|
FREE patent keyword monitoring and additional FREE benefits. |
![]() |
|
|
USPTO Class 435 | Browse by Industry: Previous - Next | All 02/2007 | Recent | 09: Oct | Sept | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 08: Dec | Nov | Oct | Sp | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 07: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Mar | Feb | Jan | | 06: Dec | Nov | Oct | Sep | Aug | Jul | Jun | May | Apr | Chemistry: molecular biology and microbiology inventions 02/07Recently published patent applications awaiting approval from the USPTO. Recent week's RSS XML file available below.Listing format for abstract view: USPTO application #, Title, Abstract excerpt,Patent Agent. Listing format for list view: USPTO National Class full category number, title of the patent application. 02/22/2007 > 158 patent applications in 42 patent subcategories. 20070042337 - Isochoric method and device for reducing the probability of ice nucleation during preservation of biological matter at subzero centigrade temperatures: Because ice-I is less dense than water, the formation of an ice nucleus in an isochoric (constant volume) system containing water at pressures lower than about 200 MPa will cause an increase in pressure. This increase in pressure increases the energy required for reducing the probability for ice nucleation in... Agent: Gordon & Rees LLP 20070042341 - Biodegradable polymer-ligand conjugates and their uses in isolation of cellular subpopulations and in cryopreservation, culture and transplantation of cells: The invention discloses a biodegradable particle-cell composition having at least one biodegradable particle, at least one receptive group covalently linked thereto, and a cell anchored thereto. The particle can be polylactide, a polylactide-lysine copolymer, polylactide-lysine-polyethylene glycol copolymer, starch, or collagen. The receptive group can be an antibody, a fragment of... Agent: Foley And Lardner LLP Suite 500 20070042340 - Method and apparatus for protecting biological specimens: A biological specimen is preserved by surrounding the biological specimen with a protective enclosing structure. The protective enclosing structure reacts with corrosive components in the surrounding atmosphere or environment to reduce their degradative effect and also protects the preparations from bacterial and fungal growth.... Agent: Fish & Richardson P.C. 20070042338 - Method for storing tumor cells: The present invention relates to a method for storing cells, wherein the cells are stored in a composition comprising a base nutritive medium and liposomes at temperatures in the range of −196° C. to 37° C., characterized in that the liposomes comprise one or more sterols and that the cells... Agent: Arnold & Porter LLP Attn:IPDocketing Dept. 20070042339 - Preservation of biomaterials with transported preservation agents: Biomaterial are preserved by exposing them to a preservation agent having preservation properties. The biomaterial has at least one transporter that allows uptake of the preservation agent into the biomaterial for loading the biomaterial with the preservation agent to an intracellular concentration sufficient for preserving the biomaterial. The preservation agent... Agent: Nutter Mcclennen & Fish LLP 20070042342 - Separation systems of frozen-thawed spermatozoa into x-chromosome bearing and y-chromosome bearing populations: Devices, compositions, and methods for handling, separating, packaging, and utilization of spermatozoa (1) that can be derived from previously frozen sperm samples collected from a male mammal. Specifically, techniques to uniformly stain (2) spermatozoal DNA even when derived from previously frozen sperm and separation techniques to separate and isolate spermatozoa... Agent: Santangelo Law Offices, P.C. 20070042344 - Differentiation regulating agent containing gene which regulating differentiation from stem cells into natural killer cells as effective ingredient: The present invention relates to a cell differentiation regulating agent containing a gene regulating differentiation from stem cells into natural killer cells as an effective ingredient, more precisely, a cell differentiation regulating agent containing a gene regulating differentiation from stem cells into premature natural killer cells as an effective ingredient... Agent: Jhk Law 20070042343 - Forward mutation assay based on 5-fluorouracil resistance: Disclosed herein is a novel forward mutation assay based on 5-fluorouracil (5-FU) resistance which utilizes a strain of Salmonella typhimurium derived from the Ames strain TA100. More specifically, the invention provides a high throughput alternative to the standard Ames mutation assay for the evaluation of the genotoxicity activity of compounds... Agent: Merck And Co., Inc 20070042347 - High throughput biological heart rate monitor that is molecularly determined: This invention provides for a chamber and system designed for use in assaying drug effects on heart rate. The chamber consists of a series of wells, each 3 mm by 3 mm in inner diameter. Cardiac myocytes disaggregated from neonatal animals are plated onto the bottom of each well and... Agent: Kenyon & Kenyon LLP 20070042346 - Method and apparatus for detection of rare cells: Fluorescent dye-tagged rare cells are disposed in a biological fluid layer contained in an annular gap (12) between an inside test tube wall (14) and a float wall (16). One or more analysis images are acquired at one or more focus depths using a microscope system (10, 10′, 10″, 10′″).... Agent: Fay, Sharpe, Fagan, Minnich & Mckee, LLP 20070042345 - Polypeptide having intracellular calcium ion indicator function: The present invention provides a polypeptide having an intracellular calcium ion indicator function, which contains the following elements (a)-(c): (a) a polypeptide residue consisting of a membrane localization signal sequence; (b) a first fluorescent polypeptide residue; and (c) a second fluorescent polypeptide residue in the order of (a), (b) and... Agent: Leydig Voit & Mayer, Ltd 20070042359 - Binding molecules capable of neutralizing west nile virus and uses thereof: The invention provides human binding molecules specifically binding to West Nile virus and having West Nile virus neutralizing activity, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used... Agent: Trask Britt 20070042348 - Colorimetric sensor: A means for detecting a presence of a particular material in the air, a filter for an air conditioner which can confirm the presence of the particular material in the air, and a method for confirming a performance of the filter for an air conditioner about a removal of the... Agent: GlobalIPCounselors, LLP 20070042354 - Detecting pathogens in companion animals: This document relates to methods and materials involved in determining whether or not an animal contains a pathogen. For example, nucleic acid primer pairs, combinations of nucleic acid primer pairs, nucleic acid arrays (e.g., diagnostic cards) containing nucleic acid primer pairs or combinations of nucleic acid primer pairs, methods for... Agent: Fish & Richardson P.C. 20070042357 - Detection and identification of bacterial strains: The present invention relates to a method to detect bacteria, the method comprising the following steps: coupling of the bacteriophages and/or bacteriophage proteins to a support, incubating the support coupled with the bacteriophages and/or bacteriophage proteins with a sample, optionally removing the sample and the bacteria in the sample not... Agent: Fulbright & Jaworski L.L.P. 20070042353 - Hcv polymerase suitable for crystal structure analysis and method for using the enzyme: An HCV polymerase suitable for crystal structural analysis and a method for using the enzyme are provided. The HCV polymerase suitable for crystal structural analysis and/or comprising high HCV polymerase activity can be used for the three-dimensional structural analysis, and for rational identification of HCV polymerase inhibitors by computers. The... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070042355 - Integrated method for collection and maintenance of detectability of a plurality of microbiological agents in a single clinical sample and for handling a plurality of samples for reporting a sum of diagnostic results for each sample: A method and kit related thereto are described for the collection and maintenance of detectability of a plurality of species of microbiological agents in a single clinical sample as well as an integral method for handling a plurality of the samples and managing information associated therewith for reporting a sum... Agent: Medical Diagnostic Laboratories LLC 20070042358 - Method for improving cell permeability to foreign particles: The present invention provides a method for allowing foreign particles to penetrate, very efficiently, the cell wall, cell membrane, organelle membrane and/or nuclear membrane of a cell and hybridizing or binding to the complimentary target in the cell. The cells may be from a culture or from specimens obtained from... Agent: Kevin Farrell Pierce Atwood 20070042350 - Methods and compositions for detecting sars virus and other infectious agents: This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotides sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated.... Agent: Morrison & Foerster LLP 20070042349 - Methods for assessing biologic diversity: Methods for determining biologic diversity (e.g., lymphocyte receptor diversity or diversity of viral quasispecies) in a subject are described, as well as methods for monitoring a disease in a subject.... Agent: Fish & Richardson P.C. 20070042351 - Multi-allelic molecular detection of sars-associated coronavirus: The subject invention relates to a multiple-allelic RT-real-time polymerase chain reaction (PCR) assay for coronaviruses including the SARS virus. Multiple target sequences within the SARS-CoV, S, E, M and N genes are identified. The use of the four different targets enhances the likelihood that the fundamental genetic drift of the... Agent: Venable LLP 20070042352 - Retroviral vector and cell-based assay for measuring the mutations rate of retroviruses employing same: Lentiviral-based retrovirus vectors and an in vivo mutation rate assay employing them. More particularly, an assay for directly determining the in vivo mutation rate of HIV-1.... Agent: Dinsmore & Shohl LLP 20070042356 - Variants of hepatitis b virus resistant against some nucleoside analogues, but sensitive to others, and uses thereof: The present invention relates generally to the field of Hepatitis B variants exhibiting a reduced sensitivity to nucleoside analogues both in vivo and in vitro. More in particular, reverse transcriptase mutant rt I233V is provided. Present invention provides assays and methods for detecting such variant, which assays are useful in... Agent: Nixon & Vanderhye, PC 20070042415 - Anti-fused antibodies: The present invention relates to nucleotide sequences, including expressed sequence tags (ESTs), oligonucleotide probes, polypeptides, vectors and host cells expressing, immunoadhesins, agonists and antagonists (including antibodies) to human & vertebrate fused.... Agent: Genentech, Inc. 20070042394 - Apparatus for producing a dna doped carbon cluster and method for producing the same: The object of the present invention is to provide an apparatus for producing a DNA doped carbon cluster capable of introducing DNA into the cavity of a carbon cluster. An apparatus for producing a DNA doped carbon cluster comprising a radio frequency current applying electrode which is composed of a... Agent: Young & Thompson 20070042365 - Assay for detecting methylation changes in nucleic acids using an intercalating nucleic acid: A method for detecting the presence of a target nucleic acid in a sample including treating a sample containing nucleic acid with an agent that modifies unmethylated cytosine; providing to the treated sample a detector ligand in the form of an intercalating nucleic acid (INA) capable of binding to a... Agent: Knobbe Martens Olson & Bear LLP 20070042380 - Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof: The present invention relates to a first group of novel oligonucleotides, here identified as “Genomic Address Messenger” or “GAM” oligonucleotide, and a second group of novel operon-like polynucleotides, here identified as “Genomic Record” or “GR” polynucleotide. GAM oligonucleotides selectively inhibit translation of known “target” genes, many of which are known... Agent: Howrey LLP 20070042381 - Bioinformatically detectable group of novel regulatory viral and viral associated oligonucleotides and uses thereof: The present invention relates to a first group of novel viral and human associated oligonucleotides, here identified as “Genomic Address Messenger” or “GAM” oligonucleotide, and a second group of novel operon-like viral and human polynucleotides, here identified as “Genomic Record” or “GR” polynucleotide. GAM oligonucleotides selectively inhibit translation of known... Agent: Howrey LLP 20070042399 - Biological materials and uses thereof: The invention relates to a library, methods of making a library of biologically active molecules and uses thereof. The library comprises a plurality of chelating ligand pairs, each said ligand pair including two ligands that bind specifically to distinct epitopes on the same target molecule and the two ligands of... Agent: Patrea L. Pabst Pabst Patent Group LLP 20070042377 - Biosensor: A sensor for determining the presence of an analyte in a test sample, said sensor comprising a nanoparticulate membrane comprising nanoparticles of at least one inorganic oxide of an element selected from Group IA, IIA, IIIA, IVA, IB, IIB, IIIB, IVAB, VB, VIB, VIII3 or VIIII3 of the Periodic Table,... Agent: Intellectual Property / Technology Law 20070042404 - Compositions and method for detecting endonuclease activity: The present invention relates to compositions and a cell-based assay for detecting endonuclease activity. The assay involves the basic principle of linking a endonuclease cleavage event with cell survival. When an endonuclease cleaves its cognate endonuclease recognition site located on a vector containing a toxic reporter protein, the vector is... Agent: Licata & Tyrrell P.C. 20070042398 - Cyanine dyes and methods of use: The present invention provides for cyanine dyes as near IR quenchers. The cyanine dyes have absorption wavelengths in the near-infrared region of about 650-900 nm and are essentially non-fluorescent. The dyes of the invention have at least one linking group. The present invention also provides substantially non-fluorescent, NIR probes. Biological... Agent: Townsend And Townsend And Crew, LLP 20070042416 - Dendritic enriched secreted lymphocyte activation molecule: The present invention relates to a novel human protein called Dendritic Enriched Secreted Lymphocyte Activation Molecule, and isolated polynucleotides encoding this protein. Also provided are vectors, host cells, antibodies, and recombinant methods for producing this human protein. The invention further relates to diagnostic and therapeutic methods useful for diagnosing and... Agent: Human Genome Sciences Inc. Intellectual Property Dept. 20070042368 - Detection and monitoring of lung cancer: Compositions and methods for the diagnosis of lung cancer are disclosed. Such methods are useful to detect early tumors or provide adequate stage/grade information or tumor specificity. Compositions may comprise one or more lung tumor proteins, immunogenic portions thereof, or polynucleotides that encode such portions. Such compositions may be used,... Agent: Seed Intellectual Property Law Group PLLC 20070042412 - Detection of biologically active compounds: A probe comprises a supramolecular structure having a chemical or biological recognition moiety; a phosphorescent reporter label; and an effector which interacts with the label so that the probe alters its phosphorescent characteristics on recognition of a target. The phosphorescent reporter label may have an emission lifetime in the order... Agent: Jacobson Holman PLLC 20070042419 - Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions: The present invention relates to a method for identifying a target nucleotide sequence. This method involves forming a ligation product on a target nucleotide sequence in a ligase detection reaction mixture, amplifying the ligation product to form an amplified ligation product in a polymerase chain reaction (PCR) mixture, detecting the... Agent: Nixon Peabody LLP - Patent Group 20070042406 - Diffusion mediated clean-up of a target carrier fluid: Microfludic channels are constructed for use in preparing and/or analyzing samples. In one embodiment, a microfluidic channel receives a carrier fluid having both non-targets and targets. The non-targets are moved from the carrier fluid by diffusion and into sheathing fluids also present in the channel before contents of the carrier... Agent: Wolf Greenfield & Sacks, PC 20070042393 - Discrimination method of target base in dna, and allele specific primer used in the method of the same: An object of the present invention is to provide an allele specific primer which is accompanied by less possibility of the false positive and enables definite discrimination when a base immediately adjacent to on the 3′ side of a target SNP base is A, while a base adjacent with one... Agent: Mcdermott Will & Emery LLP 20070042405 - Enhanced diagnostic multimarker serological profiling: The present invention is related to methods of early diagnosis of ovarian cancer in a patient by determining serum levels of blood markers using a novel LabMAP™ technology (Luminex Corp., Austin, Tex.), which allows for simultaneous measurement of the blood markers in serum. The panel of blood markers offers extremely... Agent: The Webb Law Firm, P.C. 20070042395 - Fibroblast growth factor-19 (fgf-19) nucleic acids and polypeptides and methods of use for the treatment of obesity: The present invention is directed to novel polypeptides belonging to the fibroblast growth factor family and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide... Agent: Genentech, Inc. 20070042370 - Fluorescent substrates for detecting organophosphatase enzyme activity: Disclosed are compounds of the formula (I): wherein R3, R4, R5, R9, and R10 are selected from the group consisting of H and groups or atoms other than H, and R6 and R8 are halo or hydrogen; X1, X2, and X3 are independently O or S; provided that R9 and... Agent: Foley And Lardner LLP Suite 500 20070042382 - Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof: The present invention is based on the discovery of genetic polymorphisms that are associated with myocardial infarction. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods... Agent: Celera Genomics Corp. Attn: Wayne Montgomery, Vice Pres, Intel Property 20070042361 - Human secreted proteins: The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating cancer and other hyperproliferative diseases and disorders. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors, host cells, and... Agent: Human Genome Sciences Inc Intellectual Property Dept. 20070042386 - Hybridization of polynucleotides conjugated with chromophores and fluorophores to generate donor-to-donor energy transfer system: The present invention contemplates monitoring the amplification of nucleic acid using chromophore-containing polynucleotides having at least two donor chromophores operatively linked to the polynucleotide by linker arms, such that the chromophores are positioned by linkage along the length of the polynucleotide at a donor-donor transfer distance, and at least one... Agent: O'melveny & Myers LLP Suite 100 20070042375 - Isolated berovin photoprotein and use thereof: The invention relates to the photoprotein berovin, to its nucleotide and amino acid sequences and to the activity and use of the photoprotein berovin.... Agent: Banner & Witcoff 20070042367 - Lab-on-chip system for analying nucleic acid: This invention relates generally to the field of nucleic acid detection. In particular, the invention provides a lab-on-chip system for analyzing a nucleic acid, which system comprises, inter alia, controllably closed space, and a target nucleic acid can be prepared and/or amplified, and hybridized to a nucleic acid probe, and... Agent: Morrison & Foerster LLP 20070042420 - Liver tumor marker sequences: Polypeptides whose expression is upregulated in liver tumor cells and cells from liver preneoplastic foci relative to expression in normal liver cells are disclosed as are polynucleotides that encode the polypeptides. In humans, the polynucleotide maps to a region of chromosome 15. The overexpression has also been confirmed in human... Agent: Quarles & Brady LLP 20070042409 - Mammalian obestatin receptors: A high affinity obestatin receptor is provided; the orphan receptor GPR39. The receptor mediates obestatin activities. The obestatin receptor (GPR39) and fragments thereof, particularly soluble fragments thereof, are useful as therapeutic agents capable of inhibiting the action of obestatin. In addition to use as a therapeutic agent, GPR39 polypeptides are... Agent: Bozicevic, Field & Francis LLP 20070042390 - Method and device for critical dimension detection by molecular binding: Critical Dimension (CD) of features on a semiconductor substrate may be indicated utilizing the site-specific binding properties of organic or biological molecules. In accordance with one embodiment of the present invention, a fluorescent tagged organic molecule is fabricated having a length corresponding to the desired CD. The semiconductor substrate is... Agent: Townsend And Townsend And Crew, LLP 20070042389 - Method and sequences for determinate nucleic acid hybridization: Provided are methods for using nucleic acid sequences having two or more degenerately pairing nucleotides, each degenerate nucleotide having a partially overlapping set of complementarity, to reduce the number of hybridizing nucleotide sequences or probes used in biochemical and molecular biological operations having sequence specific hybridization. The method may be... Agent: Searete LLC 20070042372 - Method for designing dna codes used as information carrier: The present invention provides a method for designing DNA code consisting of a set of information codes as an information carrier to write optional information into an optional noncoding region not including any DNA genetic information which can avoid an error occurring when the designed DNA is used. A set... Agent: Alston & Bird LLP 20070042384 - Method for isolating and modifying dna from blood and body fluids: This invention is related a method for rapidly isolating and modifying DNA from plasma/serum and body fluids. This invention provides a procedure and composition to obtain a high yield of modified DNA for methylation-specific PCR assay by coupling DNA isolation and modification courses.... Agent: Jessica M. Li 20070042402 - Method for predicting human longevity: The present disclosure concerns methods of detecting levels of one or more molecules(s), longevity predicting marker(s), in a sample, and using these levels of the marker(s) to predict a condition. In a particular embodiment, the present invention concerns methods of detecting longevity predicting marker(s), in a sample, preferably to assess... Agent: Faegre & Benson LLP Patent Docketing 20070042421 - Method of identifying nucleic acids: Disclosed are methods for identifying nucleic acids in a sample of nucleic acids in which nucleic acids are initially present in unequal amounts. The methods include partitioning the starting population of nucleic acids to form one or more subpopulations, and then identifying nucleic acids that are present in different amounts... Agent: Curagen Corporation 20070042388 - Method of probe design and/or of nucleic acids detection: It is provided a method of designing oligonucleotide probe(s) for nucleic acid detection comprising the following steps in any order: (i) identifying and selecting region(s) of a target nucleic acid to be amplified, the region(s) having an efficiency of amplification (AE) higher than the average AE; and (ii) designing oligonucleotide... Agent: Dickstein Shapiro LLP 20070042362 - Methods and apparatus for use in genetics classification including classification tree analysis: Methods and apparatus for use in genetic trait classification involving at least two genes associated with a genetic trait are described. In one illustrative method, a value for use in classifying an individual into one of a plurality of trait classes associated with the genetic trait is calculated. The value... Agent: John J. Oskorep, Esq. One Magnificent Mile Center 20070042401 - Methods for synthesis of encoded libraries: The present invention provides a method of synthesizing libraries of molecules which include an encoding oligonucleotide tag.... Agent: Lahive & Cockfield, LLP 20070042360 - Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer: Described herein are genes whose expression are up-regulated or down-regulated in specific cancers. Related methods and compositions that can be used for diagnosis and treatment of those cancers are disclosed. Also described herein are methods that can be used to identify modulators of selected cancers.... Agent: Howrey LLP 20070042400 - Methods of preparing nucleic acid for detection: Methods of preparing nucleic acid from polysaccharide-containing samples for detection by providing one or more glycosidases to the sample to degrade polysaccharides are provided. The nucleic acids can further be extracted from the sample. The method is particularly useful for detecting nucleic acid in samples with high starch content.... Agent: Brinks Hofer Gilson & Lione 20070042369 - Methods of selection, reporting and analysis of genetic markers using borad-based genetic profiling applications: Disclosed are a method for determining whether an individual has an enhanced, diminished, or average probability of exhibiting one or more phenotypic attributes and related methods of selecting a set of genetic markers; for providing relevant genetic information to an individual; of evaluating the probability that progeny of two individuals... Agent: Sidley Austin LLP Attn: Dc Patent Docketing 20070042417 - Methods of using zven polynucleotides: The present invention provides novel uses two members of a new family of human proteins, designated as “Zven,” as agents that stimulate gastrointestinal contractility, gastric emptying, intestinal transit, and treating gastroparesis The Zven1 gene, which resides in human chromosome 3p21.1-3p14.3, is expressed in testicular tissue and peripheral blood lymphocytes. The... