individual reaction areas, (b) location-resolved synthesis of nucleic acid fragments having in each case... Agent: Rothwell, Figg, Ernst & Manbeck, P.C.

20070196838 - Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites: The present invention provides compositions and methods for recombinational cloning. The compositions vectors having multiple recombination sites and/or multiple topoisomerase recognition sities. The methods premit the simultaeous cloning of two or more different nucleic acid molecules. In some embodiments the molecules are fused together while in other embodiments the molecules... Agent: Invitrogen Corporation C/o Intellevate

20070196847 - Methods for detection of chloral hydrate in dichloroacetic acid: Methods for detecting chloral hydrate in dichloroacetic acid are described.... Agent: Woodcock Washburn LLP

20070196837 - Methods for mapping signal transduction pathways to gene expression programs: The invention relates to improved methods of identifying the gene expression programs that are regulated by a signal transduction pathway. The invention also provides methods of identifying agents which modulate signal transduction pathway. The invention also provides improved methods of isolating DNA fragments to which a protein of interest is... Agent: Bozicevic, Field & Francis LLP

20070196853 - Methods for rapid genotype screening: The present invention provides a method to rapidly provide genotype screening of a plurality of biological samples in a designated well of a microwell container for remote user by a screening laboratory. The screening method can be used to determine if a biological sample is heterozygous, homozygous or wild for... Agent: Butler, Snow, O'mara, Stevens & Cannada PLLC

20070196836 - Microarray substrate, method of use, and products comprising the microarray substrate: e

20070196833 - Open channel solid phase extraction systems and methods: The invention provides, inter alia, capillary extraction devices, and methods of making and using the same.... Agent: Phynexus, Inc.

20070196825 - Optical sensors based on hybrid aptamer/conjugated polymer complexes: An optical sensor for detecting a target comprising a singlestranded aptamer complementary to said target, and a water-soluble cationic polythiophene derivative of the following formula: wherein “n” is an integer ranging from 6 to 100, is disclosed. The optical sensor allows for the detection of targets selected from the group... Agent: Knobbe Martens Olson & Bear LLP

20070196841 - Physiogenomic method for predicting response to diet: The present invention relates to the use of genetic variants of associated marker genes to predict an individual's response to diet. The present invention further relates to analytical assays and computational methods using the novel marker gene set. The present invention has utility for developing personalized diet regimens to optimize... Agent: Morgan & Finnegan, L.L.P.

20070196846 - Polymerases for nucleotide analogue incorporation: Compositions that include polymerases with features for improving entry of nucleotide analogues into active site regions and for coordinating with the nucleotide analogues in the active site region are provided. Methods of making the polymerases and of using the polymerases in sequencing and DNA replication and amplification as well as... Agent: Quine Intellectual Property Law Group, P.C.

20070196828 - Process for detecting or quantifying more than one nucleic acid in library via terminal attachment of non-inherent universal detection targets to nucleic acid copies produced thereby: This invention provides novel compositions and processes for analyte detection, quantification and amplification. Nucleic acid arrays and libraries of analytes are usefully incorporated into such compositions and processes. Universal detection elements, signaling entities and the like are employed to detect and if necessary or desirable, to quantify analytes. Amplification of... Agent: Enzo Biochem, Inc.

20070196844 - Protein pdx1 as a marker for breast cancer: The present invention relates to the diagnosis of breast cancer. It discloses the use of protein PDX1 (peroxiredoxin 1) in the diagnosis of breast cancer. It relates to a method for diagnosis of breast cancer from a liquid sample, derived from an individual by measuring PDX1 in said sample. Measurement... Agent: Roche Diagnostics Operations Inc.

20070196842 - Rapid analysis of variations in a genome: The invention provides a method useful for determining the sequence of large numbers of loci of interest on a single or multiple chromosomes. The method utilizes an oligonucleotide primer that contains a recognition site for a restriction enzyme such that digestion with the restriction enzyme generates a 5′ overhang containing... Agent: Morrison & Foerster LLP

20070196845 - Snp discrimination assay, and dna chips for snp discrimination: Disclosed herein is an SNP discrimination assay for discriminating base species of an SNP in a specific gene in a sample, which includes the steps of hybridizing four detection probes, which have at least a flanking sequence around an SNP in the gene and are different in base species at... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP

20070196826 - Solvent for dissolving nucleic acid, nucleic acid-containing solution and method of preserving nucleic acid: As a solvent for dissolving a nucleic acid such as DNA or RNA, a solvent comprising an ionic liquid having, for example, ammonium cation, imidazolium cation orpyridinium cation is used and the nucleic acid is dissolved therein and preserved. Thus, a nucleic acid such as DNA or RNA can be... Agent: Westerman, Hattori, Daniels & Adrian, LLP

20070196851 - System and method for selecting differentially dependent genes from gene expression data: Dependence between expression levels of different genes is identified through a multivariate method of statistical analysis of single color microarray gene expression data. An algorithm is applied to gene data to identify those genes that are likely to change their relationship with all other genes, and select such genes for... Agent: Blank Rome LLP