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042376 - Mn/ca ix and cancer prognosis: Herein disclosed are methods that are prognostic for neoplastic/preneoplastic disease in a subject vertebrate, wherein said disease is associated with a tissue that normally expresses MN, but which MN expression is lost or diminished upon carcinogenesis. Exemplary of the types of preneoplastic/neoplastic diseases subject to the prognostic methods of this... Agent: Leona L Lauder Attorney At Law 20070042379 - Modified dna cleavage enzymes and methods for use (as amended by isa): Compositions and methods are provided that relate to a modified DNA cleaving enzyme having at least 35% amino acid sequence identity with T7 Endo I. The modified enzyme includes two catalytic centers separated by a β-bridge where the β-bridge contains at least one mutation having an effect of altering enzyme... Agent: Harriet M. Strimpel New England Biolabs, Inc. 20070042407 - Modified nucleosides and nucleotides and uses thereof: The invention is directed to modified guanine-containing nucleosides and nucleotides and uses thereof. More specifically, the invention relates to modified fluorescently labelled guanine-containing nucleosides and nucleotides which exhibit enhanced fluorophore intensity by virtue of reduced quenching effects.... Agent: Klauber & Jackson 20070042371 - Mptens as modifers of the pten/igf pathway and methods of use: Human MPTEN genes are identified as modulators of the PTEN/IGF pathway, and thus are therapeutic targets for disorders associated with defective PTEN/IGF function. Methods for identifying modulators of PTEN/IGF, comprising screening for agents that modulate the activity of MPTEN are provided.... Agent: Mcdonnell Boehnen Hulbert @ Berghoff LLP 20070042411 - Multiplexed pcr assay for detection of bovine spongiform encephalopathy (bse)-associated bovine prion protein gene (prnp) polymorphisms: A multiplexed PCR assay system and method are provided for detection of bovine prion protein gene (PRNP) insertion/deletion polymorphisms that are associated with bovine spongiform encephalopathy (BSE), thereby identifying a population of cattle or individual therefrom that possesses an elevated level of putative resistance or susceptibility to BSE. Such system... Agent: Howrey LLP 20070042383 - Mycobacterial diagnostics: The present invention provides nucleic acid molecules unique to M. paratuberculosis. The invention also provides the polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules of the invention, and antibodies having specific binding affinity for the polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules. The invention further provides for... Agent: Fish & Richardson P.C. 20070042366 - Nanopores, methods for using same, methods for making same and methods for characterizing biomolecules using same: Featured are devices and systems embodying one or more solid-state nanopores useable for sensing and/or characterizing single macromolecules as well as sequencing DNA or RNA and/or determining RNA secondary structures. In once solid state nanopore of the present invention the width and/or length of the nanopore is defined or established... Agent: Wilmer Cutler Pickering Hale And Dorr LLP 20070042385 - Novel compositions and methods in cancer: The present invention relates to novel sequences for use in detection, diagnosis and treatment of cancers, especially lymphomas. The invention provides cancer-associated (CA) polynucleotide sequences whose expression is associated with cancer. The present invention provides CA polypeptides associated with cancer that present novel therapeutic targets against cancer. The present invention... Agent: Gwilym Attwell (cozen O'connor) 20070042392 - Novel nucleic acids and polypeptides: The present invention provides novel nucleic acids, novel polypeptide sequences encoded by these nucleic acids and uses thereof.... Agent: Nuvelo, Inc 20070042363 - Novel polypeptide and nucleic acid encoding the same: A novel protein which binds with tumor necrosis factor receptor associated factor 2, TRAF2, as well as a nucleic acid coding for the protein is disclosed. From a mouse cDNA library, a cDNA coding for a novel protein which binds with TRAF2 was discovered by mammalian two-hybrid assay, the cDNA... Agent: Birch Stewart Kolasch & Birch 20070042374 - Novel protein: The present invention provides a protein containing the same or substantially the same amino acid sequence as the amino acid sequence starting at Amino Acid No. 1 in the amino acid sequence shown by SEQ ID NO:2 or 4, the nucleic acid that encodes it, a method of screening a... Agent: Edwards & Angell, LLP 20070042391 - Nucleic acid and amino acid sequences relating to staphylococcus epidermidis for diagnostics and therapeutics: The invention provides isolated polypeptide and nucleic acid sequences derived from Staphylococcus epidermidis that are useful in diagnosis and therapy of pathological conditions; antibodies against the polypeptides; and methods for the production of the polypeptides. The invention also provides methods for the detection, prevention and treatment of pathological conditions resulting... Agent: Drinker Biddle & Reath (dc) 20070042396 - Nucleic acid purification apparatus including photovoltaic device, microfluidic apparatus including the nucleic acid purification apparatus, and method of purifying nucleic acid using the nucleic acid purification apparatus: Provided are a nucleic acid purification apparatus including a chamber that includes an inlet and an outlet, at least two electrodes that defines the chamber and form an electric field, a photovoltaic device that applies a bias to the electrodes, a microfluidic apparatus including the same, and a method of... Agent: Cantor Colburn, LLP 20070042408 - Nucleotide sequence for assessing transmissible spongiform encephalopathies: The present invention is directed to the assessment of transmissible spongiform encephalopathy (TSE) using a sample from a living individual. The assessment is based on the use of an RNA marker molecule in a sample of whole blood. The RNA encodes a hypothetical cystein protease. The invention is further directed... Agent: Roche Diagnostics Operations Inc. 20070042422 - Oligonucleotides for rapidly identifying microbial dna or rna: An oligonucoeotide selected from the group consisting of ISN2 (SEQ ID NO: 43), ISN2* (SEQ ID NO: 44), ISN (SEQ ID NO: 34), ISP2 (SEQ ID NO: 46), ISP2* (SEQ ID NO: 45) and ISP (SEQ ID NO: 33).... Agent: Frishauf, Holtz, Goodman & Chick, PC 20070042413 - Platelet-derived growth factor d, dna coding therefor, and uses thereof: PDGF-D, a new member of the PDGF/VEGF family of polypeptide growth factors, is described, as well as nucleotide sequences encoding, methods for producing, pharmaceutical compositions containing this new growth factor, and its antibodies and other antagonists. Also disclosed are transfected and transformed host cells expressing PDGF-D, and uses thereof in... Agent: Crowell & Moring LLP Intellectual Property Group 20070042387 - Promoter, promoter control elements, and combinations, and uses thereof: The present invention is directed to promoter sequences and promoter control elements, polynucleotide constructs comprising the promoters and control elements, and methods of identifying the promoters, control elements, or fragments thereof. The invention further relates to the use of the present promoters or promoter control elements to modulate transcript levels.... Agent: Birch Stewart Kolasch & Birch 20070042373 - Protein identification methods and systems: The present invention relates to methods and systems for identifying proteins. In particular the invention provides a method for identifying a protein through amino acid sequences of one or more query peptides generated from the protein. The method involves translating amino acid sequences of the query peptides to all possible... Agent: Hamre, Schumann, Mueller & Larson, P.C. 20070042378 - Regulation of prokaryotic gene expression with zinc finger proteins: Chimeric zinc finger proteins, and methods of using zinc finger proteins for regulating gene expression in prokaryotes are disclosed herein.... Agent: Sughrue Mion, PLLC 20070042414 - Retentate chromatography and protein chip arrays with applications in biology and medicine: This invention provides methods of retentate chromatography for resolving analytes in a sample. The methods involve adsorbing the analytes to a substrate under a plurality of different selectivity conditions, and detecting the analytes retained on the substrate by desorption spectrometry. The methods are useful in biology and medicine, including clinical... Agent: Townsend And Townsend And Crew LLP 20070042410 - Screening method for genes of brewing yeast: Provided herein are a method for selecting a gene participating in the desired brewing character and compiling a database of the whole genome sequence of industrial yeast; identifying a gene participating in a brewing characteristic from the database; functional analysis of the gene; and a DNA array of the whole... Agent: Drinker Biddle & Reath (dc) 20070042403 - Specific inhibitors of nfat activation by calcineurin and their use in treating immune-related diseases: Isolated peptide fragments of the conserved regulatory domain of NFAT protein capable of inhibiting protein-protein interaction between calcineurin and NFAT, or a biologically active analog thereof are described. Isolated polynucleotides and gene therapy vectors encoding such peptide fragments are also described. In addition, methods for treating immune-related diseases or conditions... Agent: Fish & Richardson PC 20070042364 - Target genes for inflammatory bowel disease: Two genes have been discovered that show single nucleotide polymorphisms that are differentially expressed in patients with inflammatory bowel disease (IBD) as compared to unaffected controls. These two genes, FLJ21425 and CSF1R (colony stimulating factor 1 receptor), are located close together on chromosome 5q33 which was known to have other... Agent: Patent Department Taylor, Porter, Brooks & Phillips, L.l.p 20070042397 - Techniques for linking non-coding and gene-coding deoxyribonucleic acid sequences and applications thereof: Techniques for linking non-coding and gene coding regions of a genome are provided. In one aspect, a method of determining associations between non-coding sequences and gene coding sequences in a genome of an organism comprises the following steps. At least one conserved region is identified from one or more non-coding... Agent: Ryan, Mason & Lewis, LLP 20070042418 - Therapeutic modulation of the fas pathway: A method for the identification of genes that are essential for the maintenance of specific cell phenotypes is disclosed. The method includes the initial step of identifying a cell type with a phenotype of interest. Gene inactivation is performed on an aliquot of cells of the cell type of interest.... Agent: Cooper & Dunham, LLP 20070042430 - Apparatus and method for single-step immunosorbent assay for single and multiple analytes: The present invention discloses an apparatus and method for minimizing or eliminating steps in immunosorbent assays by eliminating both the need to attach target molecules to the test well and the need to remove unbound antibodies through rinsing. The single-step immunosorbent assay (SISA) includes the step of mixing the immunologic... Agent: Kammer Browning PLLC 20070042429 - Assay for differentiating alzheimer's and alzheimer's-like disorders: The invention relates to an assay for discriminating between Alzheimer's disease (AD) patients, patients with AD-Like disorders that express symptoms like AD, and non-demented age-matched controls (Normal). The method is based on the use of 2-dimensional (2D) gel electrophoresis to separate the complex mixture of proteins found in blood serum,... Agent: Power3 Medical Products, Inc. 20070042426 - Biomarkers and assays for myocardial infarction: Presented herein are novel blood plasma/serum biomarkers related to cardiovascular disease. These newly identified biomarkers create the basis for multiple (single) assays using traditional bioassay technologies and when used in combination yield exceptional clinical sensitivity and specificity in the determination of myocardial infarction (MI). A multiplexed, mass spectrometric immunoassay (MSIA)... Agent: Snell & Wilmer 20070042425 - Diagnostic method for brain damage-related disorders: A brain damage-related disorder is diagnosed in a subject by detecting at least one polypeptide, or a variant or mutant thereof, selected from A-FABP, E-FABP, PGP 9.5, GFAP, Prostaglandin D synthase, Neuromodulin, Neurofilament L, Calcyphosine, RNA binding regulatory subunit, Ubiquitin fusion degradation protein 1 homolog, Nucleoside diphosphate kinase A, Glutathione... Agent: Arent Fox PLLC 20070042423 - Diagnostics and therapeutics for diseases associated with arginyl aminopeptidase rnpep-like (rnpep-like): The invention provides a human RNPEP-like which is associated with the cardiovascular diseases, dermatological diseases, endocrinological diseases, metabolic diseases, cancer, gastroenterological diseases, inflammation, hematological diseases, neurological diseases and urological diseases. The invention also provides assays for the identification of compounds useful in the treatment or prevention of cardiovascular diseases, dermatological... Agent: Banner & Witcoff 20070042424 - Method of selectively assaying adiponectin multimers: We have discovered a “human adiponectin ELISA kit”, which can specifically measure adiponectin in human blood serum (or blood plasma) or in extracted fluid from lipocytes or culture supernatant fluid. After fractioning human serum by use of gel filtration column, each fraction was measured by the present kit, and as... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070042431 - Methods for reducing complexity of a sample using small epitope antibodies: The present invention relates generally to methods for reducing the complexity of a sample. More specifically, the present invention relates to proteomics, the measurement of the protein levels in biological samples, and analysis of proteins in a sample using antibodies that recognize small epitopes.... Agent: Morrison & Foerster LLP 20070042427 - Microfluidic laminar flow detection strip: The present invention relates to microfluidic laminar flow detection strip devices and methods for using and making the same. The disclosed devices comprise: a first inlet; a microfluidic channel having a first end and a second end, wherein the first end is fluidly connected to the first inlet; a bellows... Agent: Seed Intellectual Property Law Group PLLC 20070042428 - Treatment of proliferative disorders: Inhibitors of cIAP-1 and methods and compositions for treating proliferative disorders.... Agent: Pepper Hamilton LLP 20070042435 - Assays for sensory modulators using a sensory cell specific g-protein beta subunit: The invention identifies nucleic acid and amino acid sequences of sensory specific G-protein beta subunits that are specifically expressed in sensory cells, antibodies to such subunits, methods of detecting such nucleic acids and proteins, and methods of screening for modulators of sensory cell specific beta subunits.... Agent: Townsend And Townsend And Crew, LLP 20070042436 - Cd38 modulated chemotaxis: The present invention relates to methods for modulating the migratory activity of cells expressing CD38 for the treatment of disorders including, but not limited to, inflammation, ischemia, asthma, autoimmune disease, diabetes, arthritis, allergies, infection with pathogenic organisms, such as parasites, and transplant rejection. Such cells include, for example, neutrophils, lymphocytes,... Agent: Kenyon & Kenyon LLP 20070042437 - Diagnosis and treatment of alzheimer's disease: This invention relates to methods for diagnosing Alzheimer's Disease (AD) by determining the level or function of insulin, insulin-like growth factors, their receptors and/or their downstream signaling molecules. The invention further relates to methods for the treatment of AD by administering an insulin agonist and an insulin-like growth factor agonist.... Agent: Sterne, Kessler, Goldstein & Fox PLLC 20070042434 - Method for identifying tff2 regulating agents and agents identified using said method: Agents useful for modulating the dioxin/aryl hydrocarbon receptor (AhR) can now be identified by determining the binding to said receptor and whether said agent suppresses or inhibits the expression of a gene substantially consisting of a sequence according to one of SEQ.ID. NO. 1 and SEQ.ID. NO. 2; a nucleotide... Agent: Morrison & Foerster LLP 20070042432 - Method of diagnosis and treatment: The present invention relates generally to a method for detecting an aberrant cell, and more particularly an apoptotic cell, in a subject or in a biological sample from said subject, and agents useful for same. The presence of the aberrant cell or group of aberrant cells provides an indication of... Agent: Seed Intellectual Property Law Group PLLC 20070042433 - Neuregulin protein regulation of synaptic proteins: e 20070042443 - Hematopoietic cell phenotyping using free circulating cellular markers: The present invention provides methods of identifying cluster of differentiation (CD) marker phenotype for hematopoietic cells using multiple soluble CD markers circulating in bodily fluid. In particular aspects, the CD marker phenotype can be used to classify the tumor type of a patient having a proliferative disorder. In other aspects,... Agent: Foley & Lardner LLP 20070042446 - Mammalian iap gene family, primers, probes and detection methods: Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; and methods of using such DNA to express the IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed are conserved regions characteristic of the IAP family and primer and probes for the identification and isolation of additional IAP genes.... Agent: Philip Swain, Phd C/o Gowling Lafleur Henderson 20070042445 - Method for demonstration of a molecular event in a cell by means of fluorescent marker proteins: The invention relates to a method for demonstration of the occurrence of a molecular event, particularly in a cell, characterised by the detection of the “solubilisation” of a fixed protein marker (or the fixing of a solubilised protein marker) which is a direct or indirect marker for the occurrence of... Agent: Lerner, David, Littenberg, Krumholz & Mentlik 20070042444 - Multiple-channel test device, method for producing the same and use thereof: The object of the invention is a multiple-channel test devise based on immunodiffusion and immunochromatography, which enables the simultaneous or parallel determination of several analytes. In the test devise, it is possible to group together different combinations of markers recognizing allergens, myocardial infarction markers, venereal disease analytes, blood screening analytes,... Agent: Foley & Lardner LLP 20070042447 - Use of anti-ferritin monoclonal antibodies in the treatment of some cancers (divisional): The invention concerns the use, in the preparation of a medicine for treating cancer whereof the cells exhibit overexpression of a product of a gene of the myc-related family, of an anti-ferritin monoclonal antibody or a fragment thereof, said antibody or said fragment identifying an epitope common to acidic and... Agent: Merchant & Gould PC 20070042448 - Use of enzymes from helicobacter pylori as therapeutical targets: Methods for identifying molecules which inhibit the virulence or pathogenicity of Helicobacter pylori by modulating the activity of hydrolases encoded by genes amiA, mltD and slt. Compositions and diagnostic and treatment methods using hydrolases and molecules which inhibit them.... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070042440 - Biosensor for analyzing quantitatively analyte with a predetermined size and larger than, and manufacturing method thereof: The present invention discloses a biosensor for quantitatively analyzing a bio-material and a manufacturing method thereof. The biosensor has an exposed conductive region of a few-nanometer scale distributed on an insulated metallic substrate in a desired pattern or randomly. The quantitative analysis of protein can be carried out by means... Agent: Macpherson Kwok Chen & Heid LLP 20070042441 - Method and apparatus for detecting estradiol and metabolites thereof using an acoustic device: Methods for detecting estradiol and metabolites thereof in a sample are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for estradiol, is combined with the sample to form a plurality of estradiol-particle complexes. The system also includes a transport arrangement for... Agent: Proskauer Rose LLP 20070042439 - Porphyrin compound containing biotinyl group and use thereof: wherein Por represents a porphyrin residue optionally forming a metal complex; Bi represents an optionally substituted biotinyl group; and A represents a C1-C20 hydrocarbyl group, or a heterohydrocarbyl group having 1-5 heteroatoms selected from a group consisting of oxygen, sulfur, and nitrogen, and having 1-20 atoms in total; a method... Agent: Foley And Lardner LLP Suite 500 20070042442 - Protein microarrays on mirrored surfaces for performing proteomic analyses: Provided are protein microarrays, their manufacture, use, and application. Protein microarrays in accordance with the present invention are useful in a variety preoteomic analyses. Various protein arrays in accordance with the present invention may immobilize large arrays of proteins that may be useful for studying protein-protein interactions to improve understanding... Agent: Novartis Vaccines And Diagnostics Inc. 20070042438 - Scd4ol and placental growth factor (plgf) used as a biochemical marker combination in cardiovascular diseases: The invention relates to novel markers of vascular inflammation and combinations thereof as diagnostic and prognostic tools in patients with cardiovascular diseases. The markers also act as tools that facilitate the selection of active ingredients for the treatment of such diseases, and finally act as starting points for the treatment... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070042449 - Method of detection in homogeneous phase, especially of progesterone in mammals' milk, and corresponding kit: Method for the qualitative and semi-quantitative detection of a ligand in a sample of a medium to be tested, by (1) diluting at least one lyophilised reaction medium in said sample, (2) incubating the sample in order to carry out an immunoenzymatic method, and (3) observing the resulting colouration.... Agent: Jacobson Holman PLLC 20070042450 - Multi-transduction mechanism based microfluidic analyte sensors: In various aspects are provided a microfluidic and/or nanofluidic sensor that can provide an indication of the reliability of its measurement of the presence of an analyte in a sample under investigation, an analyte concentration in the sample under investigation, or both. The provided sensors, microfluidic devices, and methods of... Agent: Lahive & Cockfield, LLP 20070042451 - Glycine decarboxylase complex as a herbicidal target: The invention relates to the use of glycine decarboxylase complex, which is used as a target for herbicides in the absence of growth retardations and chlorotic leaves. Novel nucleic acid sequences comprising SEQ ID NO:1 and functional equivalents of SEQ ID NO:1 are thus disclosed. The invention also relates to... Agent: Connolly Bove Lodge & Hutz, LLP 20070042452 - Detection of plasma ace2: A method of assessing a subject for aberrant cardiac function is described. The method particularly involves the measurement of a plasma biomarker, namely metallopeptidase angiotensin-converting enzyme 2 (ACE2), implicated in ischaemic heart disease.... Agent: Sheridan Ross PC 20070042453 - High throughput screening method for antimicrobial formulations: Methods and systems are provided for increasing the speed and throughput at which the antimicrobial effects of chemical formulations can be evaluated. Generally, the invention provides a method for screening antimicrobial chemical formulations, comprising depositing microorganisms on a slide, depositing chemical formulations onto the deposited microorganisms, removing the chemical formulations... Agent: Linda K. Russell 20070042454 - Device and method of detecting streptococcal mutans: A device, kit and method for detecting oral bacteria are provided. The device is a tube, which includes on its inside surface a coating of an agar medium selective for growing gram-positive bacteria. The device is particularly suitable for detecting the extent of growth of mutans streptococci, which provides an... Agent: Hoffmann & Baron, LLP 20070042456 - Porous ceramic, polymer and metal materials with pores created by biological fermentation: Porous polymers are made by adding biologically active agent and growth substrates (e.g., yeast and sugar, preferably in the presence of water or other suitable fluid) to a polymer forming material, which may be a liquid. The yeast acts on the sugar, forming carbon dioxide gas bubbles. The material is... Agent: Whitham, Curtis & Christofferson & Cook, P.C. 20070042455 - Porous ceramic, polymer and metal materials with pores created by biological fermentation: Porous polymers are made by adding biologically active agent and growth substrates (e.g., yeast and sugar, preferably in the presence of water or other suitable fluid) to a polymer forming material, which may be a liquid. The yeast acts on the sugar, forming carbon dioxide gas bubbles. The material is... Agent: Whitham, Curtis & Christofferson & Cook, P.C. 20070042457 - Process for producing penicillin: The invention relates to isolated nucleic acid molecules, which code for a new protein of Penicillium chrysogenum, vectors which comprise a nucleic acid molecule of this kind, host cells which are transformed with such a nucleic acid molecule or vector, and a process for the production of penicillin using such... Agent: Novartis Corporate Intellectual Property 20070042459 - Dipeptide production method, l-amino acid amide hydrolase used therein, and production method of l-amino acid amide hydrolase: A process for industrially advantageously producing a dipeptide via a convenient pathway starting with less expensive and easily available materials is provided. A dipeptide is produced from an L-amino acid amide and an L-amino acid by using a culture of a microbe capable of synthesizing the dipeptide from the L-amino... Agent: Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070042458 - Erythropoietin: remodeling and glycoconjugation of erythropoietin: The invention includes methods and compositions for remodeling a peptide molecule, including the addition or deletion of one or more glycosyl groups to a peptide, and/or the addition of a modifying group to a peptide.... Agent: Morgan, Lewis & Bockius LLP (sf) 20070042461 - Compositions of orthogonal lysyl-trna and aminoacyl-trna synthetase pairs and uses thereof: Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing... Agent: Quine Intellectual Property Law Group, P.C. 20070042464 - Hybrid vector having a cytomegalovirus enhancer and myeloproliferative sarcoma virus promoter: An expression vector capable of expressing high levels of heterologous proteins having a cytomegalovirus (CMV) enhancer 5′ upstream from a myeloproliferative sarcoma virus (MPSV) promoter.... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042466 - Il-1 related polypeptides: The present invention is directed to novel polypeptides having homology to the IL-1-like family of proteins and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous... Agent: Genentech, Inc. 20070042465 - Mammalian transforming growth factor beta-9: Novel mammalian Ztgfβ-9 polypeptides, polynucleotides encoding the polypeptides, and related compositions and methods including antibodies and anti-idiotypic antibodies.... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042467 - Nima interacting proteins: A novel class of NIMA interacting proteins (PIN), exemplified by Pin1, is provided. Pin1 induces a G2 arrest and delays NIMA-induced mitosis when overexpressed, and triggers mitotic arrest and DNA fragmentation when depleted. Methods of identifying other Pin proteins and Pin-interacting proteins and identifying compositions which affect Pin activity or... Agent: Klarquist Sparkman, LLP 20070042463 - Nucleic acid encoding proteins involved in protein degradation, products and methods related thereof: In accordance with the present invention, there are provided novel Siah-Mediated-Degradation-Proteins (SMDPs) and/or SCF-Complex Proteins (SCPs). Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention SMDPs and/or SCPs can be employed in a variety of ways, for example, for the production of anti-SMDP and/or... Agent: Biotechnology Law Group C/o Portfolioip 20070042460 - Oxidation of peptides: The folding/oxidation of a reduced peptide or partially reduced peptide to form a disulphide bridged peptide is effected by dissolving it in an oxidizing organic solvent, alone or in admixture with water, adding an aqueous alkaline buffer to the solution, and recovering the resultant disulphide bridged peptide. The preferred oxidizing... Agent: Darby & Darby P.C. 20070042462 - Super-size adeno-associated viral vector harboring a recombinant genome larger than 5.7 kb: Prior art teaches an effective packaging capacity for adeno-associated virus and adeno-associated viral vectors of 4.1 kb to 4.9 kb as well as a packaging limit of 5.2 kb to 5.6 kb. However, the inventor discovered that this packaging limit as well as that effective packaging capacity does not apply... Agent: Markus Hildinger 20070042470 - Homogeneous preparations of il-28 and il-29: Homogeneous preparations of IL-28A, IL-28B, and IL-29 have been produced by mutating one or more of the cysteine residues in the polynucleotide sequences encoding the mature proteins. The cysteine mutant proteins can be shown to either bind to their cognate receptor or exhibit biological activity. One type of biological activity... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042471 - Homogeneous preparations of il-28 and il-29: Homogeneous preparations of IL-28A, IL-28B, and IL-29 have been produced by mutating one or more of the cysteine residues in the polynucleotide sequences encoding the mature proteins. The cysteine mutant proteins can be shown to either bind to their cognate receptor or exhibit biological activity. One type of biological activity... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042469 - Homogeneous preparations of il-28 and il-29: Homogeneous preparations of IL-28A, IL-28B, and IL-29 have been produced by mutating one or more of the cysteine residues in the polynucleotide sequences encoding the mature proteins. The cysteine mutant proteins can be shown to either bind to their cognate receptor or exhibit biological activity. One type of biological activity... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042468 - Interferon-like protein zcyto21: The present invention relates to polynucleotide and polypeptide molecules for Zcyto21, an interferon-like protein, which is most closely related to interferon-α at the amino acid sequence level. The present invention also includes antibodies to the Zcyto21 polypeptides, and methods of using the polynucleotides and polypeptides.... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042472 - Mammalian transforming growth factor beta-9: Novel mammalian Ztgfβ-9 polypeptides, polynucleotides encoding the polypeptides, and related compositions and methods including antibodies and anti-idiotypic antibodies.... Agent: Zymogenetics, Inc. Intellectual Property Department 20070042473 - Method for preparing a fluid absorber: Disclosed are a fluid absorber, a method for preparing a fluid absorber, and a method for absorbing fluid from the skin. The disclosed method for preparing a fluid absorber generally comprises the steps of selecting a starch and an enzyme for hydrolysis of the starch, determining a fluid absorption optimum... Agent: Banner & Witcoff, Ltd. 20070042474 - Corynebacterium glutamicum genes encoding novel proteins: Isolated nucleic acid molecules, designated MCP nucleic acid molecules, which encode novel MCP proteins from Corynebacterium glutamicum are described. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing MCP nucleic acid molecules, and host cells into which the expression vectors have been introduced. The invention still further... Agent: Lahive & Cockfield, LLP. 20070042475 - Method for the enzymatic production of chiral 1-acylated 1,2-diols: o 20070042476 - Novel gene encoding malic enzyme and method for preparing succinic acid using the same: A nucleotide sequence encoding a malic enzyme and a method for preparing succinic acid using the same, more particularly, a maeB nucleotide sequence encoding a malic enzyme B having the activity of converting pyruvic acid or pyruvate to malic acid or malate, or vice versa, a recombinant vector containing the... Agent: Intellectual Property / Technology Law 20070042477 - Novel gene encoding fumarate hydratase c and method for preparing succinic acid using the same: A nucleotide sequence encoding a fumarate hydratase C and a method for preparing succinic acid using the same, more particularly, a fumarate hydratase C having the activity of converting malate to fumarate, a fumC nucleotide sequence encoding the fumarate hydratase C, a recombinant vector containing the nucleotide sequence, a microorganism... Agent: Intellectual Property / Technology Law 20070042478 - Fermentation of monovalent secondary alcohols in order to form corresponding ketones: The present invention concerns a fermentation process for converting a monohydric secondary alcohol having 5 or more carbon atoms into the corresponding ketone, suitable microorganisms for that purpose.... Agent: Roylance, Abrams, Berdo & Goodman, L.L.P. 20070042479 - Conversion of carbon dioxide to methanol in silica sol-gel matrix: In a sequential enzymatic reduction of carbon dioxide to methanol in which electrons are supplied by conversion of NADH to NAD+, NADH may be regenerated from the NAD+ by conversion of lactate to pyruvate by lactate dehydrogenase enzymes.... Agent: Thompson Coburn, LLP 20070042481 - Novel gene encoding formate dehydrogenases d & e and method for preparing succinic acid using the same: Nucleotide sequences encoding formate dehydrogenases D & E and a method for preparing succinic acid using the same, more particularly, formate dehydrogenases D & E converting formate to carbon dioxide and hydrogen, fdhD and fdhE nucleotide sequences encoding the formate dehydrogenases D & E, recombinant vectors containing the nucleotide sequences,... Agent: Intellectual Property / Technology Law 20070042480 - Process for producing hydrogen: A process for producing hydrogen from bio-oxidisable material is disclosed herein. The process comprises the steps of—introducing the bio-oxidisable material into a reactor provided with an anode and a cathode optionally separated by a cation exchange membrane and containing anodophilic bacteria in an aqueous medium;—applying a potential between the anode... Agent: Christine A Lekutis Medlen & Carroll 20070042482 - Sulfur-oxidizing bacteria and their use in bioleaching processes for sulfured copper minerals: The present invention is related to an isolated chemolithotrophic bacterium belonging to species Acidithiobacillus thiooxidans named Licanantay, deposited in Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH-DSMZ with number DSM 17318, and its use in pure form or in mixtures that contains it for bioleaching processes of minerals or sulfured metallic... Agent: Merchant & Gould PC 20070042483 - Methods and device for adhesive control of internal cell organisation: The present invention relates to methods and devices for adhering cells in a specific and predetermined position with an adhesive control of internal cell organisation, methods for preparing such devices, methods for studying modifications of cell shape and global internal cell organization such as the distribution of cellular compartments, centrosome... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070042484 - Method to remove bisulfite by-products from enzyme compositions: Provided are methods of removing bisulfite material from a composition that contains a bisulfite material and an enzyme. The method includes contacting the composition with a compound containing at least one aldehyde functional group to form an aldehyde-bisulfite complex, whereby the aldehyde-bisulfite complex may be separated from the composition.... Agent: Colgate-palmolive Company 20070042485 - Modified trap protein for producing nano-scale electrical devices, and a method for producing such a protein: The present invention provides a modified TRAP protein formed from a plurality of genetically engineered fusion molecules of TRAP monomers, wherein said fusion molecule consists of two, three or four wild type TRAP monomer equivalents.... Agent: Foley And Lardner LLP Suite 500 20070042486 - Stablized actively aerated compost tea: In combination, an aerobic microbial biomass and viability supporting container therefore. The aerobic microbial biomass is composed of microorganisms extracted from a tea composition and stored as a liquid or applied to a stabilizing medium for storage as a solid. The aerobic microbial biomass is stored in a container which... Agent: Dergosits & Noah LLP Suite 1450 20070042487 - Bioreactor valve island: A bioreactor valve island is provided according to an embodiment of the invention. The bioreactor valve island includes a sparge mixing region that receives and mixes a first air input and one or more first gas inputs and an overlay mixing region that receives and mixes a second air input... Agent: The Ollila Law Group LLC 20070042488 - Cell spraying device, method and sprayed cell suspension: The invention provides a device and methods suitable for producing a cellular spray of cells. The sprayed cells are of interest for covering and growing on a surface, including a skin wound. In applying the method and/or using the device, cells for grafting onto a patient are dispersed in a... Agent: Jorg C. Gerlach 20070042489 - Self-contained assay device for rapid detection of biohazardous agents: The invention relates to self-contained assay cassette for detecting a ligand in a sample. The assay cassette provides for turbulent flow and mixing of the sample with assay components, including receptors that bind to a ligand, optional microspheres capable of binding the receptors or to which other secondary receptors are... Agent: Calfee Halter & Griswold, LLP 20070042490 - Apparatus and method for tissue engineering: A bioreactor system includes a housing and a hydrostatic loading module. The housing includes a chamber with an inlet port and an outlet port. The inlet and outlet ports allowing the chamber to be continuously perfused with a culture medium while chamber is hydrostatically loaded.... Agent: Richard A. Sutkus Tarolli, Sundheim, Covell & Tummino 20070042491 - Amplification of cell populations from embryonic stem cells: Culturing embryonic stem cells without the use of embryoid bodies leads to a increase in the frequency of predetermined cell types.... Agent: Choate, Hall & Stewart LLP 20070042492 - Amino acid sequences facilitating penetration of a substance of interest into cells and/or cell nuclei: The present invention relates to an amino acid sequence being able to facilitate penetration of a substance of interest inside cells and/or cell nuclei and having the following formula (I) [(X1)p [(X)o (B)nX B X X B]m (X2)q Wherein X1 and X2 are amino acid sequences of 1 to 20... Agent: Hunton & Williams LLP Intellectual Property Department 20070042493 - Method and process of genetic transformation using supercritical fluids: Methods are provided for improving the ability of non-naturally transformable cells to take up and integrate DNA. Generally, the invention provides a method for transforming cells, comprising combining deoxyribonucleic acid (DNA) and a recipient cell culture for the uptake of the DNA, placing mixture of recipient cell culture and DNA... Agent: Linda K. Russell 20070042494 - Heterologous retroviral packaging system: A chimeric retroviral vector comprising sequences from at least two retroviruses, wherein at least one of the sequences encodes a cis element, and wherein the chimeric retroviral vector is capable of being packaged in a viral particle; and methods of making and using the same.... Agent: Jenkins, Wilson, Taylor & Hunt, P. A. 02/15/2007 > 153 patent applications in 45 patent subcategories.20070037132 - Separation of platelets from fluid suspensions: A device for separating platelets from a fluid suspension comprises a mixing chamber operable to receive and mix fluid suspensions and an aggregating agent to form platelet aggregates and residual fluid components. A filter can be configured to be in fluid communication with the mixing chamber and can be further... Agent: Thorpe North & Western, LLP. 20070037134 - Functional coupling of t1rs and t2rs by gi proteins, and cell-based assays for the identification of t1r and t2r modulators: The invention resides in part in the discovery that G proteins other than Gα15 couples to T1R and T2R taste receptors, particularly Gi proteins such as Gαi. Related to this discovery, the invention provides cell-based assay methods for identifying compounds that modulate the activity of specific T1R or T2R taste... Agent: Hunton & Williams LLP Intellectual Property Department 20070037133 - Method and apparatus for use of thermally switching proteins in sensing and detecting devices: An apparatus and method for detecting infrared radiation is provided which comprises a temperature-sensing helical coiled-coil protein such as TIpA, CC1, collagen or myosin, incorporated into an electrically conductive film or gel deposited onto an electrically conductive medium such as an electrode, means for recording changes in conductivity or resistance... Agent: Stites & Harbison PLLC 20070037136 - Method of preparing cell cultures from biological specimens for assaying a response to an agent: An improved system for screening a multiple of candidate therapeutic or chemotherapeutic agents for efficacy as to a specific patient, in which a tissue sample from the patient is harvested, cultured and separately exposed to a plurality of treatments and/or therapeutic agents for the purpose of objectively identifying. One particularly... Agent: Cooley Godward Kronish LLP 20070037135 - System and method for the identification and quantification of a biological sample suspended in a liquid: A system for the identification and quantification of a biological sample suspended in a liquid includes a fluorescence excitation module with at least one excitation light source; a sample interface module optically coupled to the fluorescence excitation module for positioning a biological sample to receive excitation light from the at... Agent: The Webb Law Firm, P.C. 20070037137 - Method and kit for quantitative and qualitative determination of human papillomavirus: The present invention relates to a method and kit for quantitative and qualitative determination of human papillomavirus, HPV, in a sample. More precisely, for quantitative and qualitative determination of oncogenic HPV to predict the risk of HPV infection resulting in cervical carcinoma. The method and kit enable simultaneous measurement of... Agent: Dinsmore & Shohl, LLP 20070037143 - Method for screening for protease modulators: The present invention is in the field of pharmaceutical research tools. Specifically, the present invention provides methods for screening compounds or compositions with respect to their ability and/or specificity to modulate the activity of proteases.... Agent: Edwards & Angell, LLP 20070037139 - Method of analyzing gene introduction site: A method of analyzing, in chromosomal DNA having a retroviral vector incorporated therein, DNA region derived from chromosome which is adjacent to the vector, characterized in that a primer extension reaction and a nucleic acid amplification reaction are carried out in the presence of a compound capable of lowering the... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw 20070037142 - Methods and apparatus for detecting viruses using an acoustic device: Methods for detecting viruses are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for the virus, is combined with the sample to form a plurality of analyte-particle complexes. The system also includes a transport arrangement for transporting the sample to the... Agent: Proskauer Rose LLP 20070037140 - Methods and compositions for detecting sars virus: This invention relates generally to the field of virus detection. In particular, the invention provides chips, probes, primers, kits and methods for amplifying and detecting SARS-CoV nucleotide sequence. The clinical and other uses of the present chips, probes, primers, kits and methods are also contemplated.... Agent: Morrison & Foerster LLP 20070037141 - Methods and compositions for inhibition of membrane fusion-associated events, including hiv transmission: The present invention relates to peptides which exhibit potent anti-retroviral activity. The peptides of the invention comprise DP178 (SEQ ID:1) peptide corresponding to amino acids 638 to 673 of the HIV-1LAI gp41 protein, and fragments, analogs and homologs of DP178. The invention further relates to the uses of such peptides... Agent: Jones Day 20070037138 - Standard for immunohistochemistry, immunocytochemistry and molecular cytogenetics: This application describes a method comprising: (a) providing a reference standard or a planar section thereof, the reference standard comprising (i) a support medium; and (ii) a quantity of a detectable entity supported by the support medium; in which the detectable entity has an elongate path; in which a predetermined... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070037194 - Allelic variation in the serotonin transporter (sert) as an indicator of autism: The present invention describes allelic variations in the SERT gene that are linked with the development of autism.... Agent: Fulbright & Jaworski L.L.P. 20070037191 - Apo-2dcr: Novel polypeptides, designated Apo-2DcR, which are capable of binding Apo-2 ligand are provided. Compositions including Apo-2DcR chimeras, nucleic acid encoding Apo-2DcR, and antibodies to Apo-2DcR are also provided.... Agent: Genentech, Inc. 20070037171 - Aptamer-based colorimetric sensor systems: The present invention provides an aptamer-based calorimetric sensor system for determining the presence and optionally the concentration of an analyte in a sample. Methods of utilizing the sensor system and kits that include the sensor also are provided. The sensor utilizes a linker and oligonucleotide functionalized particles to form an... Agent: Evan Law Group LLC 20070037146 - Biodisc microarray and its fabrication, use, and scanning: A biodisc comprises a CD-type optical disc with small feature oligonucleotide probes disposed on its surfaces. The biodisc's probes are either custom-fabricated in-situ with a master-duplicate tandem arrangement of discs that allows one disc and a reading/tracking head to control the probe locations being synthesized pass-by-pass on the duplicate. Or... Agent: Vierra Magen Marcus & Deniro LLP 20070037151 - Cd4+ human papillomavirus (hpv) epitopes: The present invention provides CD4+ T-cell epitopes in E6, E7 and E2 proteins from various strains of human papillomavirus (HPV). In some preferred embodiments, the present invention provides means for the development of HPV vaccines, in particular multivalent vaccines for the prevention of infection with high-risk HPV strains. In additional... Agent: Genencor International, Inc. Attention: Legal Department 20070037174 - Chemiluminescent generated fluorescent labeling: A method for detecting a target analyte in a sample having the steps of: binding the target analyte to a solid substrate; binding a reporter to the bound target to form a label enzyme; contacting a chemiluminescent reagent with the label enzyme to produce a fluorescent precipitate; and detecting fluorescence... Agent: Beckman Coulter Inc. C/o Sheldon Mak Rose & Anderson 20070037173 - Circulating tumor cells (ctc's): early assessment of time to progression, survival and response to therapy in metastatic cancer patients: A cancer test having prognostic utility in predicting time to disease progression, overall survival, and response to therapy in patients with MBC based upon the presence and number of CTC's. The Cell Spotter® System is used to enumerate CTC's in blood. The system immunomagnetically concentrates epithelial cells, fluorescently labels the... Agent: Immunicon Corporation 20070037181 - Compositions and methods for detecting pathogen specific nucleic acids in urine: The invention is based upon the discovery that small nucleic acids from non-viral pathogens are able to cross the kidney and are present in urine of a subject when the subject is infected with the non-viral pathogen. These transrenal DNAs are especially prevalent at smaller sizes under about 300 bp.... Agent: Mintz, Levin, Cohn, Ferris, Glovsky And Popeo, P.C. 20070037148 - Compositions and methods for the treatmetn of natural killer cell related diseases: Compositions and methods for improving detection sensitivity in nucleic acid microarray analysis are disclosed, including methods of purifying nucleic acids, methods of synthesizing fluorescent DNA probes, methods of hybridization, and methods of activating a substrate for target molecule attachment are disclosed.... Agent: Genentech, Inc. 20070037175 - Controlling use of oligonucleotide sequences released from arrays: A method for controlling the use of oligonucleotide sequences released from arrays, comprises synthesizing a chemical array of oligonucleotides on a substrate under conditions for producing an array of cleavable oligonucleotides that are blocked from enzymatic reactions after cleavage. Methods may also include receiving a chemical array of cleavable oligonucleotides... Agent: Agilent Technologies, Inc. Legal Department, Dl429 20070037177 - Cyp19a1 polymorphisms: Isolated CYP19A1 nucleic acid molecules that include a nucleotide sequence variant and nucleotides flanking the sequence variant are described, as well as CYP19A1 allozymes. Methods for determining the aromatase status of an individual also are provided, as are methods for determining if a subject is predisposed to certain clinical conditions.... Agent: Fish & Richardson P.C. 20070037183 - Diagnostic and therapeutic target for macular degeneration: The present invention is based on the discovery of genetic polymorphisms that are associated with ocular diseases and disorders, such as age-related macular degeneration (AMD). In particular, the present invention relates to methods for determining an individuals susceptibility to ocular disorders such as AMD by screening for mutations and/or polymorphisms... Agent: Ronald I. Eisenstein Nixon Peabody LLP 20070037176 - Discrimination method of target base in dna, and allele specific primer used in the method of the same: An object of the present invention is to provide an allele specific primer which is accompanied by less possibility of the false positive and enables definite discrimination when a base immediately adjacent to on the 3′ side of a target SNP base is A, while a base adjacent with one... Agent: Mcdermott Will & Emery LLP 20070037190 - Dna ligase mutants: It is intended to obtain DNA ligase improved in binding ability and reactivity with DNA, particularly thermostable DNA ligase improved in binding ability and reactivity with DNA. The present invention provides a DNA ligase mutant improved in binding ability and reactivity with DNA, which is obtained by partially or completely... Agent: Reed Smith LLP Suite 1400 20070037178 - Endocrine cell lines and method of using the same: In accordance with the present invention, there are provided (1) various cell lines derived from hypothalamus and Langerhans islets of mammals, (2) process for producing an active peptide and expression cloning system of active peptide precursor gene using the cell line as a host, (3) a method of screening or... Agent: Nixon & Vanderhye, PC 20070037147 - Endogenous retrovirus polypeptides linked to oncogenic transformation: HERV-K human endogenous retroviruses show up-regulated expression in tumors. In particular, splicing events in the env region generate a series of transcripts which utilise the +2 reading frame, relative to the env reading frame. The proteins show activity typical of transcriptional regulators, and they also have oncogenic potential. Two related... Agent: Novartis Vaccines And Diagnostics Inc. 20070037185 - Estimating allele frequencies by small pool pcr: Methods of the invention include the application of fluorescent technology, total genome amplification, high throughput automated microsatellite fragment analysis, robotics, and novel computational methods. Computational methods include determining a microsatellite instability (MSI) phenotype (frequency and significance of MSI over multiple loci) using SP-PCR at higher than 0.5 genome equivalents (0.5... Agent: Fulbright & Jaworski L.L.P. 20070037154 - Fine mapping of chromosome 17 quantitative trait loci and use of same for marker assisted selection: Disclosed herein is fine mapping of a quantitative trait locus on Chromosome 17 which is associated with meat traits, growth and fatness. The quantitative trait locus correlates with several major effect genes which have phenotypic correlations with animal growth and meat quality which may be used for marker assisted breeding.... Agent: Mckee, Voorhees & Sease, P.L.C 20070037204 - Gene overexpressed in cancer: Disclosed are a protein encoded by a gene having a nucleotide sequence represented by any of SEQ ID NOs: 1 to 65 or a fragment thereof, an antibody recognizing the protein or antigen-binding fragment thereof, and a polynucleotide having a sequence comprising at least 12 consecutive nucleotides of a nucleotide... Agent: Davidson, Davidson & Kappel, LLC 20070037149 - Human calcium transporter 1 gene, screening method of calcium absorption regulating factor, and calcium absorption regulating factor: An object of the present invention is to provide helpful means which enables: genetic applications such as insertion into an expression vector and transformation of a human CaT1 gene; clarification of a calcium absorption activity mechanism such as the presence of a factor affecting the regulation of a calcium absorption... Agent: Antonelli, Terry, Stout & Kraus, LLP 20070037201 - Hybrid model for dna probe design and validation using nonlinear and linear regression methods: Methods and systems for selecting oligonucleotide probes for use in microarray applications are provided herein. The described methods use a combination of measured probe performance and predicted probe performance to select probes. Nucleic acid arrays containing probes selected by the described methods are described. Also included are algorithms for performing... Agent: Agilent Technologies Inc. 20070037187 - Identification and quantification of a plurality of biological (micro)organisms or their components: Disclosed is a system and method conducting real-time PCR. Unlabeled capture molecules of a specific design are immobilized on a solid support, and contacted with amplicons produced in one or more PCR cycles. Detection of amplicons may take place during or between the PCR cycles while the solid support is... Agent: Howrey LLP 20070037197 - In vitro recombination method: The present invention relates, e.g., to in vitro method, using isolated protein reagents, for joining two double stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity, comprising contacting the... Agent: Carr & Ferrell LLP 20070037199 - Individual discriminating method, as well as array, apparatus and system for individual discriminating test: The invention provides a method of individual discriminating. The method includes selecting and using single nucleotide polymorphism satisfying any one of the conditions defined by this invention.... Agent: C. Irvin Mcclelland Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070037170 - Intravenous immunoglobulin composition: A method for preparing a concentrated, immunoglobulin composition for treating subjects vaccinated against or infected with a pathogenic microorganism, comprising: (a) selecting a population of individuals previously vaccinated against one or more antigens associated with the pathogenic microorganism; (b) determining the level of specific antibodies immunoreactive with the pathogenic microorganism... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw 20070037144 - Leukocyte expression profiling: Leukocyte gene expression profiling is utilized to identify oligonucleotides from gene expression candidate libraries. The expression libraries are generally immobilized on an array. Diagnostic oligonucleotide sets for analysis of leukocyte-related diseases are described.... Agent: Michael R. Ward Morrison & Foerster LLP 20070037195 - Light transmitted assay beads: A micro bead having a digitally coded structure that is partially transmissive and opaque to light. The pattern of transmitted light is determined by to decode the bead. The coded bead may be structured a series of alternating light transmissive and opaque sections, with relative positions, widths and spacing resembling... Agent: Liu & Liu 20070037156 - Metalloproteinase gene polymorphism in copd: A method for genetic testing relating to chronic obstructive pulmonary disease (COPD), including testing for a single nucleotide polymorphism within the metal loproteinase-9 gene, an exon 6, codon 279 Gln/Arg polymorphism, where in presence of the variant polymorphism, particularly homozygous presence, is predictive of susceptibility to COPD. Further provided are... Agent: Peacock Myers, P.C. 20070037153 - Method and device for detecting biomolecules: The present invention relates to a method for detecting a target biomolecule in a sample comprising a plurality of biomolecules, whereby the target biomolecule is provided with a tag, said tag comprising a catalytic active moiety which catalyses a reaction yielding an insoluble reaction product which precipitates on flexible electrically... Agent: Millen, White, Zelano & Branigan, P.C. 20070037196 - Method for in vitro recombination: The present invention relates, e.g., to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity, comprising (a) chewing... Agent: Venable LLP 20070037160 - Method for the dissociation of the extracellular haemoglobin molecule of <i> arenicola marina </i> and the characterisation of the protein chains forming the molecule and the nucleotide sequences coding for said protein chains: The invention relates to a method of dissociating the extracellular haemoglobin molecule of annelids, e.g. Arenicola marina, which can be used to obtain the protein chains forming said molecule. The inventive method is characterised in that it comprises a step consisting in bringing an extracellular haemoglobin sample from annelids, e.g.... Agent: Young & Thompson 20070037192 - Method of purifying recombinant human antithrombin to enhance the viral and prion safety profile: Methods of purifying antithrombin from a variety of source materials including from the milk of transgenic mammals to enhance its safety profile vis-à-vis the removal and/or the inactivation of contaminants. Contaminants would include particulate matter, viruses, and/or prions.... Agent: Wolf Greenfield & Sacks, PC 20070037205 - Methods and apparatus for cell based screening: Methods, kits and systems for identifying at least one compound, from a set of compounds, that modulates the growth or biological activity of a cell. Also high-throughput, tumor cell-based screening assay methods for identifying one or more cell-growth modulating compounds from among a library of compounds.... Agent: Knobbe Martens Olson & Bear LLP 20070037166 - Methods and compositions for diagnosing and monitoring transplant rejection: Methods of diagnosing or monitoring transplant rejection or cytomegalovirus infection in a patient by detecting the expression level of one or more genes or surrogates derived therefrom in the patient are described. Diagnostic oligonucleotides for diagnosing or monitoring transplant rejection or cytomegalovirus infection and kits or systems containing the same... Agent: Morrison & Foerster LLP 20070037167 - Methods and compositions for diagnosing or monitoring autoimmune and chronic inflammatory diseases: Methods of diagnosing or monitoring an autoimmune or chronic inflammatory disease, particularly SLE in a patient by detecting the expression level of one or more genes or surrogates derived therefrom in the patient are described. Diagnostic oligonucleotides for diagnosing or monitoring chronic inflammatory disease, particularly SLE infection and kits or... Agent: Morrison & Foerster LLP 20070037200 - Methods and compositions for diagnosis, stratification, and monitoring of alzheimer's disease and other neurological disorders in body fluids: The inventors have discovered a collection of proteinaceous biomarkers (“AD biomarkers) which can be measured in peripheral biological fluid samples to aid in the diagnosis of neurodegenerative disorders, particularly Alzheimer's disease and mild cognitive impairment (MCI). The invention further provides methods of identifying candidate agents for the treatment of Alzheimer's... Agent: Morrison & Foerster LLP 20070037184 - Methods and kits for evaluating dna methylation: Methods and kits are disclosed for determining the degree of methylation of at least one target region. Typically a sample is exposed to a modifying agent to obtain a modified sample comprising a modified nucleotide. At least one target region in the modified sample is amplified. Some of the disclosed... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070037189 - Methods for amplification monitoring and gene expression profiling, involving real time amplification reaction sampling: The invention relates to methods of monitoring the amplification of one or more nucleic acid sequences of interest. More particularly, the invention relates to methods of monitoring the amplification of sequences of interest in real time. The methods disclosed herein provide methods for monitoring the amplification of one sequence or... Agent: Palmer & Dodge, LLP Kathleen M. Williams 20070037198 - Methods for genetic analysis: Methods are described for assessing an individual's likelihood of developing or exhibiting a multifactorial trait, and for predicting the effectiveness of a drug treatment regimen in an individual. The methods include determining a plurality of genotypes for the individual at a plurality of biallelic polymorphic loci, using the genotypes to... Agent: Perlegen Sciences, Inc. Legal Department 20070037188 - Methods for modulating transcriptional activation using mint proteins: The present invention is directed to isolated nucleic acids encoding Mint protein variants having enhanced abilities to modulate the transcriptional activation mediated by the cytoplasmic tail of the amyloid precursor protein (APP) relative to wild-type Mint proteins. The present invention is further directed toward purified Mint protein variants having enhanced... Agent: Baker & Botts L.L.P. 20070037179 - Methods of diagnosing and prognosticating solid tumors and melanoma: The invention relates to the diagnosis and prognosis of solid tumors and melanoma by detecting increased cellular levels of A3 receptors in tissue and/or leukocytes obtained from patients with cancer or patients at risk for developing cancer.... Agent: Jones Day 20070037158 - Methods of modulating bone growth, bone remodeling and adiposity: The present invention provides a method of determining a modulator of Y receptor associated bone remodeling and/or bone growth and/or adiposity in a human or animal subject. The present invention further provides a method of determining a modulator of Y receptor associated differentiation of a mesenchymal stem cell into an... Agent: Quine Intellectual Property Law Group, P.C. 20070037193 - Modulation of peroxisome proliferator-activated receptors: A method of treating a peroxisome proliferators-activated receptors related disease by administering to a subject in need thereof an effective amount of a modulator of 15-keto prostaglandin-Δ13-reductase. Also disclosed are methods of identifying a compound for inhibiting activity of the reductase and of lowering blood glucose levels by administering to... Agent: Fish & Richardson PC 20070037161 - Motoneuronotrophic factor gene sequences: The invention is directed nucleic acids associated with sequences encoding motoneuronotrophic factors, which promote the survival, growth, proliferation, or maintenance of mammalian neurons, polypeptides encoded by the sequences, and assays for detecting the sequences.... Agent: Duane Morris LLP 20070037182 - Multiplex assays for inferring ancestry: Oligonucleotide primers and probes for detecting Ancestry informative marker (AIMs) polynucleotides that contain a single nucleotide polymorphism or that contain an insertion or deletion, are provided, as are methods of using the oligonucleotide primers and probes to draw an inference as to a trait of an individual. The trait can... Agent: Dla Piper US LLP 20070037203 - Novel 21910, 56634, 55053, 2504, 15977, 14760, 25501, 17903, 3700, 21529, 26176, 26343, 56638, 18610, 33217, 21967, h1983, m1983, 38555 or 593 molecules and uses therefor: The invention provides isolated nucleic acids molecules, designated 21910, 56634, 55053, 2504, 15977, 14760, 25501, 17903, 3700, 21529, 26176, 26343, 56638, 18610, 33217, 21967, h1983, m1983, 38555 and 593 nucleic acid molecules. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing 21910, 56634, 55053, 2504, 15977, 14760,... Agent: Millennium Pharmaceuticals, Inc. 20070037145 - Novel compositions and methods for cancer: The present invention relates to novel sequences for use in diagnosis and treatment of carcinomas, especially lymphoma carcinomas. In addition, the present invention describes the use of novel compositions for use in screening methods.... Agent: Shantanu Basu Morrison & Foerster LLP 20070037163 - Nucleic acid and amino acid sequences relating to staphylococcus epidermidis for diagnostics and therapeutics: The invention provides isolated polypeptide and nucleic acid sequences derived from Staphylococcus epidermidis that are useful in diagnosis and therapy of pathological conditions; antibodies against the polypeptides; and methods for the production of the polypeptides. The invention also provides methods for the detection, prevention and treatment of pathological conditions resulting... Agent: Buchanan Ingersoll PC (including Burns, Doane, Swecker & Mathis) 20070037165 - Polymorphisms in known genes associated with human disease, methods of detection and uses thereof: The present invention is based on the discovery of novel polymorphisms (SNPs) in the genes known in the art to contribute to human disease. Such polymorphisms can lead to a variety of disorders that are mediated/modulated by a variant human disease associated protein. The present invention provides reagents used for... Agent: Celera Genomics Attn: Wayne Montgomery, Vice Pres, Intel Property 20070037168 - Polymorphisms in known genes associated with inflammatory autoimmune disease, methods of detection and uses thereof: The present invention is based on the discovery of novel polymorphisms (SNPs) in the genes known in the art to contribute to inflammatory and autoimmune disorders. Such polymorphisms can lead to a variety of disorders that are mediated/modulated by a variant inflammatory and autoimmune disorders associated protein. The present invention... Agent: Celera Genomics Attn: Wayne Montgomery, Vice Pres, Intel Property 20070037162 - Polymorphisms in known genes associated with osteoporosis, methods of detection and uses thereof: The present invention is based on the discovery of novel polymorphisms (SNPs) in the genes known in the art to contribute to osteoporosis. Such polymorphisms can lead to a variety of disorders that are mediated/modulated by a variant osteoporosis associated protein. The present invention provides reagents used for detecting and... Agent: Celera Genomics Attn: Wayne Montgomery, Vice Pres, Intel Property 20070037202 - Potentiation of cancer therapies by znf217 inhibition: This invention provides methods, reagents and kits for treating cancer in a patient or subject, e.g., a human. Accordingly, the present methods can be used to monitor the efficacy of a cancer treatment and to treat cancer, e.g., by inhibiting the expression and/or activity of ZNF217 in a neoplastic cell.... Agent: Townsend And Townsend And Crew, LLP 20070037152 - Random array dna analysis by hybridization: The invention relates to methods and devices for analyzing single molecules, i.e. nucleic acids. Such single molecules may be derived from natural samples, such as cells, tissues, soil, air and water without separating or enriching individual components. In certain aspects of the invention, the methods and devices are useful in... Agent: Marshall, Gerstein & Borun LLP 20070037169 - Selective dehybridization using electrochemically-generated reagent on an electrode microarray: The present invention provides a method for selective dehybridization by electrochemically-generated (ECG) reagent on an electrode microarray. The ECG reagent is generated by activation of selected electrodes. Activation alters pH in the vicinity of only the selected electrodes. In one embodiment, the increase or decrease in pH is sufficient to... Agent: Combimatrix Corporation 20070037172 - Separation and concentration of biological cells and biological particles using a one-dimensional channel: This document discloses, among other things, a method and system for a substrate having a bypass region for fluid flow. The substrate includes a plurality of fluid flow channels with each channel configured to concurrently allow fluid flow while precluding passage of a target particle or object.... Agent: Schwegman, Lundberg, Woessner & Kluth, P.A. 20070037180 - Site-specific immunization in order to establish antibodies with specificity for the e7 oncoprotein of high-risk hpv's: The present invention relates to a method for establishment of antibodies with specificity for high-risk HPVs compared to immunization using the whole antigen of high-risk HPVs, wherein the method includes an exclusion of evolutionary conserved motifs as well as regions with high similarity to E7 proteins of low-risk HPVs, as... Agent: Gauthier & Connors, LLP 20070037157 - Socs-3 promoter methylation in cancer: This invention provides compositions and methods for the diagnosis and treatment of cancers that exhibit decreased SOCS-3 expression.... Agent: Townsend And Townsend And Crew, LLP 20070037155 - Substrate for biomolecule microarray, biomolecule microarray, device and method of promoting interaction, and method of detecting interaction: The substrate for biomolecule microarray has one or more spots for immobilizing a biomolecule. The spot for immobilizing a biomolecule protrudes from the surface of the substrate and has a flat surface for spotting on the top thereof, at least the surface of the substrate around the protruding spot part,... Agent: Birch Stewart Kolasch & Birch 20070037159 - Tetrahydrofolate synthetase gene: By finding a novel tetrahydrofolate synthetase gene and a protein encoded by said gene, a method for identifying a compound which inhibits cell growth accelerating activity of said protein is provided, and a judging method, a preventing method and a treating method of colon cancer are provided. A DNA comprising... Agent: Sughrue Mion, PLLC 20070037186 - Thyroid fine needle aspiration molecular assay: The present invention relates to methods, compositions and articles directed to diagnosing thyroid carcinoma, differentiating between thyroid carcinoma and benign thyroid diseases, testing indeterminate thyroid fine needle aspirate samples of thyroid nodules, and determining patient protocols and outcomes.... Agent: Philip S. Johnson Johnson & Johnson 20070037164 - Tumor necrosis factor alpha: The present disclosure describes the use of genetic variance information for genes involved in inflammatory or immunologic disease, disorder, or dysfunction. The variance information is indicative of the expected response of a patient to a method of treatment. Methods of determining relevant variance information and additional methods of using such... Agent: Fish & Richardson PC 20070037150 - Tyrosine kinome: Protein kinases are important signaling molecules involved in tumorigenesis. Mutational analysis of the human tyrosine kinase gene family (98 genes) identified somatic alterations in −20% of colorectal cancers, with the majority of mutations occurring in NTRK3, FES, GUCY2F and a previously uncharacterized tyrosine kinase gene called MCCK/MLK4. Most alterations were... Agent: Banner & Witcoff 20070037215 - Assay particles and methods of use: The invention provides assay particles useful, for example, for detecting analytes and binding molecule interactions. One type of assay particle includes a core portion encased by a shell portion, wherein the shell portion comprises an inorganic phosphor that binds selectively to a target molecule. Another type of an assay particle... Agent: Perkinelmer Las, Inc.IPLegal Department 20070037210 - Cytokine receptor modulators, method of identifying same, and method of modulating cytokine receptors activity with same: The present invention relates to a method for identifying a non-competitive peptide, which inhibits the activity of a cytokine receptor. This method includes the steps of selecting a candidate peptide containing from about 7 to about 20 amino acids derived from a flexible region of a cytokine receptor, and determining... Agent: Clark & Elbing LLP 20070037216 - Dual expression vector system for antibody expression in bacterial and mammalian cells: The present invention provides a dual expression vector, and methods for its use, for the expression and secretion of a full-length polypeptide of interest in eukaryotic cells, and a soluble domain or fragment of the polypeptide in bacteria. When expressed in bacteria, transcription from a bacterial promoter within a first... Agent: Jones Day 20070037214 - Generation and selection of protein library in silico: The present invention provides a methodology for efficiently generating and screening protein libraries for optimized proteins with desirable biological functions, such as improved binding affinity towards biologically and/or therapeutically important target molecules. The process is carried out computationally in a high throughput manner by mining the ever-expanding databases of protein... Agent: Merck And Co., Inc 20070037218 - Human gene critical to fertility: Disclosed herein are novel nucleic acid and protein sequences that are essential to fertility. In particular, human Mater cDNA and protein sequences are provided. Functional MATER is required for female fertility; zygotes that arise from Mater null oocytes do not progress beyond the two-cell stage. Methods are described for using... Agent: Klarquist Sparkman, LLP 20070037206 - Human secreted proteins: The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating diseases, disorders, and/or conditions related to said human secreted proteins. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors,... Agent: Human Genome Sciences Inc 20070037212 - Human t2r receptors recognizing a class of bitter molecules from coffee: The present invention relates to the discovery that specific human taste receptors in the T2R taste receptor family respond to particular bitter compounds, i.e., chlorogenic lactone compounds that contribute at least partially to the bitter taste of many coffee beverages. The present invention further relates to the use of these... Agent: Hunton & Williams LLP Intellectual Property Department 20070037207 - Latex reagent for adiponectin analysis and method of adiponectin analysis: A latex reagent for analyzing adiponectin, comprising a suspension of latex particles carrying a substance which specifically binds to adiponectin, is disclosed. Further, a method for analyzing adiponectin, comprising (1) obtaining a biological liquid possibly containing adiponectin, and (2) bringing the biological liquid, while maintaining the state in which the... Agent: Heslin Rothenberg Farley & Mesiti PC 20070037208 - Method for detecting cardiac ischemia via changes in b-natriuretic peptide levels: The present invention relates to a method of detecting cardiac ischemia by measuring the levels of BNP or NT-proBNP. Increases in BNP or NTproBNP levels in an individual are indicative of cardiac ischemia.... Agent: Licata & Tyrrell P.C. 20070037213 - Method of analyzing protein and kit for analyzing protein: The expression and the phosphorylation level of a target protein are determined without performing complicated operations involving risk; the expression and the phosphorylation level of the target protein are simultaneously determined, by separating and detecting the specific protein from other proteins different from the specific protein, and by specifically detecting... Agent: Mcdermott Will & Emery LLP 20070037211 - Peptide antagonists for inhibiting heat shock protein (hsp 16.3) of mycobacterium tuberculosis: A process to identify peptide antagonists of Hsp16.3, a chaperon protein necessary for the survival of Mycobacterium tuberculosis in the dormant phase is described. Affinity selection of a 7-mer and a 12-mer random peptide libraries displayed on bacteriophage M13 was performed using recombinant Hsp16.3 as template and two peptide phage... Agent: Summa, Allan & Additon, P.A. 20070037209 - Soluble ectodomain fragments of met and uses thereof: The invention relates a fragment derived from the MET ectodomain which the inventors have found is capable, in monomer form, of binding to HGF/SF either in the presence or absence of heparin. The availability of soluble, monomeric forms of the MET receptor enabled studies of its solution properties and HGF/SF... Agent: Nixon & Vanderhye, PC 20070037217 - Structure-based selection and affinity maturation of antibody library: The present invention provides a structure-based methodology for efficiently generating and screening protein libraries for optimized proteins with desirable biological functions, such as antibodies with high binding affinity and low immunogenicity in humans. In one embodiment, a method is provided for constructing a library of antibody sequences based on a... Agent: Merck And Co., Inc 20070037220 - Biomolecule specificity detection and selection method and apparatus: We disclose a method of detecting a polypeptide of interest produced by a cell or a cell colony, the method comprising: (a) exposing the polypeptide to a class marker capable of identifying a class of polypeptides to which the polypeptide of interest belongs; (b) exposing the polypeptide to a specificity... Agent: Foley And Lardner LLP Suite 500 20070037221 - Diagnosis of liver pathology through assessment of protein glycosylation: Methods for diagnosing pathology of the liver in a subject suspected of having such pathology are disclosed. The methods comprise quantifiably detecting glycosylation, and more specifically fucosylation, on proteins in biological fluids, and comparing the detected glycosylation with reference values for the glycosylation of such proteins in healthy or disease... Agent: Woodcock Washburn LLP 20070037222 - Lineage restricted glial precursors: Glial precursor cell populations from mammalian central nervous system and embryonic stem cells has been isolated. These A2B5+ E-NCAM− glial-restricted precursor (GRP) cells are capable of differentiating into oligodendrocytes, A2B5+ process-bearing astrocytes, and A2B5− fibroblast-like astrocytes, but not into neurons. GRP cells can be maintained by regeneration in culture. GRP... Agent: Licata & Tyrrell P.C. 20070037219 - Rhesus monkey bombesin receptor subtype-3 (brs-3), nucleotides encoding same, and uses thereof: A rhesus monkey bombesin receptor subtype-3 has been isolated, cloned and sequenced. This receptor is characteristic of the G-protein family of receptors. Isolated rhesus monkey bombesin receptor subtype-3 may be used to screen and identify novel bombesin receptor modulators that may contribute to the regulation of endocrine processes, metabolism, or... Agent: Merck And Co., Inc 20070037224 - Quantitative assays for pdgfr-beta in body fluids: The present invention is directed to the detection and quantification of total PDGFR-β in body fluids, particularly serial changes of total PDGFR-β levels in a subject's body fluids. Further, the invention is directed to detecting and quantitatiing total PDGFR-β in conjunction with one or more other proteins, such as, oncoproteins,... Agent: Leona L. Lauder 20070037225 - Rapid microbial detection and antimicrobial susceptibility testing: A method for the detection of microorganisms in a sample comprising contacting said sample with a biosensor concentration module, allowing microorganisms to grow for a first period of time and detecting growth of discrete microorganisms as an indication of the presence of said microorganisms.... Agent: Robin M. Silva Dorsey & Whitney LLP 20070037229 - Altered intracellular localization of brk/sik protein tyrosine kinase in human prostate tumors: The invention provides methods for detecting abnormal prostate conditions, such as benign prostatic hyperplasia (BPH), prostatic intraepithelial neoplasia (PIN), and adenocarcinoma, in an animal by comparing the amount of the Breast Tumor Kinase (BRK) tyrosine kinase in the nuclei of prostate luminal epithelial cells in a test sample with an... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070037227 - Annexin proteins and autoantibodies as serum markers for cancer: The present invention relates to screening methods for diagnosis, prognosis, or susceptibility to cancer in a subject by means of detecting the presence of serum autoantibodies to specific annexin protein antigens in sera from subjects. The present invention also provides screening methods for diagnosis and prognosis of cancer in a... Agent: Arent Fox PLLC 20070037226 - Diagnostics and therapeutics for diseases associated with g-protein coupled receptor adipor1(adipor1): The invention provides a human AdipoR1 which is associated with the cardiovascular diseases, dermatological diseases, gastroenterological diseases, cancer, hematological diseases, inflammation, respiratory diseases, neurological diseases and urological diseases. The invention also provides assays for the identification of compounds useful in the treatment or prevention of cardiovascular diseases, dermatological diseases, gastroenterological... Agent: Jeffrey M. Greenman 20070037228 - Method for predicting the response to a treatment: The invention is related to a method of predicting the response to a treatment with a HER inhibitor in a patient comprising the steps of assessing a biomarker or a combination of biomarkers selected from the group consisting of amphiregulin, an epidermal growth factor, a transforming growth factor alpha, and... Agent: Hoffmann-la Roche Inc. Patent Law Department 20070037231 - Methods and apparatus for detecting bacteria using an acoustic device: Methods for detecting bacteria are provided. A plurality of particles, each of which is coated with a capture agent having an affinity for the bacteria, is combined with the sample to form a plurality of analyte-particle complexes. The system also includes a transport arrangement for transporting the sample to the... Agent: Proskauer Rose LLP 20070037230 - Peptides for selectively and specifically binding bacillus anthracis spores and use thereof in landscape phages: Several peptides for selectively and specifically binding Bacillus anthracis spores are disclosed herein. It is contemplated that the isolated peptides will be incorporated into diagnostic probes. The diagnostic probes may include landscape page probes and antibody probes, as well as any other probes known in the art. Inventors contemplate that... Agent: Andrus, Sceales, Starke & Sawall, LLP 20070037223 - Isotope labeling methods: The present invention relates to a method for the analysis of differential expression of proteins employing a radioactive label, characterized by cleaving a tag from peptides labeled with a cICAT reagent, separating and purifying the resultant labeled peptides, and performing an analysis in mass spectrometry.... Agent: Sughrue Mion, PLLC 20070037232 - Detection of ngal in chronic renal disease: Methods of assessing the ongoing kidney status in a subject afflicted with chronic renal failure (CRF) by detecting the quantity of Neutrophil Gelatinase-Associated Lipocalin (NGAL) in fluid samples over time is disclosed. NGAL is a small secreted polypeptide that is protease resistant and consequently readily detected in the urine and... Agent: Hasse & Nesbitt LLC 20070037233 - Detection of preharvest sprouting in cereal grains: A two-site immunoassay for the qualitative or quantitative detection of alpha-amylase in a test sample, said immunoassay comprising; (i) exposing said test sample to a first (“capture”) antibody or fragment thereof which specifically or preferentially binds to a first epitope on said alpha-amylase, under conditions permitting binding of said first... Agent: Fenwick & West LLP 20070037234 - Fluorogenic enzyme substrates and methods of preparation: This invention relates to hydrolase fluorogenic substrates with improved cell permeability, methods for the preparation thereof, and methods of measuring activities of hydrolases, particularly in cell-based assays. The substrates easily diffuse into the cells, where they are enzymatically processed to yield photostable fluorescent products, and are particularly fitted for visualising... Agent: Philip S. Johnson Johnson & Johnson 20070037236 - Factor xa-based heparin assay using a heparin-modifying component: The present invention is concerned with the diagnosis of coagulation and relates to a method for determining the heparin activity in a sample, where the sample is initially incubated with a heparin-modifying component, and then the heparin-dependent FXa inactivation is measured.... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070037235 - Soluble phospholipids for use in clotting factor assays: The present invention provides a soluble phospholipid reagent and assays of clotting activity using the same. The methods of the invention can be used to carry out any clotting assay or other assay of clotting activity that traditionally relies on platelet membranes or synthetic membrane preparation by substituting therefor the... Agent: Myers Bigel Sibley & Sajovec 20070037239 - Composition for measuring glucose having improved substrate specificity: The present invention relates to a method for lowering activity with respect to maltose in glucose measurement comprising a step of reacting modified pyrroloquinoline quinone dependent glucose dehydrogenase subjected to amino acid sequence modification, wherein pyrroloquinoline quinone dependent glucose dehydrogenase is reacted in the presence of at least one type... Agent: Leydig Voit & Mayer, Ltd 20070037238 - Composition for suppressing pqqgdh reaction inhibition: The present invention includes a step of reacting modified PQQGDH in the presence of one or more selected from the group consisting of succinic acid, glutaric acid, malonic acid, malic acid, phthalic acid, 2-ketoglutaric acid, 3,3-dimethylglutaric acid, pimelic acid, suberic acid, adipic acid and citric acid adipic acid, an amino... Agent: Leydig Voit & Mayer, Ltd 20070037237 - Method for improving substrate specificity of pyrroloquinoline quinone-dependent glucose dehydrogenase: The present invention relates to a method for reducing activity for maltose in glucose measurement which comprises a step of reacting pyrroloquinoline quinone-dependent glucose dehydrogenase, the method comprising a step of keeping the pH acidic during the measurement reaction.... Agent: Leydig Voit & Mayer, Ltd 20070037240 - Control of protein activity using a conducting polymer: A device having a substrate and an enzyme attached to the substrate. The substrate has a polymeric surface having at least two conductivity states. A minimum voltage that does not cause a redox reaction in the enzyme may be applied to the polymeric surface to change the conductivity state of... Agent: Naval Research Laboratory Associate Counsel (patents) 20070037241 - Method and kit for assessing anxiety or disposition thereto in a subject: The invention provides methods/kits for assessing levels of trait or state anxiety in a subject by comparing genotypes and/or expression patterns at the ACHE, PON1 and/or BChE genes to the genotype and/or expression pattern of the genes in a reference population whose genotype and/or expression pattern of the genes is... Agent: Prtsi, Inc. 20070037242 - On-line enzymatic digestion in separation-detection methods: Apparatus and methods are disclosed for digesting a biopolymer in a medium. The medium is disposed adjacent a wall of a hollow element wherein at least a portion of the wall is porous. The medium is then exposed to digestion conditions to cleave the biopolymer into fragments. The fragments are... Agent: Agilent Technologies Inc. 20070037243 - Process for producing alpha-glycosylated dipeptide and method of assaying alpha-glycosylated dipeptide: The present invention relates to a method for producing α-glycated dipeptide, which comprises causing protease to act on N-terminal-glycated peptide or N-terminal-glycated protein. The present invention further relates to a method for determining the amount of α-glycated dipeptide, which comprises causing a fructosyl peptide oxidase to act on the α-glycated... Agent: C. Irvin Mcclelland Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070037244 - Materials and reactor systems having humidity and gas control: The present invention is directed to materials and reactor systems having humidity and/or gas control. The material may have high oxygen permeability and/or low water vapor permeability. In some cases, the material may have sufficient permeance and/or permeability to allow cell culture to occur in a chip or other reactor... Agent: Wolf Greenfield & Sacks, PC 20070037245 - Method of posttranslational modification by adding mycrosomal membrane in cell-free protein synthesis: It is intended to provide a novel method for posttranslational modification in cell-free protein synthesis and a novel method for cell-free protein synthesis with the use of such posttranslational modification reaction. A method for synthesizing a protein in a cell-free system using an extract liquid for cell-free protein synthesis, characterized... Agent: Rader Fishman & Grauer PLLC 20070037255 - Antibody variants with faster antigen association rates: Antibody variants with faster antigen association rates are disclosed. The antibody variants have one or more amino acid alteration(s) in or adjacent to at least one hypervariable region thereof which increase charge complementarity between the antibody variant and an antigen to which it binds.... Agent: Genentech, Inc. 20070037252 - Compositions and methods for topical application and transdermal delivery of an oligopeptide: The invention relates to the transdermal application of oligopeptides for reducing synaptic transmission in tissues of an animal. In one aspect, this invention relates to compositions comprising an oligopeptide and optionally a carrier comprising a positively charged “backbone” having positively charged branching or “efficiency” groups, as described herein. Most preferably... Agent: King & Spalding 20070037254 - Expression vectors and methods: Vectors and methods for efficient isolation of recombinant cells expressing high levels of a desired protein are provided. The vectors comprise an amplifiable selectable gene, a fluorescent protein gene, and a gene encoding a desired product in a manner that optimizes transcriptional and translational linkage.... Agent: Genentech, Inc. 20070037250 - Method for obtaining precursor z and use thereof for the production of a means for therapy of human molybdenum cofactor deficiency: The invention relates to a method for obtaining the molybdopterin derivative precursor Z, wherein an over-production of precursor Z occurs in host organisms by recombinant expression of precursor Z synthesizing proteins. The invention further relates to the use of precursor Z for the production of a means for the therapy... Agent: Akerman Senterfitt 20070037246 - Methods and compositions for enhanced protein expression and purification: Methods for enhancing expression levels and secretion of heterologous fusion proteins in a host cell are disclosed.... Agent: Dann, Dorfman, Herrell & Skillman 20070037253 - Methods and compositions for treatment of arthritis and cancer: The present invention provides a new 18-residue homodimerized peptide, designated PIP [59-67] dimer (SEQ ID NO: 1), which is a mutant of the optimized anti-inflammatory peptide P-NT.II, the patent for which has recently been filed [1]. P-NT.II has the potential to modulate both the inflammatory and bone damaging components of... Agent: Harness, Dickey & Pierce, P.L.C 20070037249 - Molecules that block viral infectivity and methods of use thereof: Embodiments relate to the discovery that certain tripeptide amides and glycine amide can be used to inhibit viral infection, including human immunodeficiency virus (HIV) infection. More specifically, medicaments comprising said tripeptide amides and/or glycine amide and methods of using said compounds for the prevention and treatment of viral infection, such... Agent: Knobbe Martens Olson & Bear LLP 20070037251 - Novel protein expression system: The present invention relates to proteomics, especially downstream processing of proteins. The present invention also relates to novel expression cassettes having unique cleavage sites for efficient removal of purification tags. The invention further provides expression systems and a methods for purifying and isolating proteins.... Agent: Edwards & Angell, LLP 20070037256 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070037248 - Production of modified glycoproteins having multiple antennary structures: The present invention relates to eukaryotic host cells, especially lower eukaryotic host cells, having modified oligosaccharides which may be modified further by heterologous expression of a set of glycosyltransferases, sugar and sugar nucleotide transporters to become host-strains for the production of mammalian, e.g., human therapeutic glycoproteins. The process provides an... Agent: Fish & NeaveIPGroup Ropes & Gray LLP 20070037247 - Thermostable ribonuclease h: A polypeptide having an RNaseH activity and being highly useful in gene engineering; a gene encoding. this polypeptide; and a genetic engineering process for producing the polypeptide.... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw 20070037257 - Recombinant vaccine against botulinum neurotoxin: This invention is directed to preparation and expression of synthetic genes encoding polypeptides containing protective epitopes of botulinum neurotoxin (BoNT). The invention is also directed to production of immunogenic peptides encoded by the synthetic genes, as well as recovery and purification of the immunogenic peptides from recombinant organisms. The invention... Agent: Baker & Botts L.L.P. 20070037258 - Methods and compositions for enhancing protein folding: The present invention relates to methods and compositions for enhancing protein folding. In particular, the present invention relates to methods for directing recombinantly expressed proteins to protein folding chaperones.... Agent: Medlen & Carroll, LLP Suite 350 20070037259 - Integration of alternative feedstreams for biomass treatment and utilization: The present invention provides a method for treating biomass composed of integrated feedstocks to produce fermentable sugars. One aspect of the methods described herein includes a pretreatment step wherein biomass is integrated with an alternative feedstream and the resulting integrated feedstock, at relatively high concentrations, is treated with a low... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070037260 - Process for producing optically active 2-alkycysteine, derivative thereof, and processes for production: There is provided a process for producing an optically active 2-alkylcysteine or a salt thereof, characterized by allowing cells of microorganism or treated products thereof having an activity of stereoselective hydrolysis of the amide bond of a 2-alkyl-L-cysteinamide or a salt thereof to act on a 2-alkylcysteinamide consisting of a... Agent: Fitch Even Tabin And Flannery 20070037261 - Genes encoding carbon metabolism and energy-producing proteins: The invention relates to novel nucleic acid molecules, to the use thereof for constructing genetically improved microorganisms and to methods for preparing fine chemicals, in particular amino acids, with the aid of said genetically improved microorganisms.... Agent: Lahive & Cockfield, LLP 20070037262 - Genes encoding genetic stability, gene expression and folding proteins: The invention relates to novel nucleic acid molecules, to the use thereof for constructing genetically improved microorganisms and to methods for preparing fine chemicals, in particular amino acids, with the aid of said genetically improved microorganisms.... Agent: Lahive & Cockfield, LLP 20070037263 - Novel acetoacetyl-coa reductase and process for producing optically active alcohol: An object of the present invention is to provide a simple and easy process for producing optically active alcohols, specifically, a (R)-3-hydroxypentanenitrile, optically active 3-hydroxybutanoic esters, and optically active 1-phenylethanol derivatives, and to provide a novel enzyme useful for producing the above optically active alcohols, particularly a (R)-3-hydroxypentanenitrile. The present... Agent: Brinks Hofer Gilson & Lione 20070037264 - Preparation of (e)- and (z)-2-methyl-2-butenoic acids: A method has been developed to prepare (E)- and (Z)-2-methyl-2-butenoic acids (2M2BA) from a mixture of (E,Z)-2-methyl-2-butenenitriles (2M2BN) by the regioselective hydrolysis of (E)-2M2BN to (E)-2-methyl-2-butenoic acid (2M2BA) using enzyme catalysts having either a nitrilase activity or a combination of nitrile hydratase and amidase activities. The method provides high yields... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070037265 - Materials and methods for efficient lactic acid production: The present invention provides derivatives of ethanologenic Escherichia coli K011 constructed for the production of lactic acid. The transformed E. coli of the invention are prepared by deleting the genes that encode competing pathways followed by a growth-based selection for mutants with improved performance. These transformed E. coli are useful... Agent: Saliwanchik Lloyd & Saliwanchik A Professional Association 20070037266 - Process for producing erythritol: The disclosure relates to a process for producing erythritol that includes using an aqueous carbohydrate source that meets the requirements of 7 C.F.R. 205.102 (2002), and at least one other component that meets the requirements of 7 C.F.R. 205.605 (2002), to produce a media, and fermenting the media in the... Agent: Cargill, Incorporated 20070037267 - Methods and systems for producing ethanol using raw starch and fractionation: The present invention relates to methods for producing high levels of alcohol during fermentation of plant material, and to the high alcohol beer produced. The method can include fractionating the plant material. The present invention also relates to methods for producing high protein distiller's dried grain from fermentation of plant... Agent: Merchant & Gould PC 20070037268 - Hydrogen producing bioreactor with sand for the maintenance of a high biomass bacteria: This invention discloses an apparatus for the concentrated growth of hydrogen generating microorganisms. The apparatus includes a receptacle with an interior cavity that contains a material in which the hydrogen generating microorganisms are located as well as one or more substrates that are used to facilitate the growth of hydrogen... Agent: Eckert Seamans Cherin & Mellott 20070037269 - Mutants of desoxycytidine kinase having extended enzymatic activity: The invention relates to a method for artificial in vivo evolution of proteins, said method making it possible to bring about the evolution of a protein X by complementation of a relative protein Y,X and Y both belonging to the same class of enzyme commission (EC) nomenclature or belonging to... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070037270 - Method for the purification of alpha-1 proteinase inhibitor (a1pi): The present invention relates to a method for the purification of alpha-1 proteinase inhibitor (a1PI) from protein fractions. More specifically, the invention relates to an improved method for the purification of alpha-1 proteinase inhibitor (a1PI), wherein the yield of a1PI can be increased by thawing the starting material and incubating... Agent: Baxter Healthcare Corp. 20070037271 - Vitrification apparatus for microdrop vitrification of cells and a method of microdrop vitrification of cells using the apparatus: An apparatus for microdrop vitrification has a tank and two wings. The tank has a bottom, two side edges, two top edges, two sidewalls, a lowest bottom, a drain and a spout. The drain is defined in one of the sidewalls at the bottom of the tank. The spout is... Agent: Hershkovitz & Associates 20070037273 - Devices and methods for pharmacokinetic-based cell culture system: Devices, in vitro cell cultures, systems, and methods are provided for microscale cell culture analogous (CCA) device.... Agent: Wilson Sonsini Goodrich & Rosati 20070037274 - Microarray synthesis instrument and method: During the light illumination period of a monomer addition cycle in synthesizing an DNA microarray, undesirable reflections of illumination light from various interfaces that the illumination light passes through near the synthesis surface of the substrate may reduce the light-dark contrast, and negatively affect the precision and resolution of the... Agent: Quarles & Brady LLP 20070037272 - System for optically analyzing a substance: A microfluidic analysis system for optically analyzing a substance includes a light source having a plurality of selectable single-wavelength light sources, a substance presentation member optically coupled to the light source, and an optical detection system associated with the substance presentation member.... Agent: Hewlett Packard Company 20070037276 - Continuous culture apparatus with mobile vessel, allowing selection of fitter cell variants and producing a culture in a continuous manner: A method and device for growing plant, animal or stem cells in a continuous manner.... Agent: Young & Thompson 20070037275 - Devices and methods for pharmacokinetic-based cell culture system: Devices, in vitro cell cultures, systems, and methods are provided for microscale cell culture analogous (CCA) device.... Agent: Wilson Sonsini Goodrich & Rosati 20070037277 - Pharmacokinetic-based culture system with biological barriers: Systems and methods are disclosed for microscale pharmacokinetics. Various organs and their interactions with drug compounds can be simulated in vitro by use of microscale compartments that can be interconnected by microscale channels. Cells or cellular materials associated with the organs can be cultured in such compartments to allow interactions... Agent: Knobbe Martens Olson & Bear LLP 20070037278 - Materials and reactor systems having humidity and gas control: The present invention is directed to materials and reactor systems having humidity and/or gas control. The material may have high oxygen permeability and/or low water vapor permeability. In some cases, the material may have sufficient permeance and/or permeability to allow cell culture to occur in a chip or other reactor... Agent: Wolf Greenfield & Sacks, PC 20070037279 - Cell culture system: The present invention provides a novel apparatus to grow cells where the cultivation chamber (1) is partially filled with liquid cultivation medium and cells. Mixing and aeration is achieved by generating intermittently one single large gas bubble (6) at the bottom of the column bioreactor, the single large bubble width... Agent: Bell, Boyd & Lloyd LLC 20070037280 - Method for generating primate trophoblasts: The first method to cause a culture of human and other primate stem cells to directly and uniformly differentiate into a committed cell lineage is disclosed. Treatment of primate stem cells with a single protein trophoblast induction factor causes the cells to transform into human trophoblast cells, the precursor cells... Agent: Quarles & Brady LLP 20070037281 - Method for differentiating stem cells in cells that produce a pancreatic hormone: Described is a process for generating cells producing pancreatic hormone by cultivating and differentiating stem cells obtained from differentiated exocrine glandular tissue of an organism. The use of the cells producing pancreatic hormone is also described.... Agent: Caesar, Rivise, Bernstein, Cohen & Pokotilow, Ltd. 20070037282 - Method of producing lens cell and lens cell obtained by the method: A method of producing a lens cell is disclosed. The method includes: an ES cell maintenance step of maintaining an ES cell by using a medium containing a fibroblast growth factor FGF-2 at a concentration of 2 ng/ml to 50 ng/ml; and a differentiation inducing step, carried out after the... Agent: Harness, Dickey & Pierce, P.L.C 20070037283 - Graft prosthesis devices containing renal capsule collagen: The invention provides tissue graft compositions comprising collagen-based extracellular matrices derived from renal capsules of warm-blooded vertebrates. The invention further provides a process of harvesting and purifying a renal capsule to provide an extracellular matrix material having beneficial use as a tissue graft and/or cell growth material.... Agent: Woodard, Emhardt, Moriarty, Mcnett & Henry LLP 20070037284 - Vectors for expressing exogenous gene or exogenous nucleic acid sequences: Provided are novel vectors and viral vectors capable of expressing exogenous gene or exogenous nucleic acid sequences in a target cell of interest, such as T cells, bone marrow cells, epithelial cells, liver cells and the like. The nucleic acid components of the vectors may include one or more native... Agent: Enzo Biochem, Inc. 02/08/2007 > 153 patent applications in 45 patent subcategories.20070031811 - Methods of inducing a t cell mediated immune response by administering antigen presenting b cells: We teach a strategy to obtain large quantities of desired APCs, activated B cells, which are superior in their capacity to present tumor protein antigen in a multiadministration protocol. Human B cells can be obtained from peripheral blood in large numbers. These cells can be activated in vitro by coculture... Agent: Ronald I. Eisenstein Nixon Peabody LLP 20070031812 - Processing of platelet-containing biological fluids: Platelet resuspension solutions, platelet storage solutions and systems for processing platelet-containing biological fluids are disclosed, wherein a platelet resuspension solution comprises an aqueous solution having a pH in the range of from about 4 to about 6: dextrose; and citrate; wherein the solution is substantially free of adenine, and wherein... Agent: Leydig Voit & Mayer, Ltd 20070031818 - Assay for distinguishing live and dead cells: Image analysis methods and apparatus are used for distinguishing live and dead cells. The methods may involve segmenting an image to identify the region(s) occupied by one or more cells and determining the presence of a particular live-dead indicator feature within the region(s). In certain embodiments, the indicator feature is... Agent: Beyer Weaver & Thomas, LLP 20070031813 - Method of examining cell: An object of the present invention is to provide a more accurate diagnostic method of a tissue or a cell for carrying out definite diagnosis of cancer, drug resistance test and prognosis. More accurate examination of cancer tissues or cancer cells is enabled by a method of the examination of... Agent: Sughrue Mion, PLLC 20070031817 - Methods for screening compounds for proarrhythmic risk and antiarrhythmic efficacy: Methods for screening compounds for their potential to induce or inhibit a cardiac arrhythmia are disclosed. The methods comprise determining the ratio of the time constant (τ) of ICa,L recovery in tissue expressing the L-type calcium channel or any subunit or combination thereof of the L-type calcium channel treated with... Agent: Woodcock Washburn LLP 20070031814 - Methods of modulating and identifying agents that modulate intracellular calcium: Methods are provided for identifying agents that modulate intracellular calcium. Also provided are methods of modulating calcium within cells and methods of identifying proteins involved in modulating intracellular calcium.... Agent: Fish & Richardson, PC 20070031819 - Microfluidic systems for biological and molecular analysis and methods thereof: Disclosed herein are systems, components, devices and methods for automated yeast pedigree analysis. Systems, components, devices and methods for analyzing microorganisms, cells, particles and molecules are also disclosed.... Agent: Woodcock Washburn LLP 20070031816 - Mounting device for mounting a retainer means for a biological object and corresponding method for laser micro-dissection: To enable contactless laser microdissection in a closed container (10, 11), for example in the form of a Petri dish, it is proposed according to the invention to use a holding device which comprises a receiving portion (4) for arrangement in the container (10, 11) and a holding portion (1)... Agent: Squire, Sanders & Dempsey L.l.p 20070031815 - Screening method for identifying hsp90 modulators: A screening method for identifying and/or analysing Hsp90 inhibitors and/or Hsp90 agonists comprises the steps of contacting a compound with at least two of yeast strains A-E wherein each yeast strain comprises expression vectors from which a pair of binding partners for a yeast two-hybrid assay are expressed. The binding... Agent: Davis Wright Tremaine LLP 20070031821 - Screening molecules with anti-prion activity: kits, methods and screened molecules: A kit and a method for identifying compounds having anti-prion activity are provided. The kit comprises a yeast of phenotype [PSI+]; an antibiogram; and a prion curing agent in a sub-effective dose, wherein the yeast has the adel-14 allele of the ADE1 gene and an inactivated ERG6 gene. Compounds and... Agent: Buchanan, Ingersoll & Rooney PC 20070031820 - Specific bacterial inclusions in bone marrow cells indicate systematic lupus erthematosus, and treatment for lupus: A method for diagnosing for the presence of systemic lupus erythematosus (SLE) in a patient is disclosed. In accordance with this method, megakaryocytes present in bone marrow of a person suspected of having SLE are assayed for the presence of internal bacterial structures that specifically stain with an intercalating dye.... Agent: Edward P. Gamson 20070031828 - Assay: A process for identification of type-specific polynucleotide sequences in a sample, the process comprising the steps of (1) contacting polynucleotides from the sample, or derived from the sample, with a plurality of type-specific probes in the context of a solid support, and detection of any type-specific hybridisation; and (2) contacting... Agent: Glaxosmithkline 20070031823 - Bioinformatically detectable group of novel vaccinia regulatory genes and uses thereof: The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “genomic record” or “GR” genes. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive viral... Agent: Rosetta-genomics 20070031826 - Diagnostic kit for determining the genotype of a human papilloma virus and method of using thereof: This invention relates to a kit and a method of use thereof to detect and determine the genotype of HPVs in a biological sample. The kit for detection and determination of the genotype of HPV, comprises PCR primers for HPV genes; HPV oligonucleotide chips having one or more probes immobilized... Agent: Thorpe North & Western, LLP. 20070031827 - Method and detector for identifying subtypes of human papilloma viruses: A detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detector comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype... Agent: Mathews, Shepherd, Mckay, & Bruneau, P.A. 20070031825 - Methods and compositions for detecting bk virus: The invention provides methods and compositions for rapid, sensitive, and highly specific nucleic acid-based (e.g., DNA based) detection of a BK virus in a sample. In general, the methods involve detecting a target nucleic acid having a target sequence of a conserved region of BK viral genomes. The invention also... Agent: Bozicevic, Field & Francis LLP 20070031822 - Ndr kinase modulators: Methods of identifying agents that modulate NDR kinases, including those that modulate NDR1 and NDR2 kinases and methods of using those agents to inhibit retroviral pathogenesis are among the methods described herein.... Agent: Fish & Richardson PC 20070031824 - Simultaneous quantification of nucleic acids in diseased cells: A process for assessing mitochondrial toxicity of a compound that includes contacting nucleic acids from a host with an amplification reaction mixture that contains at least two primers that provide detectable signals, wherein: a first primer provides a first detectable signal upon amplification of a host mitochondrial nucleic acid; a... Agent: Merchant & Gould PC 20070031842 - 379 human secreted proteins: The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating immune disorders and diseases. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors, host cells, and recombinant and synthetic... Agent: Human Genome Sciences Inc Intellectual Property Dept. 20070031872 - A141s and g399s mutation in the omi/htra2 protein in parkinson's disease: The present invention relates to a method for diagnosing Parkinson's disease in a human being; nucleic acid molecules used in this method; a nucleic acid molecule which encodes a human Omi/HtrA2 protein which has a genetic modification at amino acid position 141 and/or 399 compared with the wild type, and... Agent: Knobbe Martens Olson & Bear LLP 20070031883 - Analyzing cgh data to identify aberrations: Methods, systems and computer readable media for calling out genetic aberrations. Log ratio noise associated with log ratio signals read from respective probes on at least one array for signals representative of the same chromosomal locations in a test sample of nucleic acids and a reference sample of nucleic acids... Agent: Agilent Technologies Inc. 20070031887 - Aqueous-based pharmaceutical composition: An aqueous pharmaceutical composition which is capable of being sprayed into the nasal cavity of an individual and which comprises: (A) a pharmaceutically effective amount of solid particles of medicament which is effective in treating a bodily condition by virtue of its being present on the mucosal surfaces of the... Agent: Synnestvedt & Lechner LLP 20070031836 - Bacteria with increased levels of protein secretion, nucleotide sequences coding for a seca protein with increased levels of protein secretion, and methods for producing proteins: The invention relates to bacteria that have increased levels of protein secretion due to genetic modification, to nucleotide sequences and gene structures containing at least one gene coding for a SecA protein having increased levels of protein secretion, to a SecA having increased levels of protein secretion, and to a... Agent: Kamrin T Macknight Genencor International Inc 20070031856 - Biodisc microarray and its fabrication, use, and scanning: A biodisc comprises a CD-type optical disc with small feature oligonucleotide probes disposed on its surfaces. The biodisc's probes are either custom-fabricated in-situ with a master-duplicate tandem arrangement of discs that allows one disc and a reading/tracking head to control the probe locations being synthesized pass-by-pass on the duplicate. Or... Agent: Vierra Magen Marcus & Deniro LLP 20070031843 - Bioinformatically detectable group of novel regulatory bacterial and bacterial associated oligonucleotides and uses thereof: The present invention relates to a first group of novel bacterial and human associated oligonucleotides, here identified as “Genomic Address Messenger” or “GAM” oligonucleotide, and a second group of novel operon-like bacterial and human polynucleotides, here identified as “Genomic Record” or “GR” polynucleotide. GAM oligonucleotides selectively inhibit translation of known... Agent: Rosetta-genomics C/o Psws 20070031851 - Characterization of the yeast transcriptome: Yeast genes which are differentially expressed during the cell cycle are described. They can be used to study, affect, and monitor the cell cycle of a eukaryotic cell. They can be used to obtain human homologs involved in cell cycle regulation. They can be used to identify antifungal agents and... Agent: Banner & Witcoff 20070031880 - Chemical treatment of biological samples for nucleic acid extraction and kits therefor: A composition and method for the purification of nucleic acid are disclosed. The composition includes at least one alkaline agent and at least one detergent. The composition preferably also includes a suspension of paramagnetic particles and an acidic solution. The method involves the use of the composition with paramagnetic particles... Agent: David W Highet Vp And ChiefIPCounsel Becton Dickinson And Company 20070031857 - Compositions and methods for processing and amplification of dna, including using multiple enzymes in a single reaction: The present invention concerns preparation of DNA molecules, such as a library, using a stem-loop oligonucleotide. In particular embodiments, the invention employs a single reaction mixture and conditions. In particular, at least part of the inverted palindrome is removed during the preparation of the molecules to facilitate amplification of the... Agent: Fulbright & Jaworski L.L.P. Fulbright Tower 20070031845 - Compositions, methods and systems for inferring bovine breed: Provided herein are methods to discover and use single nucleotide polymorphisms (SNP) for identifying breed, or line and breed, or line composition of a bovine subject. The present invention further provides specific nucleic acid sequences, SNPs, and SNP patterns that can be used for identifying breed or breed combinations for... Agent: Dla Piper Rudnick Gray Cary Us, LLP 20070031886 - Detecting recessive diseases in inbred populations: Techniques of using statistical analysis of genetic data to determine likely markers for a recessive genetic disease or trait. One embodiment of these techniques includes the steps of obtaining actual genotype data for one or more affected people with the genetic disease or trait in a population, obtaining estimated genotype... Agent: Agilent Technologies Inc. 20070031866 - Detection of vancomycin-resistant enterococcus spp.: The invention provides methods to detect vancomycin-resistant enterococci in biological samples using real-time PCR. Primers and probes for the detection of vancomycin-resistant enterococci are provided by the invention. Articles of manufacture containing such primers and probes for detecting vancomycin-resistant enterococci are further provided by the invention.... Agent: Fish & Richardson P.C. 20070031835 - Diagnosis of advanced cancer: The present invention relates generally to a method of diagnosing, predicting or monitoring the development or progress of advanced cancer and, in particular, to a method of diagnosing, predicting or monitoring the development of or progress of advanced prostate cancer in a mammal. The present invention contemplates a method for... Agent: Scully Scott Murphy & Presser, PC 20070031844 - Functional and hyperfunctional sirna: Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rationale design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes.... Agent: Kalow & Springut LLP 20070031860 - G-protein coupled receptor and uses therefor: The present invention is based on the identification of a G-protein coupled receptor (GPCR) that is expressed predominantly in the brain and placenta and nucleic acid molecules that encoded the GPCR, which is referred to herein as the hCAR protein and hCAR gene respectively (for human Constitutively Active Receptor). Based... Agent: Kirkpatrick & Lockhart Nicholson Graham LLP/wyeth 20070031853 - Gene sequence variations with utility in determining the treatment of neurological or psychiatric disease: The present disclosure describes the use of genetic variance information for genes involved in neurologic and phychiatric diseases and in the selection of effective methods of treatment of such disease or condition. The variance information is indicative of the expected response of a patient to a method of treatment. Methods... Agent: Fish & Richardson PC 20070031837 - Genetic markers for skatole metabolism: Novel metabolites and enzymes involved in skatole metabolism are disclosed. The novel metabolites are 3-OH-3-methylindolenine (HMI); 3-methyloxindole (3MOI); indole-3-carbinol (I-3C); and 2-aminoacetophenone (2-AM). Measuring levels of these metabolites in a pig may be useful in identifying the pig's ability to metabolize skatole and its susceptibility to boar taint. The novel... Agent: Mckee, Voorhees & Sease, P.L.C 20070031846 - Genetic polymorphisms associated with rheumatoid arthritis, methods of detection and uses thereof: The present invention is based on the discovery of genetic polymorphisms that are associated with rheumatoid arthritis. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods... Agent: Celera Genomics Corp. Attn: Wayne Montgomery, Vice Pres, Intel Property 20070031848 - Genetic polymorphisms associated with rheumatoid arthritis, methods of detection and uses thereof: The present invention is based on the discovery of genetic polymorphisms that are associated with rheumatoid arthritis. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods... Agent: Celera Genomics Corp. Attn: Wayne Montgomery, Vice Pres, Intel Property 20070031847 - Genetic polymorphisms associated with stenosis, methods of detection and uses thereof: The present invention is based on the discovery of genetic polymorphisms that are associated with stenosis. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of... Agent: Celera Genomics Corp. Attn: Wayne Montgomery, Vice Pres, Intel Property 20070031888 - Human leucine-rich repeat containing protein expressed predominately in small intestine, hlrrsi1: The present invention provides novel polynucleotides encoding HLRRSI1 polypeptides, fragments and homologues thereof. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing said polypeptides. The invention further relates to diagnostic and therapeutic methods for applying these novel HLRRSI1 polypeptides to the diagnosis, treatment, and/or prevention... Agent: Louis J. Wille Bristol-myers Squibb Company 20070031839 - Identification of pharmaceutical targets: An equivalence relationship is created between a) the functional network of the genome and proteome and b) a neuronal network. Both networks represent highly cross-linked feedback systems. The equivalence relationship makes it possible to model the functional network of proteins of and genes by an equivalent artificial neuronal network. The... Agent: Staas & Halsey LLP 20070031881 - Immunoassays to detect diseases or disease susceptibility traits: Disclosed are immunoassay methods for the diagnosis/prognosis of diseases and disease susceptibility traits associated with gene mutations that cause protein truncation or allelic loss. The levels of one or more targeted wild-type proteins expressed by a subject gene or genes are immunologically quantitated in biological samples. Results indicating that a... Agent: Leona L. Lauder 20070031858 - Isolation of cpg islands by thermal segregation and enzymatic selection-amplification method: The present invention concerns isolation, library preparation and selective amplification from a compositionally heterogeneous pool of DNA fragments of a fraction of molecules, such as those originating from promoter CpG islands and characterized by a high GC content. In particular, the process utilizes a heat-induced segregation of DNA molecules into... Agent: Fulbright & Jaworski, LLP 20070031885 - Materials and methods for detection of nucleic acids: Assays using non-natural bases are described. In one embodiment, the method involves contacting a sample suspected of containing the target nucleic acid with a polymerase and first and second primers; amplifying the target nucleic acid, if present in the sample, by PCR using the first and second primers to generate... Agent: Eragen Biosciences, Inc. C/o Foley & Lardner LLP 20070031838 - Method: This invention relates to use of polymorphisms in human OATP-C in statin therapy because they are associated with an effect on statin pharmacokinetics (PK) in humans, especially rosuvastatin pharmacokinetics. The invention also relates to the use of OATP-C polymorphisms in predicting the efficacy and safety of statins, whose uptake in... Agent: Fish & Richardson P.C. 20070031833 - Method for examining obesity or leanness: In the examination of obesity or leanness, the examination is based on the expression level of the MCP-1 gene or the MCP-1 protein in a tissue or cell analyte, or on the polymorphism in the gene. In the evaluation of compounds, including screening for therapeutic agents for obesity or leanness,... Agent: Knobbe Martens Olson & Bear LLP 20070031859 - Method for producing a population of homozygous stem cells having a pre-selected immunotype and/or genotype, cells suitable for transplant derived therefrom, and materials and methods using same: A method of producing a homogenous population of homozygous stem (HS) cells pre-selected for immunotype and/or genotype from donor cells is described herein. The invention relates to methods of using immunohistocompatible HS cells for diagnosis, therapeutic and cosmetic transplantation, and the treatment of various genetic diseases, neurodegenerative diseases, traumatic injuries... Agent: Reed Smith LLP 20070031889 - Method for rapidly detecting quinolone-resistant salmonella ssp. and the probes and primers utilized therein: The present invention relates to a method for rapidly detecting quinolone-resistant Salmonella spp. The invention also relates to the oligonucleotide primers and probes utilized in the method, which can differentiate mutant strains having one or two single point mutations in gyrA gene or single point mutation in parC gene from... Agent: Bacon & Thomas, PLLC 20070031841 - Method for the detection of gene transcripts in blood and uses thereof: The present invention is directed to detection and measurement of gene transcripts and their equivalent nucleic acid products in blood. Specifically provided is analysis performed on a drop of blood for detecting, diagnosing and monitoring diseases using gene-specific and/or tissue-specific primers. The present invention also describes methods by which delineation... Agent: Palmer & Dodge, LLP Kathleen M. Williams 20070031868 - Method of detection of sp-a2 gene variants useful for prediction of predisposition to aspergillosis: Allele specific primers and probes suitable for detecting allelic variants of human SP-A2 gene for applications such as molecular diagnosis, prediction of an individual's susceptibility, and/or the genetic analysis of SP-A2 gene in a population.... Agent: Smith, Gambrell & Russell 20070031831 - Method of monitoring genomic instability using 3d microscopy and analysis: The present invention relates to a method of detecting and monitoring genomic instability in a cell using three-dimensional analysis to assess telomeric and/or chromosomal organization. In addition, the invention relates to a method and system for characterizing the 3D organization of telomeres and/or chromosomes. The system includes an input module... Agent: Kramer & Amado, P.C. 20070031878 - Methods and compositions for polypeptide engineering: Methods are provided for the evolution of proteins of industrial and pharmaceutical interest, including methods for effecting recombination and selection. Compositions produced by these methods are also disclosed.... Agent: Bingham, Mccutchen LLP 20070031882 - Methods and compositions for treating aids and hiv-related disorders using 1414, 1481,1553, 34021, 1720, 1683, 1552, 1682, 1675, 12825, 9952, 5816, 10002, 1611, 1371, 14324, 126, 270, 312, 167, 326, 18926, 6747, 1793, 1784 or 2045 molecules: The present invention relates to methods for the diagnosis and treatment of AIDS or an HIV-related disorder or disorders. Specifically, the present invention identifies the differential expression of 1414, 1481, 1553, 34021, 1720, 1683, 1552, 1682, 1675, 12825, 9952, 5816, 10002, 1611, 1371, 14324, 126, 270, 312, 167, 326, 18926,... Agent: Millennium Pharmaceuticals, Inc. 20070031863 - Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases: The present invention relates to compositions and methods for diagnosing, monitoring and/or treating an autoimmune or chronic inflammatory disease. In particular, the present invention provides methods for diagnosing, monitoring and treating an autoimmune disease (e.g., rheumatoid arthritis) or chronic inflammatory disease (e.g., systemic lupus erythematosus) based on detecting or altering... Agent: Medlen & Carroll, LLP 20070031870 - Methods and reagents for detecting target nucleic acids: The present invention provides methods and probe nucleic acids for detecting mutant forms of target nucleic acids that comprise repetitive nucleotide sequences. In certain embodiments, for example, these approaches and reagents can be used to detect instability in regions of genomic DNA that include microsatellite markers. The invention also provides... Agent: Quine Intellectual Property Law Group, P.C. 20070031861 - Methods for determining nucleotide sequence information: Provided herein, is a nucleic acid sequencing method based on detection of Raman signatures of oligonucleotide probes. Raman signatures of individually captured nucleic acid probes, optionally labeled by a Raman label or a positively charged enhancer, are detected. The sequences of captured probes are used to identify the nucleotide sequences... Agent: Raj S. Dave Morrison & Foerster LLP 20070031832 - Methods of constructing biodiverse gene fragment libraries and biological modulators isolated therefrom: Methods for producing nucleic acid fragment libraries that express highly diverse peptide domains, wherein the nucleic acid fragments are derived form microorganisms or eukaryotes with compact genomes. Also peptides derived form the libraries wherein the peptides are selected on the basis of their abilities to bind selected target proteins, including... Agent: Morrison & Foerster LLP 20070031871 - Methods of predicting responsiveness to chemotherapeutic agents and selecting treatments: Methods are provided for predicting responsiveness of cancer cells to chemotherapy by measuring the level of phosphorylated Stat or the level of expression of Survivin in a cancer and comparing the level in the cancer cell to the respective level in a control. Also provided are methods of selecting a... Agent: Michael Best & Friedrich, LLP 20070031876 - Methods of providing gene expression profiles for metastatic cancer phenotypes utilizing differentially expressed transcripts associated with circulating tumor cells: Methods of identifying the presence of differentially expressed transcripts associated with the presence of at least one circulating tumor cell in a biological sample of a cancer patient involves the use of suppression subtractive hybridization to identify differentially expressed transcripts present in biological samples of cancer patients not present in... Agent: Dunlap, Codding & Rogers P.C. 20070031874 - Modulating sos response induction by antimicrobial agents: Compositions and methods are provided for the use of SOS pathway targeted agents in antimicrobial formulations. The innate sensitivity of bacteria to antibiotics is increased by disrupting a mechanism that normally activates the bacterial SOS response or by inhibiting steps in the SOS response pathway itself. SOS response induction can... Agent: Bozicevic, Field & Francis LLP 20070031867 - Molecular/genetic aberrations in surgical margins of resected pancreatic cancer represents neoplastic disease that correlates with disease outcome: The present invention relates to the detection of field cancerization by detection of aberrations in tumor target genes at the margins of resected tumors, and the use of such information to predict survival in cancer patients. Methods for treatment of cancer based thereon also are provided.... Agent: Fulbright & Jaworski L.L.P. 20070031854 - Novel 10,10'-substituted-9,9'-biacridilidine luminescent molecules their preparation and uses: Novel symmetric, uniformly symmetric and asymmetric 10,10′-substituted-9,9′-biacridines and the synthesis of such symmetric, uniformly symmetric and asymmetric 10,10′-substituted-9,9′-biacridine molecules and their derivatives is disclosed. These molecules are shown to produce light by luminescence in the presence of signals. These symmetric, uniformly symmetric or asymmetric 10,10′-substituted-9,9′-biacridines are used alone or attached... Agent: George William Katsilometes, D.v.m., Ph.d. 20070031879 - Novel enterokinase cleavage sequences: Novel enterokinase cleavage sequences are provided. Also disclosed are methods for the rapid isolation of a protein of interest present in a fusion protein construct including a novel enterokinase cleavage sequence of the present invention and a ligand recognition sequence for capturing the fusion construct on a solid substrate. Preferred... Agent: Fish & Richardson PC 20070031865 - Novel process for construction of a dna library: The invention is directed to processes for constructing DNA Libraries in which ssDNA containing a chemical modification (CM) at or near the 5′- or 3′-terminus is prepared from a RNA or DNA source, a 1st universal oligonucleotide (Oligo A′) is ligated to the 3′-of the ssDNA, and a 2nd universal... Agent: RogersIPGroup 20070031852 - Nucleic acid and amino acid sequences relating to streptococcus pneumoniae for diagnostics and therapeutics: The invention provides isolated polypeptide and nucleic acid sequences derived from Streptococcus pneumoniae that are useful in diagnosis and therapy of pathological conditions; antibodies against the polypeptides; and methods for the production of the polypeptides. The invention also provides methods for the detection, prevention and treatment of pathological conditions resulting... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070031850 - Nucleic acid arrays for detecting multiple strains of a non-viral species: Nucleic acid arrays and methods of using the same for concurrent or discriminable detection of different strains of a non-viral species. In many embodiments, the nucleic acid arrays of the present invention include probes that are specific to different respective strains of a non-viral species. In many other embodiments, the... Agent: Nixon Peabody, LLP 20070031840 - Nucleic acids specifically binding bioactive ghrelin: The present invention is related to a nucleic acid specifically binding bioactive ghrelin, more preferably n-octanoyl ghrelin, and its use for the diagnosis of grelin mediated diseases and disorders.... Agent: Connolly Bove Lodge & Hutz, LLP 20070031829 - Oligonucleotides for genotyping thymidylate synthase gene: Oligonucleotides for genotyping the thymidylate synthase gene are provided. The number of tandem repeats in the promoter region of the thymidylate synthase gene can be identified based on the hybridization of an oligonucleotide of the invention to the genomic DNA of a subject. Therefore, the genotype of the thymidylate synthase... Agent: Fish & Richardson PC 20070031864 - Polyvalent cation-sensing receptor in atlantic salmon: The present invention encompasses four full length nucleic acid and amino acid sequences for PolyValent Cation-Sensing Receptors (PVCR) in Atlantic Salmon. These PVCR have been named SalmoKCaR#1, SalmoKCaR#2, SalmoKCaR#3, and SalmoKCaR#4. The present invention includes homologs thereof, antibodies thereto, and methods for assessing SalmoKCaR nucleic acid molecules and polypeptides. The... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070031873 - Predicting bone relapse of breast cancer: A method of providing predicting relapse of breast cancer in bone is conducted by analyzing the expression of a group of genes. Gene expression profiles in a variety of medium such as microarrays are included as are kits that contain them.... Agent: Philip S. Johnson Johnson & Johnson 20070031862 - Preparation of plastic supports for biochips: Plastic substrates, including poly(methyl methacrylate) (PMMA) and poly(ethylene terephthalate) (PET) slides, may be modified with methods described herein and subsequently used in the manufacture or formation of biochips, or other microarrays. Illustrative methods include modifying the surface of the plastic substrates by covalent attachment of unsaturated acid derivatives that include... Agent: Barnes & Thornburg LLP 20070031830 - Process for the determination of the primary structure of the messenger rna coding for the human recombinant endooligopeptidase a (heopa)(af217798)...: This invention refers to the recombinant human endooligopeptidase (hEOPA), polynucleotide which codes for the hEOPA, polynucleotide which allow the expression of the EOPA in prokaryotes and eukaryotes, including the human beings; use of the synthetic substrates for the determination of the proteolytic activity of the hEOPA, or of its chaperon... Agent: Birch Stewart Kolasch & Birch 20070031855 - Receptor for a bacillus thuringiensis toxin: The cDNA that encodes a glycoprotein receptor from the tobacco hornworm which binds a Bacillus thuringiensis toxin has been obtained and sequenced. The availability of this cDNA permits the retrieval of DNAs encoding homologous receptors in other insects and organisms as well as the design of assays for the cytotoxicity... Agent: Morrison & Foerster LLP 20070031875 - Signal pattern compositions and methods: The invention relates to compositions and methods for a temporal signal pattern or signature representative of a characteristic of a nucleic acid template. The signature is created by monitoring the real time sequential pattern of signal emissions generated during nucleic acid template-dependent polymerization reactions.... Agent: Sullivan & Worcester LLP 20070031877 - Support for analyte determination methods and method for producing the support: A method for producing a support for determining analytes. The method comprises the steps of (a) providing a support comprising at least one channel, comprising a conduit having an intake and an outlet for passing fluid from the intake to the outlet, in the support body, (b) passing liquid with... Agent: Rothwell, Figg, Ernst & Manbeck, P.C. 20070031869 - Template specific inhibition of pcr: Template specific inhibition during PCR (TSI-PCR) allows specific inhibition of particular templates without disrupting the amplification of other templates that share amplification primer binding sites. TSI-PCR is achieved by ligation of stop oligos comprising a 3′ modification that prevents extension by DNA polymerases. Stop oligos hybridize to a region of... Agent: Bozicevic, Field & Francis LLP 20070031834 - Test methods for determining the intracellular concentration of cyclic nucleotides: The invention relates to methods for the quantitative optical analysis of the intracellular concentration of the cyclic nucleotides cGMP and cAMP, said methods using cell lines which express a combination of certain CNG channels, a calcium-sensitive photoprotein, and different target proteins for which modulators are to be found, in a... Agent: Jeffrey M. Greenman 20070031849 - Three-dimensional structure of dna recombination/repair protein and use thereof: A crystal of DNA recombination/repair protein, Rad52 protein is prepared and the three-dimensional structure thereof is determined by X-ray crystallography with the use of the same. The obtained three-dimensional structure of Rad52 protein can be used for screening a variety of mutant enzymes or compounds which binds to the enzyme... Agent: Birch Stewart Kolasch & Birch 20070031884 - Universal readout for target identification using biological microarrays: A method and apparatus for implementing the method is provided. The method involves performing an indirect competitive binding assay on a microarray to identify biological or chemical targets and screen for compounds of interest. The microarray comprises a common ligand located among membrane-, lipid- or protein-associated active binding sites. The... Agent: Corning Incorporated 20070031893 - Method for measuring reaction rate coefficient in analysis utilizing total reflection attenuation: An object of the present invention is to provide a method for measuring a reaction rate coefficient in an analysis utilizing total reflection attenuation, which is capable of calculating the reaction rate coefficient speedily and accurately. The present invention provides a method for measuring adsorption rate coefficient (Ka) and diffusion... Agent: Sughrue Mion, PLLC 20070031891 - Method of analyzing ligand in sample and apparatus for analyzing ligand in sample: A sample analyzing method capable of high-precision analysis without being affected by vibration and optical design is provided. In the sample analyzing method, a sample containing a ligand is caused to bind to a receptor that can bind specifically to the ligand, and a change caused by binding of the... Agent: Hamre, Schumann, Mueller & Larson P.C. 20070031890 - Methods and compositions for diagnosing and monitoring transplant rejection: Methods of diagnosing or monitoring transplant rejection, particularly cardiac transplant rejection, in a patient by detecting the expression level of one or more genes in a patient, are described. Diagnostic oligonucleotides for diagnosing or monitoring transplant rejection, particularly cardiac transplant rejection and kits or systems containing the same are also... Agent: Michael R. Ward Morrison & Foerster LLP 20070031892 - Novel coumarin-based amino acids for use in enzyme activity and substrate specificity assays: The design, synthesis, and utilization of a novel coumarin-based amino acid and its fluorinated derivatives for use in enzyme activity and substrate specificity assays are described. The synthesis is both facile and high-yielding and allows for the production of a highly fluorescent phosphorylated amino acid that can be incorporated into... Agent: Hogan & Hartson L.L.P. 20070031896 - Anti-ccr4 antibodies and methods of use therefor: The present invention relates to an antibody or functional fragment thereof which binds to a mammalian (e.g., human) CC-chemokine receptor 4 (CCR4) or a portion of the receptor and blocks binding of a ligand to the receptor. The invention further relates to a method of inhibiting the interaction of a... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070031895 - Glans compatible single unit semen collection and storage device, kit and related methods of use: A method and device to conform with the glans penis to recover ejaculated semen completely, to prevent the loss of initial sperm rich epididymal fractions, to avoid the use of a condom for masturbation, to eliminate the multi-step transfers of semen following ejaculation that are common with current methods, and... Agent: University Of Virginia Patent Foundation 20070031897 - Methods and compositions for treating and diagnosing diabetes and related diseases involving beta-trp: Expression of beta-TRP is enriched in islet cells. Introduction of expression cassettes encoding beta-TRP into diabetic islet cells improved glucose-stimulated insulin production. Therefore, the invention provides methods of identifying beta-TRP modulators for treating diabetic individuals and introducing beta-TRP into islet cells... Agent: Townsend And Townsend And Crew, LLP 20070031894 - Novel nerve stem cell marker: It is an object of the present invention to provide a method for detecting nerve stem cells/progenitor cells among a tissue or a mass of cells as constituted of a plurality of cell species, and a method for screening for a drug functioning as a nerve differentiation factor or the... Agent: Sughrue Mion, PLLC 20070031898 - Kit for determining polysaccharide-binding ability of mononuclear cells present in peripheral blood: A kit for the determination of the ability of a peripheral blood mononuclear cell to bind to a polysaccharide herein provided comprises a detection reagent comprising a fluorescence-labeled immunostimulant polysaccharide; and a reference reagent comprising a fluorescence-labeled material of a polysaccharide different from that used in the fluorescence-labeled immunostimulant polysaccharide,... Agent: C. Irvin Mcclelland Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070031901 - Compositions and methods for the diagnosis and treatment of tumor: The present invention is directed to compositions of matter useful for the diagnosis and treatment of tumor in mammals and to methods of using those compositions of matter for the same.... Agent: Genentech, Inc. 20070031900 - Diagnosing and grading gliomas using a proteomics approach: The present invention provides for a proteomic approach to grading gliomas, and for predicting patient survival. In addition to employing global protein expression patterns, such as by mass spectrometry, particular target proteins whose expression is altered in various gliomas can be used to predict the stage/classificiation of a glioma, as... Agent: Fulbright & Jaworski L.L.P. 20070031899 - Drug: An objective of the present invention is to provide methods of screening for novel compounds that exhibit anticancer activity. The screening methods of the present invention comprise using serine/threonine kinase Pim-1, or partial peptides or salts thereof.... Agent: Fish & Richardson P.C. 20070031903 - Mammalian iap gene family, primers, probes and detection methods: Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; and methods of using such DNA to express the IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed are conserved regions characteristic of the IAP family and primer and probes for the identification and isolation of additional IAP genes.... Agent: Philip Swain, Phd C/o Gowling Lafleur Henderson 20070031904 - Mammalian iap gene family, primers, probes and detection methods: Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; and methods of using such DNA to express the IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed are conserved regions characteristic of the IAP family and primer and probes for the identification and isolation of additional IAP genes.... Agent: Philip Swain, Phd C/o Gowling Lafleur Henderson 20070031902 - Predictive methods for cancer chemotherapy: This invention provides methods and reagents for determining or predicting response to cancer therapy, as well as dual therapy treatments.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070031905 - Soluble fas urinary marker for the detection of bladder transitional cell carcinoma: The present invention is an apparatus, system and method for detecting bladder cancer are provided that includes a substrate including one or more sFas binding agents and one or more reagents that indicate the amount of sFas present in the sample.... Agent: Chalker Flores, LLP 20070031906 - Test system for detecting salmonella: Disclosed is a diagnostic test system for detecting Salmonella infections in a sample using monoclonal antibodies specific for SipC-protein.... Agent: Joyce Von Natzmer Hall, Vande Sande & Pequigot, LLP 20070031907 - Anaplastic lymphoma kinase assay, reagents and compositions thereof: Disclosed are methods for detecting ALK tyrosine kinase activity and for the identification of compounds that modulate ALK activity, peptide substrates, reagents and compositions thereof.... Agent: Young & Thompson 20070031908 - Method for detecting a progressive, chronic dementia disease, and corresponding peptides and detection reagents: The invention relates to a method for detecting progressive, chronic dementia diseases or a predisposition to such diseases or method for the prognosis of such diseases. For this purpose, the concentration of particular peptides in body fluids or other samples from the patient is measured in a method which can... Agent: Whitham, Curtis & Christofferson & Cook, P.C. 20070031909 - Modulation of protein methylation and phosphoprotein phosphate: The invention relates to methylated proteins that control protein phosphorylation, particularly phosphoesterases, such as PP2A. It relates to screening methods for determining agents that affect methylation of these proteins and thus also modulate the level of phosphorylation of phosphoproteins. It relates as well to the agents and to compositions comprising... Agent: Patent Docket Administrator Lowenstein Sandler PC 20070031913 - Amino-acid biosensor, fischer-ratio biosensor and health information management system: Disclosed is a biosensor capable of measuring a total concentration of plural types of amino acids. An amino-acid biosensor (200) for measuring a total concentration of a plurality of specific amino acids, comprises a measuring electrode (202) which includes as components a mediator and an enzyme which selectively act on... Agent: Foley And Lardner LLP Suite 500 20070031911 - Isotopically-labeled proteome standards: The invention provides methods for quantifying biomolecules, such as polypeptides in mass spectrometric analysis. The methods include use of a biomolecule standard having at least one atomic isotope different than that of the naturally occurring isotopes in the biomolecule of interest. Methods of the present invention also include methods for... Agent: Invitrogen C/o Intellevates Castellano Malm Ferrario & Buck PLLC 20070031912 - Method for analysis of protein interaction using fluorescent protein: An object of the present invention is to provide a method for analyzing the protein interaction, wherein the information about time can be obtained and the movement of protein can be monitored. The present invention provides a method for analyzing interaction between a first test protein and a second test... Agent: Greenblum & Bernstein, P.L.C 20070031910 - Method of stabilizing sample: A method for stabilizing a hemolyzed sample that does not affect an accuracy of determination in a measurement even after the sample is left standing at room temperature, and a hemolysis reagent solution used therefor are provided. Using a hemolysis reagent solution in which a surfactant is contained and carbon... Agent: Hamre, Schumann, Mueller & Larson, P.C. 20070031914 - Devices for analyte assays and methods of use: The present invention provides devices for detecting the presence of an analyte in a liquid sample. The parts of the device include a sample collector for collecting and applying a liquid sample, a test matrix with reagents for detecting the analyte, a sample application port for receiving the liquid sample,... Agent: Azure Institute Intellectual Property Dept. 20070031915 - Blood and urine test: The present invention provides a test medium comprising a test microorganism, an indicator and a metal in ionized form, wherein the valence of said metal is at least 2 and the concentration of said metal is between 0.001 M and 1 M. Furthermore, there is provided a method for the... Agent: Nixon & Vanderhye, PC 20070031916 - Apparatus and method for automated monitoring of airborne bacterial spores: An apparatus and method for automated monitoring of airborne bacterial spores. The apparatus is provided with an air sampler, a surface for capturing airborne spores, a thermal lysis unit to release DPA from bacterial spores, a source of lanthanide ions, and a spectrometer for excitation and detection of the characteristic... Agent: Alessandro Steinfl, Esq. C/o Ladas & Parry 20070031917 - System for staining fungi and protozoa: The present invention provides a method for the staining of fungi and microsporidia for observation with a light microscope based upon the presence of chitin in the composition of these organisms. With the method of the present invention a sample to be analyzed is treated with a solution of Ponceau... Agent: Smith Hopen, Pa 20070031919 - Treatment of biomass to obtain a target chemical: Target chemicals were produced using biocatalysts that are able to ferment sugars derived from treated biomass. Sugars were obtained by pretreating biomass under conditions of high solids and low ammonia concentration, followed by saccharification.