20070196857 - Determination of risk and treatment of complications of prematurity: In one aspect of the present invention there is provided a method for determining the risk of developing a complication of preterm birth in a patient born before 40 weeks of gestation or weighing 10% less than the average for the patient's gestational age. The method involves measuring serum IGF-I... Agent: David S. Resnick

20070196864 - Method and kits for detecting cerebrospinal fluid in a sample: The present invention relates to detection of the presence or absence of cerebrospinal fluid (CSF) in a sample, in particular to the analysis of the CSF protein lipocalin-type prostaglandin D2 synthase (L-PGDS). The present invention provides assays for the analysis of PGDS indicating the presence or absence of CSF in... Agent: Wiggin And Dana LLP Attention: Patent Docketing

20070196862 - Method for detecting a response of each probe zone on a test strip: A method for detecting a response of each probe zone on a test strip is provided. The present method includes providing a test strip having a color pattern displayed thereon. The color pattern occurs in response to a tested solution contacting with the test strip and including a plurality of... Agent: Berkeley Law & Technology Group, LLP

20070196860 - Methods for measuring real time kinase activity: The present invention relates to methods for detecting and/or measuring the activity of a specific kinase, with the methods comprising contacting one or more kinases with a binding agent to isolate a specific kinase of interest. The isolated kinase is then contacted with a kinase activity sensor, where the kinase... Agent: Invitrogen Corporation C/o Intellevate

20070196856 - Methods of determining activity of ryanodine receptor modulators: Methods for identifying modulators of ryanodine receptors are disclosed. In preferred embodiments the activity of the ryanodine receptor is stimulated to a baseline level and the ability of a test compound to increase or decrease the baseline level indicates that the test compound is a modulator of ryanodine receptor activity.... Agent: Stout, Uxa, Buyan & Mullins LLP

20070196859 - Novel antibacterial agents: This invention relates to novel multibinding compounds (agents) that are antibacterial agents. The multibinding compounds of the invention comprise from 2-10 ligands covalently connected by a linker or linkers, wherein each of said ligands in their monovalent (i.e., unlinked ) state have the ability to bind to a an enzyme... Agent: Theravance, Inc.

20070196863 - Prion protein detection: An example embodiment of the invention includes a method of performing an assay comprising the steps of (1) providing a multimode waveguide; (2) fixing one or more fluidic cells to the multimode waveguide, wherein each of the one or more fluidic cells including a surface having a portion thereof sealed... Agent: Mcnees Wallace & Nurick LLC

20070196858 - Separation matrix and method of purification: The present invention relates to a separation matrix comprised of a porous support to which ligands have been immobilised, wherein said ligands comprise at least one sulphonamide and the R group of the sulphonyl comprises an aromatic group. The nitrogen of the sulphonamide may be a secondary or tertiary amine.... Agent: Ge Healthcare Bio-sciences Corp. Patent Department

20070196871 - Forensic test for human semen: Lateral flow immunochromatographic strip tests for the detection of human semen, method of detecting human semen, and methods of manufacturing ICS tests for the detection of human semen are described... Agent: Baker & Mckenzie LLP

20070196867 - Gpcr expressing cell lines and antibodies: The present invention provides expression vectors that facilitate high levels of expression of GPCR proteins. Encompassed by the invention are methods and compositions for recombinant cell lines expressing GPCR proteins with the aid of the expression vectors of the instant invention. The recombinant cell lines of the instant invention express... Agent: Morgan, Lewis & Bockius LLP (sf)

20070196872 - Materials and methods for identifying agents that modulate norrin, norrin mimetics, and agents identified thereby: The specification discloses materials and methods for screening and identifying reagents, which modulate Norrin activity as it relates to Wnt pathway signaling. Preferably, agents identified thereby modulate bone remodeling and/or lipid levels, and can be Norrin mimetics and Norrin agonists, as well as other agonists and mimetics of the LRP5/Norrin/Frizzled4... Agent: Drinker Biddle & Reath (dc)

20070196868 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP

20070196869 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP

20070196870 - Methods and compositions for detecting receptor-ligand interactions in single cells: The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The... Agent: Bozicevic, Field & Francis LLP

20070196865 - Methods of screening compositions for g protein-coupled receptors aganist agonists: Methods of screening compositions for G protein-coupled receptor (“GPCR”) agonist activity against two or more GPCRs in a multiplex receptor assay format are disclosed. One or more cells expressing at least two different GPCRs are exposed to a test composition and it is determined whether or not the composition gives... Agent: Dorsey & Whitney LLP

20070196866 - Modulators of ion channel trpa1: This invention provides methods for modulating activities of noxious ion channel TRPAI and methods for screening for novel modulators of TRPAI. Compounds such as bradykinin, eugenol, gingerol, methyl salicylate, allicin, and cinnamaldehyde can be employed to activate cold themosensor TRPAI. These TRPAI agonists can be used in screenings methods to... Agent: Genomics Institute Of The Novartis Research Foundation

20070196873 - Pain signaling molecules: The invention relates generally to novel genes expressed in normal but not Neurogenin-1-deficient animals. The invention relates specifically to a novel family of G protein-coupled receptors and a novel family of two-transmembrane segment proteins that are expressed in dorsal root gan