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070031918 - Treatment of biomass to obtain fermentable sugars: Biomass is pretreated using a low concentration of aqueous ammonia at high biomass concentration. Pretreated biomass is further hydrolyzed with a saccharification enzyme consortium. Fermentable sugars released by saccharification may be utilized for the production of target chemicals by fermentation.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070031922 - Altered polypeptides with increased half-life: Polypeptides that are cleared from the kidney and do not contain in their original form a Fc region of an IgG are altered so as to comprise a salvage receptor binding epitope of an Fc region of an IgG and thereby have increased circulatory half-life.... Agent: Merchant & Gould PC 20070031927 - Biological system and assay for identifying inhibitors of tubulin glutamylases: Tetrahymena is used as a host cell in a biological assay for identification of inhibitors of tubulin glutamylases.... Agent: Mueting, Raasch & Gebhardt, P.A. 20070031924 - Biomolecule partition motifs and uses thereof: The invention provides amino acid sequence motifs (e.g., biomolecule partition motifs) that can direct targeting of intracellular polypeptides to and through membranes, including cell surface membranes.... Agent: Edwards Angell Palmer & Dodge LLP 20070031931 - Biosynthetic binding proteins for immuno-targeting: Disclosed is a formulation for targeting an epitope on an antigen expressed in a mammal. The formulation comprises a pharmaceutically acceptable carrier together with a dimeric biosynthetic construct for binding at least one preselected antigen. The biosynthetic construct contains two polypeptide chains, each of which define single-chain Fv (sFv) binding... Agent: Novartis Vaccines And Diagnostics Inc. 20070031932 - Cultures of e1-immortalized cells and processes for culturing the same to increase product yields therefrom: The invention provides processes for culturing cells derived from embryonic retinoblast cells immortalized by adenovirus E1 sequences, preferably PER.C6® cells, to improve product yields from such cells. Feed strategies for such cells and cultures with very high cell densities are provided, resulting in high yields of products, such as recombinant... Agent: Trask Britt 20070031928 - Glucoamylase variants: The invention relates to a variant of a parent fungal glucoamylase, which exhibits improved thermal stability and/or increased specific activity using saccharide substrates.... Agent: Novozymes North America, Inc. 20070031920 - High expression locus vector based on ferritin heavy chain gene locus: High expression locus vectors based, in part, on the ferritin heavy chain locus are disclosed. The vectors include distal 5′ flanking sequences and/or proximal 5′ regulatory sequences derived from ferritin heavy chain locus. The vectors include a site for insertion of heterologous sequences and proximal 3′ regulatory and distal 3+... Agent: Sterne, Kessler, Goldstein & Fox, P.l.l.c. 20070031923 - Modified viral particles with immunogenic properties and reduced lipid content useful for treating and preventing infectious diseases: Described is a composition and method for reducing the occurrence and severity of infectious diseases, especially infectious diseases in which lipid-containing infectious viral organisms are found in biological fluids, such as blood. The present invention employs solvents useful for extracting lipids from the lipid-containing infectious viral organism thereby creating immunogenic... Agent: John S. Pratt, Esq Kilpatrick Stockton, LLP 20070031933 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070031934 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070031935 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070031936 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070031929 - Polypeptides homologous to vegf and bmp1: The present invention involves the identification and preparation of vascular endothelial growth factor-E (VEGF-E). VEGF-E is a novel polypeptide related to vascular endothelial growth factor (VEGF) and bone morphogenetic protein 1. VEGF-E has homology to VEGF including conservation of the amino acids required for activity of VEGF. VEGF-E can be... Agent: Genentech, Inc. 20070031921 - Potent combinations of mrna transport elements: This invention provides expression vectors that comprise a combination of RNA transport elements that improve expression.... Agent: Townsend And Townsend And Crew, LLP 20070031930 - Process for protein extraction: The invention includes a process for extracting a target protein from E. coli cells that includes lowering the pH of a whole E. coli cell solution to form an acidic solution, disrupting the cells to release the protein into the acidic solution, and separating the cellular debris from the released... Agent: Merchant & Gould PC 20070031926 - Refolded membrane protein in monodisperse form: The present invention relates to a method for preparing a solution of a refolded, recombinantly expressed or chemically synthesized eukaryotic membrane protein in monodisperse form, to methods for preparing a crystalline form of a recombinantly expressed or chemically synthesized membrane protein, to a crystalline form of a recombinantly expressed, or... Agent: Knobbe Martens Olson & Bear LLP 20070031925 - Small molecular weight tnf receptor multimeric molecule: The present invention relates to a receptor molecule which binds to TNF comprising all or a functional portion of the extracellular domain (ECD) of two or more TNF-Rs linked via one or more polypeptide linkers. The receptor can further comprise a signal peptide of a secreted protein, such as the... Agent: Cooper & Dunham LLP 20070031937 - Co-expression of recombinant proteins: Expression vectors are described which permit the recombinant expression of proteins which essentially contain, in addition to nucleic acid encoding the recombinant protein, nucleic acid encoding a non-proteolytic analog of Haemophilus Hin47 protein, with or without leader sequence, or nucleic acid encoding high molecular weight proteins of non-typeable Haemophilus, which... Agent: Robert Yoshida Sanofi Pasteur Inc. 20070031938 - Organic anion transporting (oat)-like protein ust3-like1 and uses thereof: The present invention is directed to a polynucleotide sequence of a novel organic anion transporting (OAT)-like protein UST3-like1. More particularly, the present invention provides a polynucleotide sequence comprising the nucleic acid sequence SEQ ID NO: 1 or nucleic acid sequences that hybridize to SEQ ID NO: 1 or its complimentary... Agent: Banner & Witcoff 20070031939 - Method for the production of overproducing staphylococcus aureus strains: e 20070031941 - Methods and compositions for expressing negative-sense viral rna in canine cells: The present invention provides novel canine pol I regulatory nucleic acid sequences useful for the expression of nucleic acid sequences in canine cells such as MDCK cells. The invention further provides expression vectors and cells comprising such nucleic acids as well as methods of using such nucleic acids to make... Agent: Johnathan Klein-evans 20070031940 - Methods for inducing differentiation of undifferentiated mammalian cells into osteoblasts: The present invention relates to in vivo and in vitro methods, agents and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts, including bone formation enhancing pharmaceutical compositions, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean bone... Agent: Synnestvedt & Lechner, LLP 20070031942 - Making nucleic acid sequences in parallel and use: The present invention relates generally to the fields of genomics, synthetic biology and genetic engineering. More particularly, the present invention concerns the methods that enable parallel multiplex ligation and amplification on surface for making assemblies of nucleic acids of various biological applications and for analysis of biological samples such as... Agent: Patrick J. Halloran 20070031944 - Rna complexes, methods of their production: The invention includes RNA complexes comprising at least three monomeric units of an RNA molecule, each monomeric unit comprising an RNA polymer having first and second helical domains that have respective first and second binding sites, wherein the first binding sites are adapted to binding to one another and are... Agent: Roger A. Gilcrest 20070031943 - System for manipulating nucleic acids: The present invention provides an improved system for linking nucleic acids to one another. In particular, the present invention provides techniques for producing DNA product molecules that may be easily and directly ligated to recipient molecules. The product molecules need not be cleaved with restriction enzymes in order to undergo... Agent: Choate, Hall & Stewart LLP 20070031945 - High mannose proteins and methods of making high mannose proteins: The invention features a method of producing a high mannose glucocerebrosidase (hmGCB) which includes: providing a cell which is capable of expressing glucocerebrosidase (GCB), and allowing production of GCB having a precursor oligosaccharide under conditions which prevent the removal of at least one mannose residue distal to the pentasaccharide core... Agent: Fish & Richardson PC 20070031946 - Arginine repressor deficient strain of coryneform bacterium and method for producing l-arginine: L-Arginine is produced by culturing a coryneform bacterium in which an arginine repressor involved in L-arginine biosynthesis is deleted by disrupting a gene coding for the repressor, and which has L-arginine producing ability in a medium to produce and accumulate L-arginine in the medium, and collecting the L-arginine from the... Agent: C. Irvin Mcclelland Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070031947 - Transgenic amorpha-4, 11-diene synthesis: The present invention relates to an isolated DNA sequence encoding a polypeptide having the biological activity of amorpha-4,11-diene synthase. This DNA sequence can be used for the transformation of bacteria, yeasts and plants for the production of amorpha-4,11-diene, a specific precursor in the synthesis of artemisinin, in the respective organisms.... Agent: The Webb Law Firm, P.C. 20070031948 - Novel plasmids and utilization thereof: A shuttle vector is constructed by preparing a DNA region replicable in bacteria belonging to the genus Rhodococcus from a Rhodococcus-derived plasmid having the nucleotide sequence set forth as SEQ ID NO: 73 and a plasmid or its DNA fragment having the nucleotide sequence set forth as SEQ ID NO:... Agent: Osha Liang L.L.P. 20070031949 - Process for the preparation of amides: A novel biotechnological process for the preparation of nitriles, starting from amides, is described. Micro-organisms of the genus Amycolatopsis, Actinomadura or Rhodococcus are employed for this process.... Agent: Baker & Botts L.L.P. 20070031950 - Production of d-lactic acid with yeast: A yeast strain, wherein the yeast strain is transformed with at least one copy of a gene coding for D-lactate dehydrogenase functionally linked to a promoter sequence allowing the expression of the gene in the yeast strain and the yeast strain has undergone disruption of one or more pyruvate decarboxylase... Agent: Williams, Morgan & Amerson 20070031951 - Method for the production of resveratrol in a recombinant bacterial host cell: A method to produce resveratrol in a recombinant bacterial host cell is provided. Expression of a resveratrol synthase gene in combination with genes involved in the phenylpropanoid pathway enabled recombinant microbial production of resveratrol.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070031952 - Alcohol product processes: The present invention relates to processes for production of an alcohol product from granular starch comprising a pre-treatment at an elevated temperature below the initial gelatinization temperature of said granular starch followed by simultaneous saccharification and fermentation.... Agent: Novozymes North America, Inc. 20070031954 - Ethanol recovery process: A process for producing and recovering light alcohols, particularly ethanol, alcohol mixtures containing ethanol, and ABE mixtures (alcohol mixtures containing acetone, butanol and ethanol), using a combination of steps including fermentation, first membrane separation, dephlegmation and dehydration by second membrane separation.... Agent: Membrane Technology And Research Inc. 20070031953 - Treatment of biomass to obtain ethanol: Ethanol was produced using biocatalysts that are able to ferment sugars derived from treated biomass. Sugars were obtained by pretreating biomass under conditions of high solids and low ammonia concentration, followed by saccharification.... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070031955 - Compositions and methods for refolding of denatured proteins: Compounds and methods for refolding of proteins in an aqueous solution. In particular, biocompatible multiblock copolymer surfactants such as poloxamers, meroxapols, poloxamines, or polyols are used to catalyze proper refolding without changing the protein composition, and restore the protein to its native conformation and native biological function. The methods can... Agent: Brinks Hofer Gilson & Lione 20070031956 - Crystal structure of human pim-1 kinase protein complexes and binding pockets thereof, and uses thereof in drug design: The present invention relates to the X-ray analysis of crystalline molecules or molecular complexes of human Pim-1. The present invention also relates to Pim-1-like binding pockets. The present invention provides a computer comprising a data storage medium encoded with the structure coordinates of such binding pockets. This invention also relates... Agent: Fish & NeaveIPGroup Ropes & Gray LLP 20070031957 - Extraction and purification of phosphodiesterase: A process for purifying a phosphodiesterase 1 (PDE-1) from a cell including heating an extract of a cell formed from a solution including at least on divalent cation, to increase the specific activity of PDE-1 in the extract.... Agent: Christensen, O'connor, Johnson, Kindness, PLLC 20070031958 - Bacterial effects on metal accumulation by plants: The invention includes methods for (1) extracting metals from soil by the use of plants that extract and accumulate the metal and adding bacteria to the soil that enhances the ability of the plants to extract the metal, and (2) preparing soil for extraction of a metal by plants by... Agent: Squire, Sanders & Dempsey L.L.P. 20070031959 - High voltage nanosecond pulse generator using fast recovery diodes for cell electro-manipulation: A pulse generator circuit may include a diode configured to operate as an opening switch, a tank circuit in series with the diode having an admittance that is switchable from a first value to a second value that is different from the first value, and a switching system configured to... Agent: Mcdermott Will & Emery LLP 20070031961 - Biosensors and methods for their use: The invention disclosed herein provides biosensors and methods which increase the sensitivity of assays of optically labelled molecules fluorescently tagged polypeptides and polynucleotides while decreasing the sample volume required for detection. By integrating reflective sidewalls into the receptacles used in such assays, the signal-to-noise ratio of the optical signal is... Agent: Gates & Cooper LLP Attn: William J. Wood 20070031960 - Optical cuvette with platform-and-well construction: Formats for optical analysis of fluid samples are provided with platforms and wells for contacting fluid samples and bringing reagents in contact with fluid samples. Formats may be made in opposing platform-and-well constructions, allowing a platform protruding from one format member to enter a well contained within an opposing format... Agent: Bayer Healthcare, LLC 20070031962 - Methods and apparatuses for conducting assays in animals: The invention provides apparatuses, systems, and methods for conducting assays in aquatic animals. The apparatuses, systems, and methods of the invention can be used to identify and/or characterize compounds that modulate morphological, anatomical, or behavioral characteristics. The apparatuses, systems, and methods of the invention can be used to identify and/or... Agent: Fish & NeaveIPGroup Ropes & Gray LLP 20070031963 - Cell culture flasks, systems, and methods for automated processing: Cell culture flasks that are readily conducive to various automated processing applications, including introducing and removing fluid from the flasks are provided. Automated cell culture flask processing systems, system components, and related methods are also provided.... Agent: Knobbe Martens Olson & Bear LLP 20070031965 - Anti-pathogen treatments: Chimeric molecules that contain at least one pathogen-detection domain and at least one effector domain, and their methods of use in preventing or treating a pathogen infection in a cell or organism are described. The pathogen-detection domain and effector domain of the chimeric molecules are domains not typically found in... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070031964 - Myeloma cell culture in transferrin-free low iron medium: The present invention relates to a method for culturing mammalian cells in a culture medium which is transferrin free and which contains no lipophilic or synthetic nitrogen-containing chelators. Also provided is the use of the medium and a process for providing a mammalian product by culturing cells capable of producing... Agent: Nixon & Vanderhye, PC 20070031966 - Renal progenitor cells from embryonic stem cells: The present invention relates to compositions and methods for inducing the differentiation of stem cells into renal progenitor cells. In particular, the present invention provides compositions containing activin-a, retinoic acid, and bmp-7, and variants thereof, for differentiating stem cells into renal cells containing tubular epithelia. In certain embodiments, the present... Agent: Medlen & Carroll, LLP 20070031967 - Hyperactive, non-phosphorylated, mutant transposases of mariner mobile genetic elements: The invention relates to hyperactive, non-phosphorylated, mutant transposases of mariner mobile genetic elements. The invention also relates to recombinant nucleotide sequences encoding such transposases. The invention further relates to a method of producing said transposases and to the use thereof for in vitro or in vivo transposition.... Agent: Buchanan, Ingersoll & Rooney PC 20070031968 - Beer yeast cell bodies containing high ribonucleic acid content and their production method: By using a medium containing an ingredient for activating brewer's yeast, a brewer's yeast cell body is immersed in the medium in the presence of an added inorganic salt; and the immersion is stirred at a predetermined temperature to concurrently carry out an aerobic activation treatment, resulting in the formation... Agent: C. Irvin Mcclelland Oblon, Spivak, Mcclelland, Maier & Neustadt, P.C. 20070031969 - Bacteria with reduced genome: The present invention provides a bacterium having a genome that is genetically engineered to be at least 2 to 14% smaller than the genome of its native parent strain. A bacterium with a smaller genome can produce a commercial product more efficiently. The present invention also provides methods for deleting... Agent: Fulbright & Jaworski L.L.P. 02/01/2007 > 145 patent applications in 38 patent subcategories.20070026376 - Composition and method for the restoration and preservation of transplant organs procured from dcd donors: The present invention provides a perfusion solution comprising specific metabolic agents, antioxidant agents, and membrane stabilizer agents that can help improve preservation, organ viability, and in some cases recover organs that would otherwise being unusable for transplantation. In a further embodiment, the perfusion solution can be used in combination with... Agent: Alston & Bird LLP 20070026379 - Collection systems for cytometer sorting of sperm: Improved flow cytometer system particularly adapted to use for sex-selected sperm sorting include enhanced sheath fluid and other strategies which minimize stress on the sperm cells, including a 2.9 percent sodium citrate sheath solution for bovine species and a hepes bovine gamete media for equine species. Improved collection systems and... Agent: Santangelo Law Offices, P.C. 20070026378 - Methods and apparatus for reducing protein content in sperm cell extenders: The inventive technology relates to methods and apparatus for reducing protein content in sperm cell extenders and may include one or more of the following features: techniques for reducing protein content in a sperm cell extender; techniques for reducing protein content in a cryoprotectant-containing B fraction of a sperm cell... Agent: Santangelo Law Offices, P.C. 20070026377 - Methods for preserving nucleated mammalian cells: Methods and compositions are provided for increasing the survival of nucleated mammalian cells following drying and rehydration. The methods include introducing a disaccharide such as trehalose into said cells, optionally including heat shock proteins, apoptosis inhibitors, and arbutin, drying said cells, and rehydrating them. The invention further provides nucleated mammalian... Agent: Townsend And Townsend And Crew, LLP 20070026382 - Cytometer on a chip: An assay technique for label-free, highly parallel, qualitative and quantitative detection of specific cell populations in a sample and for assessing cell functional status, cell-cell interactions and cellular responses to drugs, environmental toxins, bacteria, viruses and other factors that may affect cell function. The technique includes a) creating a first... Agent: Alix Yale & Ristas LLP 20070026384 - Detection of transmembrane potentials by optical methods: Methods and compositions are provided for determining the potential of a membrane. In one aspect, the method comprises: (a) introducing a first reagent comprising a hydrophobic fluorescent ion capable of redistributing from a first face of the membrane to a second face of the membrane in response to changes in... Agent: Townsend And Townsend And Crew, LLP 20070026381 - Devices and methods for enrichment and alteration of cells and other particles: The invention features devices and methods for the deterministic separation of particles. Exemplary methods include the enrichment of a sample in a desired particle or the alteration of a desired particle in the device. The devices and methods are advantageously employed to enrich for rare cells, e.g., fetal cells, present... Agent: Clark & Elbing LLP 20070026385 - Marker for antidepressant therapy and methods related thereto: The present invention relates generally to methods for determining the effectiveness of ongoing antidepressant therapy via analysis of the association of Gsα with components of the plasma membrane or cytoskeleton of cells from peripheral tissues of the depressed individual as well as to methods involved in screening for effective antidepressant... Agent: Marshall, Gerstein & Borun LLP 20070026383 - Methods and compositions for extracting membrane proteins: The present invention provides methods and compositions for the isolation and use of membrane proteins and other membrane associated molecules (e.g., peptides, carbohydrates, lipids, or combinations thereof). In particular, the present invention provides amphiphilic polymer compositions and methods of using the compositions to solubilize, enrich and isolate components of biological... Agent: Medlen & Carroll, LLP 20070026380 - System for water removal and solvent evaporation: An apparatus and method for separating residual water from a solvent and removing a solvent. The apparatus may be sealed and automated. The method comprises providing a solution comprising solvent and residual water and an analyte. The solution may be passed through a membrane to reduce water content wherein an... Agent: Grossman, Tucker, Perreault & Pfleger, PLLC 20070026388 - Analyte detection using carbon nanotubes: A method for detecting analytes involves measuring the fluorescence of a sample of fluorescence-attenuated carbon nanotubes, then exposing the sample to a target analyte, and then measuring the fluorescence again. The fluorescence-attenuated nanotubes include a chemical having quenching portion that interacts with the nanotubes and attenuates the fluorescence, a receptor... Agent: Los Alamos National Security, LLC 20070026390 - Development of diagnostic kit against the recombinant coat protein of prunus necrotic ringspot virus: The present invention deals with a set of primers of sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful for detection of Prunus necrotic ringspot virus in plants. It also relates to a method for detection of Prunus necrotic ringspot virus in plants by using... Agent: Merchant & Gould PC 20070026387 - Diagnosing and monitoring inflammatory diseases by measuring complement components on white blood cells: The invention is related to methods of diagnosing inflammatory diseases or conditions by determining levels of components of the complement pathway on the surface of white blood cells.... Agent: Townsend And Townsend And Crew, LLP 20070026392 - Disease model incorporation into an artificial immune system (ais): The present invention relates to methods for preparing an artificial immune system. The artificial immune system comprises a cell culture comprising a three-dimensional matrix comprising lymphoid tissue, a three-dimensional matrix comprising epithelial and/or endothelial cells, and diseased cells. The artificial immune system of the present invention can be used for... Agent: Merchant & Gould PC 20070026386 - Method for the detection of newly acquired hiv infection: The present invention relates to the detection of a human immunodeficiency virus (HIV) infection. More particularly, the present invention relates to methods of distinguishing between early antibody responsesto HIV infection from matured responses. In one aspect, the present invention provides a method of distinguishing between a recent and an established... Agent: Bozicevic, Field & Francis LLP 20070026391 - Methods and compositions for identifying chemical or biological agents using multiplexed labeling and colocalization detection: The present invention provides methods for detecting a target pathogenic agent, e.g., a virus, a bacterium, and/or a toxic substance, using colocalization detection. The invention also provides methods for parallel detection of different target pathogenic agents in a sample using multiplexed labeling and colocalization detection. The invention also provides kits... Agent: The Law Office Of Steven G Roeder 20070026389 - Methods for drug discovery, disease treatment, and diagnosis using metabolomics: The small molecule profiles of cells are compared to identify small molecules which are modulated in altered states. Cellular small molecule libraries, methods of identifying tissue sources, methods for treating genetic and non-genetic diseases, and methods for predicting the efficacy of drugs are also discussed.... Agent: Lahive & Cockfield, LLP 20070026442 - Analytical method and device: A method is provided that conveniently allows rapid amplification of nucleic acids. Two different heat sources are used to heat the reaction mixture.... Agent: Roche Molecular Systems Inc Patent Law Department 20070026406 - Apparatus and method for classifying multi-dimensional biological data: Apparatus and method for classifying multi-dimensional biological data are described. In some embodiments, a methodology for deriving a linear classification rule can be used for predicting a biological activity or a biological state. Advantageously, the methodology described herein facilitates obtaining robust and sparse classifiers that account for uncertainty involved in... Agent: Howrey LLP 20070026452 - Aspartoacylase gene, protein, and methods of screening for mutations associated with canavan disease: Canavan disease, an autosomal recessive leukodystrophy, is caused by deficiency of aspartoacylase and accumulation of N-acetylaspartic acid in brain. Human aspartoacylase (ASP) cDNA spanning 1,435 bp has been cloned and expressed in E. coli. A base change, a854>c, has been found in 85% of the 34 Canavan alleles tested so... Agent: Millen, White, Zelano & Branigan, P.C. 20070026429 - Binary probe and clamp composition and methods for target hybridization detection: Binary probe and clamp compositions conduct methods for target hybridization detection. Where the probe is a substrate for exonuclease cleavage, the composition provides quantitation and detection of PCR products, by real-time and end-point measurements. Where the probe is an amplification primer, the composition provides an improved method for labelling and... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070026453 - Classification of patients having diffuse large b-cell lymphoma based upon gene expresson: Methods and kits for classifying patients having diffuse large B-cell lymphoma (DLBCL) based upon expression of a plurality of genes are disclosed. Real-time quantitative RT-PCR can be used to measure expression values. Correlating expression values of the plurality of genes in a tumor sample from the patient to reference expression... Agent: Harness, Dickey & Pierce, P.L.C 20070026428 - Combinatorial expression of split caspase molecules: The present invention relates to the use of split caspase proteins to determine whether or not promoters are coordinately active, whereby the transcriptional expression of incomplete portions of a caspase protein is controlled by different promoters and coordinate (not necessarily contemporaneous) promoter activity results in formation of an activated caspase... Agent: Baker & Botts L.L.P. 20070026393 - Detection of variations in the dna methylation profile: The invention describes a set of oligonucleotides as probes for the detection of relevant variations of DNA methylation in a target group of genes, the use thereof for the detection of gene variants with respect to DNA methylation, a medical device which uses a set of oligonucleotides, a method for... Agent: Kriegsman & Kriegsman 20070026413 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026414 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026415 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026416 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026417 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026418 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026419 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026399 - Diagnosis of gynecological neoplasms by detecting the levels of oviduct-specific glycoprotein: The present invention provides a method for detecting cancer in a patient. A sample from the patient is provided, and the level of oviduct-specific glycoprotein (OGP) in the sample is determined and compared to a control sample. Increased levels of OGP in the sample as compared to the control indicates... Agent: Bereskin And Parr 20070026443 - Diagnosis of uniparental disomy with the aid of single nucleotide polymorphisms: The present invention relates to a method for diagnosing uniparental disomy (UPD) in a human being via the analysis of the inheritance of informative single nucleotide polymorphisms (SNPs).... Agent: Knobbe Martens Olson & Bear LLP 20070026433 - Epitope testing using soluble hla: The present invention relates generally to a methodology for assaying the binding of a peptide to an individual, specific, soluble HLA molecule using fluorescence polarization. The peptides utilized in the method may be identified by indirect methods utilizing T lymphocytes, or by a direct method of epitope discovery described herein.... Agent: Dunlap, Codding & Rogers P.C. 20070026446 - Evolution of whole cells and organisms by recursive sequence recombination: The invention provides methods employing iterative cycles of recombination and selection/screening for evolution of whole cells and organisms toward acquisition of desired properties. Examples of such properties include enhanced recombinogenicity, genome copy number, and capacity for expression and/or secretion of proteins and secondary metabolites.... Agent: Maxygen, Inc. Intellectual Property Department 20070026439 - Fluid processing device and method: A fluid processing device and methods are provided that can process one or many different fluid samples, detection for each of which can be multiplexed to detect the presence or absence of each of a panel of target sequences, for example 20 different target sequences. The device can comprise a... Agent: Kilyk & Bowersox, P.l.l.c. 20070026424 - Gene profiles correlating with histology and prognosis: The present invention related to methods and kits for evaluating the histology and prognosis of lung cancer by measuring expression levels of specific gene markers. It is based, at least in part, on the discovery of 99 genes that were found to be differentially expressed among lung cancer subtypes, 30... Agent: Baker & Botts L.L.P. 20070026402 - Genetic marker of response to atypical antipsychotics and antidepressants methods for use thereof: The invention provides methods of identifying candidate psychiatric patients, or patients with movement disorder, for treatment with receptor site or increases density of D2 dopamine receptors. The method comprises determining a patient's DRD2 genotype. Patients having the Taq1A (A1) allele (A1+ allelic status) are candidates for treatment with high dose,... Agent: Karen S. Canady Canady & Lortz LLP 20070026436 - Glucose transport-related genes, polypeptides, and methods of use thereof: Methods and compositions for modulating glucose transport are provided herein.... Agent: Fish & Richardson PC 20070026425 - Hepatitis c virus non-structural ns3/4a fusion gene: Disclosed herein is the discovery of a novel hepatitis C virus (HCV) isolated from a human patient. Embodiments of the inevntion include HCV peptides, nucleic acids encoding said HCV peptides, antibodies directed to said peptides, compositions containing said nucleic acids and peptides, as well as, methods of making and using... Agent: Knobbe Martens Olson & Bear LLP 20070026395 - Human cancer-relating genes, the products encoded thereby and applications thereof: The invention discloses a human cancer-related gene, LAPTM4B, its encoded products and their applications thereof. This human cancer-related gene provided by this invention comprises one of the following nucleotide sequences: (1) SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 6, or SEQ ID... Agent: Morgan Lewis & Bockius LLP 20070026435 - Hydroxysilane functionalized magnetic particles and nucleic acid separation method: A method for obtaining nucleic acids from a sample, includes: providing the sample including nucleic acids and other components; providing paramagnetic particles including a metal oxide core and a hydroxysilane (preferably a hydroxyalkyltrialkoxysilane) coating; contacting the sample with the paramagnetic particles under binding conditions such that the nucleic acids bind... Agent: Caesar, Rivise, Bernstein, Cohen & Pokotilow, Ltd. 20070026440 - Identification, diagnosis, and treatment of neuropathologies, neurotoxicities, tumors, and brain and spinal cord injuries using electrodes with microvoltammetry: The present invention relates to devices and methods of use thereof for detection of biomolecules, in vitro, in vivo, or in situ. The invention relates to methods of diagnosing and/or treating a subject as having or being at risk of developing a disease or condition that is associated with abnormal... Agent: Morgan & Finnegan, L.L.P. 20070026408 - Materials and methods for analysis of atp-binding cassette transporter gene expression: The invention provides materials and methods for detecting the expression of ABC transporter genes. The materials include sets of primers and PCR amplicons. The sets of primers are used to generate PCR amplicons, wherein each PCR amplicon is a unique portion of an ABC transporter gene. The methods of the... Agent: Bereskin And Parr 20070026405 - Materials and methods for colorectal cancer screening, diagnosis and therapy: The invention provides materials and methods for colorectal cancer screening, diagnosis, and therapy.... Agent: Marshall, Gerstein & Borun LLP 20070026421 - Method and apparatus for generating thermal melting curves in a microfluidic device: The present invention provides novel methods and devices that employ microfluidic technology to generate molecular melt curves. In particular, the devices and methods in accordance with the invention are useful in providing for the analysis of PCR amplification products.... Agent: Caliper Life Sciences, Inc. 20070026401 - Method and apparatus for spore disruption and/or detection: A method and apparatus for spore disruption and/or detection is provided. The method involves irradiating a sample with laser light, conveniently ultraviolet radiation, to disrupt any spores present and collecting any disrupted material for analysis. The disruption can involve breaking the spore open to release intrasporal DNA which is useful... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070026403 - Method and systems for identifying micro-rna targets and synthesizing novel micro-rnas and uses of the same: Method of identifying a microRNA-recognition element and of generating microRNAs are disclosed. System and computer programs for performing such methods are disclosed. Recombinant nucleic acid molecule comprising a heterologous coding sequences and one or more MREs are also disclosed as are isolated nucleic acid molecule comprising one or more MRE... Agent: Cozen O'connor, P.C. 20070026423 - Method and test kit for the detection of target nucleic acids: This invention concerns a method for the detection of target nucleic acids or analoga to nucleic acids (targets), wherein at least one pair of labeled oligonucleotides or analoga to oligonucleotides (probes) are used, characterised in that the upstream probe proportionally hybridises to the target with its 5′ end and proportionally... Agent: Jordan And Hamburg LLP 20070026427 - Method enabling use of extracellular rna extracted from plasma or serum to detect, monitor or evaluate cancer: This invention relates to the use of tumor-derived or associated extracellular ribonucleic acid (RNA) found circulating in the plasma or serum fraction of blood for the detection, monitoring, or evaluation of cancer or premalignant conditions. Extracellular RNA may circulate as non-bound RNA, protein-bound RNA, lipid-RNA complexes, lipoprotein (proteolipid)—RNA complexes, protein-RNA... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 32nd Floor 20070026397 - Method for producing second-generation library: The present invention relates to a method for generating a second-generation library. In a first step, a library of encoded molecules associated with an identifier nucleic acid comprising codons identifying chemical entities that have participated in the formation of the encoded molecule is provided. In a second step, the library... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw 20070026451 - Methods for rapidly identifying small organic molecule ligands for binding to biological target molecules: The present invention is directed to novel methods for rapidly and unambiguously identifying small organic molecule ligands for binding to biological target molecules. Small organic molecule ligands identified according to the methods of the present invention may find use, for example, as novel therapeutic drug lead compounds, enzyme inhibitors, labeling... Agent: Heller Ehrman LLP 20070026441 - Methods for reducing viral load in hiv-1-infected patients: This method provides a method for reducing HIV-1 viral load in an HIV-1-infected human subject which comprises administering to the subject at a predefined interval effective HIV-1 viral load-reducing doses of (a) a humanized antibody designated PRO 140, or of (b) an anti-CCR5 receptor monoclonal antibody. This invention also provides... Agent: Cooper & Dunham, LLP 20070026450 - Methods for the treatment of carcinoma: The invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The invention is based upon the identification of genes that are amplified in the genome of tumor cells, such as renal cell carcinoma. Such gene amplification is expected to... Agent: Genentech, Inc. 20070026438 - Methods of producing and sequencing modified polynucleotides: The present invention encompasses methods for producing a modified polynucleotide sequence that comprises a (e.g., one or more) phosphorothiolate linkage, methods for determining a polynucleotide sequence comprising a (e.g., one or more) phosphorothiolate linkage, and methods for separating forward and reverse extension products that comprise a (e.g., one or more)... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070026434 - Mobility-modified nucleobase polymers and methods of using same: The present invention relates generally to nucleobase polymer functionalizing reagents, to mobility-modified sequence-specific nucleobase polymers, to compositions comprising a plurality of mobility-modified sequence-specific nucleobase polymers, and to the use of such polymers and compositions in a variety of assays, such as, for example, for the detection of a plurality of... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070026394 - Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies: The present invention relates to nucleic acid molecules, including antisense, enzymatic nucleic acid molecules, and RNA interference molecules, such as hammerhead ribozymes, DNAzymes, allozymes, siRNA, decoys and antisense, which modulate the expression of prostaglandin D2 (PTGDS), prostaglandin D2 receptor (PTGDR), adenosine receptor, NOGO and NOGO receptor, and IKK genes, such... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070026431 - Modulation of mapk-mediated phosphorylation and/or fbxw8-mediated ubiquitinylation of cyclin d1 in modulation of cellular proliferation: The invention features methods and compositions for screening for agents that modulate cellular proliferation, particularly in cells that have elevated cyclin D1 (e.g., cancerous cells), where the methods provide for detection of agents that modulate phosphorylation of cyclin D1 by MAPK and/or detection of agents that modulate ubiquitination of cyclin... Agent: Bozicevic, Field & Francis LLP 20070026400 - Multi-hybridization set for dna microarray related assay: The present invention relates to a multi-hybridization set for DNA microarray assay, which comprises: a lower plate in which a DNA microarray is mounted; an upper plate which is coupled to the lower plate, and in which one or more O-rings are attached to the lower surface of the upper... Agent: Intellectual Property / Technology Law 20070026412 - Multiplex pcr for the detection of ampc beta-lactamase genes: Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain AmpC beta-lactamases. The primers can be employed in methods to detect the presence or absence of an AmpC beta-lactamase gene in samples, and to identify nucleic acid characteristic of AmpC beta-lactamase genes in samples, particularly, in clinical... Agent: Mueting, Raasch & Gebhardt, P.A. 20070026437 - Novel bmp products: Purified BMP-2 and BMP-4 proteins and processes for producing them are disclosed. The proteins may be used in the treatment of bone and cartilage defects and in wound healing and related tissue repair.... Agent: Wyeth/finnegan Henderson, LLP 20070026420 - Novel egiii-like enzymes, dna encoding such enzymes and methods for producing such enzymes: r 20070026407 - Novel fine fluorescent particle: Novel silica particles having bondable functional groups on the surface thereof and containing a fluorescent rare-earth complex characterized by being uninfluenced by the surrounding environment including a buffer and a substance to be labeled. The silica particles containing a fluorescent rare-earth complex specifically are ones which comprise silica particles containing... Agent: Rader Fishman & Grauer PLLC 20070026449 - Novel human sodium-dependent phosphate cotransporter: The present invention provides a human sodium-dependent phosphate cotransporter (NAPTR) and polynucleotides which identify and encode NAPTR. The invention also provides genetically engineered expression vectors and host cells comprising the nucleic acid sequences encoding NAPTR and a method for producing NAPTR. The invention also provides for agonists, antibodies, or antagonists... Agent: Merchant & Gould PC 20070026445 - Novel steroid-activated nuclear receptors and uses therefor: A novel nuclear receptor, termed the steroid and xenobiotic receptor (SXR), a broad-specificity sensing receptor that is a novel branch of the nuclear receptor superfamily, has been discovered. SXR forms a heterodimer with RXR that can bind to and induce transcription from response elements present in steroid-inducible cytochrome P450 genes... Agent: Foley & Lardner LLP 20070026409 - Nucleic acid and amino acid sequences involved in pain: The present invention relates to nucleic acid sequences which are related to pain and which are differentially expressed during pain. The invention further relates to methods of identifying nucleic acid sequences which are differentially expressed during pain, microarrays comprising such differentially expressed sequences and methods of screening agents for the... Agent: Palmer & Dodge, LLP Kathleen M. Williams 20070026410 - Nucleoside cyanine dye derivatives for rna labeling and nucleic acid detection and methods for using same: Fluorescent adenosine derivatives that can be incorporated into the 5′ end of transcribed RNA are disclosed. Adenosine derivatives have readily detectable cyanine dyes attached. Symmetric derivatives are disclosed that. The transcribed RNAs can be used in a variety of applications including nucleic acid detection and in the study of RNA... Agent: Adegenix 20070026447 - Nucleotides: The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme... Agent: Wilson Sonsini Goodrich & Rosati 20070026396 - Peptides directed against antibodies, which cause cold-intolerance, and the use thereof: The invention relates to nucleic acid molecules encoding peptides which are directed against autoantibodies associated with cold allergy, to the peptides themselves, to a pharmaceutical composition comprising said nucleic acid molecules and peptides, and to the use of said nucleic acid molecules and peptides for the treatment of circulatory disorders... Agent: Millen, White, Zelano & Branigan, P.C. 20070026448 - Polynucleotide encoding a novel human g-protein coupled receptor, hbprbmy39: The present invention provides novel polynucleotides encoding HGPRBMY39 polypeptides, fragments and homologues thereof. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing said polypeptides. The invention further relates to diagnostic and therapeutic methods for applying these novel HGPRBMY39 polypeptides to the diagnosis, treatment, and/or prevention... Agent: Louis J. Wille Bristol-myers Squibb Company 20070026411 - Preparing rna from a wax-embedded tissue specimen: In particular embodiments in accordance with the present invention, a wax-embedded tissue specimen is digested and the resulting digested tissue specimen is purified to provide a purified RNA fraction. The purified RNA fraction is treated with one or more enzymes to provide a sample containing dephosphorylated RNA; the sample is... Agent: Agilent Technologies Inc. 20070026404 - Production characteristics of cattle: A single nucleotide polymorphism (SNP) in exon 2 of the cattle IGF2 gene is associated in cattle with phenotypes of increased rib eye area, decreased fat content, decreased marbling, and decreased birth weight. The presence of a C residue at position 150 of SEQ ID NO: 1, results in increased... Agent: Bennett Jones C/o Ms Roseann Caldwell 20070026398 - Protein tyrosine phosphatase-prl-1 a a marker and therapeutic target for pancreatic cancer: Using gene expression profiling, the present Invention identifies Protein tyrosine phosphatase IVA member 1 (PRL-1) as a diagnostic marker and therapeutic target for pancreatic cancer. The Invention therefore provides methods for prediction and detection of PRL-1 associated cancers, and evaluation of inhibitors of PRL-1. The Invention also provides a method... Agent: Fulbright & Jaworski L.L.P. 20070026430 - Proximity probing of target proteins comprising restriction and/or extension: The present teachings provide methods, compositions, and kits for detecting target analytes, including proteins. In some embodiments, cleavage reactions are performed in the context of proximity probe reactions that query target proteins, wherein the presence and/or quantity of cleavage products is indicative of the presence and/or quantity of a target... Agent: Mila Kasan, Patent Dept. Applied Biosystems 20070026432 - Separation and purification of nucleic acid from paraffin-containing samples: Disclosed are rapid and reproducible methods for separating and purifying nucleic acids from paraffin-containing tissue samples. The disclosed methods involve a melting step, where paraffin-containing tissue samples are heated in the presence of a detergent, causing the paraffin to melt and tissue sample cells to lyse. From the resulting two-phase... Agent: Biotechnology Law Group C/o Portfolioip 20070026426 - System for genetic surveillance and analysis: A genetic surveillance system comprises a communications network and at least one reader-analyzer instrument. The reader-analyzer instrument has a communication interface to communicate over the network. The reader-analyzer instrument is adapted to perform genetic assay analysis of a sample obtained from a member of a population and to generate detection-related... Agent: Harness, Dickey & Pierce, P.L.C 20070026444 - Thermal cycling in polymerase chain reactions by thermodynamic methods: Systems and methods for rapid thermal cycling in a polymerase chain reaction (“PCR”). Thermodynamic work is performed, directly, or indirectly, or both, on or by analyte and reagents comprising a PCR mixture. The thermodynamic work, which is typically adiabatic, reversible, and isentropic, causes a rapid and uniform change in the... Agent: Edwards & Angell, LLP 20070026422 - Vaccine-induced hepatitis b viral strain and uses thereof: This invention provides an isolated strain of Hepatitis B virus designated Human Hepatitis B Virus Surface Antigen-‘S’-145 Singapore Strain (Glycine to Arginine) which constituent viral genome is deposited under Accession Nos. P97121504, P97121505 and P97121506 with the European Collection of Cell Culture on 15th Dec. 1997. This invention also provides... Agent: Ladas & Parry 20070026458 - Assessing insulin resistance using biomarkers: The invention encompasses novel biomarkers and methods for assessing insulin resistance in a subject. The novel biomarkers of the invention include various plasma constituent (e.g., insulin, glucose, lactate and/or triglyceride) concentrations. The methods of the invention include measuring various plasma constituent concentrations and calculating a predicted euglycemic hyperinsulinemic clamp glucose... Agent: Entelos, Inc. C/o Foley & Lardner LLP 20070026464 - Biologically active synthetic thyrotropin and cloned gene for producing same: Substantially pure recombinant TSH has been prepared from a clone comprising complete nucleotide sequence for the expression of the TSH. Diagnostic and therapeutic applications of the synthetic TSH are described.... Agent: Knobbe, Martens, Olson & Bear, LLP 20070026463 - Compositions and methods of mutant nogo-66 domain proteins: To facilitate the study of Nogo-66 interaction with its neuronal receptors, and to explore therapeutic opportunities, the present invention provides mutant human Nogo-66 domain-based proteins that do not aggregate during isolation or purification procedures, and methods for using these proteins. Aggregates of Nogo-66 domain containing proteins do not effectively or... Agent: Wilmer Cutler Pickering Hale And Dorr LLP / 20070026462 - Gas 1 universal leader: Disclosed is a polynucleotide molecule comprising a promoter operably linked to a nucleic acid sequence encoding a GAS1 secretion signal peptide, wherein said promoter is not a rhamnose promoter.... Agent: Palmer & Dodge, LLP Kathleen M. Williams 20070026454 - Human secreted proteins: The present invention relates to human secreted polypeptides, and isolated nucleic acid molecules encoding said polypeptides, useful for diagnosing and treating hematopoietic and hematologic diseases, disorders, and/or conditions related thereto. Antibodies that bind these polypeptides are also encompassed by the present invention. Also encompassed by the invention are vectors, host... Agent: Human Genome Sciences Inc Intellectual Property Dept. 20070026456 - Method of biomolecule analysis and method of identifying biomolecule therewith: A biomolecule is analyzed with high accuracy. A biomolecule is analyzed with high likelihood. A biomolecule as an analysis subject is modified with a marker binding or adsorbing to only its specific portion (S101). Next, the biomolecule modified with the marker is developed on a base plate (S102). The arrangement... Agent: Young & Thompson 20070026455 - Method of producing hybridoma and utilization thereof: The present invention provides a method of producing an antibody-producing hybridoma, which includes fusing a B cell immunized in vitro and a myeloma cell, and which is more efficient and practical than the conventional methods, more specifically a method of producing an antibody-producing hybridoma, which includes fusing a B cell... Agent: Edwards & Angell, LLP 20070026459 - Methods for determination of an analyte: The invention relates to analytical methods in which the partition of a labeled substance between a liquid and a solid phase is determined. The assays include solid-phase reagents which can be particulate or monolithic such as, for example, a coated tube. Assays of this type are known per se to... Agent: Finnegan, Henderson, Farabow, Garrett & Dunner LLP 20070026461 - Production of motif-specific and context-independent antibodies using peptide libraries as antigens: A method is provided for producing motif-specific, context-independent antibodies that recognize a plurality of peptides or proteins within a genome that contain the same post-translationally modified motif. The method includes the step of immunizing a host with a degenerate peptide library antigen featuring (i) a fixed target motif containing one... Agent: James Gregory Cullem, Esq. Intellectual Property Counsel 20070026457 - Screening method: The present invention provides a method of screening an agent for the prevention/treatment of cancer. More specifically, the present invention provides a screening method/screening kit for screening a compound or its salt that changes the binding properties of a protein comprising the same or substantially the same amino acid sequence... Agent: Takeda Pharmaceuticals North America, Inc Intellectual Property Department 20070026460 - Use of ionic liquids for protein extraction: The present invention relates to a method for the extraction of proteins, protein fragments and/or peptides from biological samples, where the extractants employed are ionic liquids of the general formula K+A−, to a kit for the extraction of proteins, protein fragments and/or peptides, and to the use thereof.... Agent: Millen, White, Zelano & Branigan, P.C. 20070026465 - Method for detecting gad65 autoreactive t cells newly diagnosed type1 diabetic patients and in the prediabetic period: The invention refers to a method for detecting GAD65 specific T cells in a biological sample useful for the prediction of T1D onset, and/or to follow up the effects of therapeutics and in particular of specific immunotherapies in the pre-clinical period of the disease.... Agent: Law Offices Of Albert Wai-kit Chan, LLC 20070026467 - Lupus anticoagulant testing: The present invention relates generally to the field of diagnostic screening and diagnostic assays. In particular, the present invention provides an improved, rapid, and efficient method of screening for antiphospholipid antibodies, such as lupus anticoagulants (LA). The invention also relates to a kit for screening plasma levels for antiphospholipid antibodies... Agent: Frommer Lawrence & Haug 20070026468 - Tetrameric antibody complexes for blocking non-specific labeling of antigens: A method for preventing or inhibiting non-specific binding reactions between a detection reagent and an antigen in an immunological assay is described. The method involves using tetrameric antibody complexes that can bind to the antigen and are comprised of two monoclonal antibodies of a first animal species linked to two... Agent: Bereskin And Parr 20070026469 - Devices and methods for enrichment and alteration of circulating tumor cells and other particles: The invention features devices and methods for detecting, enriching, and analyzing circulating tumor cells and other particles. The invention further features methods of diagnosing a condition, e.g., cancer, in a subject by analyzing a cellular sample from the subject.... Agent: Clark & Elbing LLP 20070026471 - Glypican-1 in human breast cancer: Glycosylphosphatidylinositol-(GPI-) anchored HSPG glypican-1 is strongly expressed in human breast and pancreatic cancer—both by the cancer cells and in the case of pancreatic cancer the adjacent fibroblasts—whereas expression of glypican-1 is low in the normal pancreas and in chronic pancreatitis. Treatment of two pancreatic cancer cell lines, which express glypican-1,... Agent: Robert D. Fish Rutan & Tucker LLP 20070026470 - Mammalian iap gene family, primers, probes and detection methods: Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; and methods of using such DNA to express the IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed are conserved regions characteristic of the IAP family and primer and probes for the identification and isolation of additional IAP genes.... Agent: Philip Swain, Phd C/o Gowling Lafleur Henderson 20070026473 - Antibody profiles characteristic of tuberculosis state: Serum antibody assays capable of distinguishing cases of inactive TB from cases of active TB include a combination at least three M. tuberculosis protein antigens, at least one for which a positive response is consistent with inactive TB and antigens, and at least one for which a negative response is... Agent: Fish & Richardson P.C. 20070026474 - Compositions and methods for detection of ehrlichia canis and ehrlichia chaffeensis antibodies: The invention provides methods and compositions for the detection of Ehrlichia canis and Ehrlichia chaffeensis antibodies and antibody fragments.... Agent: Mcdonnell Boehnen Hulbert & Berghoff LLP 20070026472 - Sterilization wrap with additional strength sheet: A sterilization wrap is provided. The sterilization wrap includes a first sheet that is configured for providing a barrier to prevent at least some bacteria from passing therethrough while allowing sterilization gas to pass therethrough. A second sheet is attached to the first sheet. The second sheet is located on... Agent: Dority & Manning, P.A. 20070026466 - Methods for predicting pregnancy outcome in a subject by hcg assay: The present invention provides a method of predicting pregnancy outcome in a subject by determining the amount of an early pregnancy associated molecular isoform of hCG in a sample. The present invention further provides a method for determining the amount of early pregnancy associated molecular isoforms of human chorionic gonadotropin... Agent: Cooper & Dunham LLP 20070026475 - Kinase and phosphatase activity measurement using fluorescent polarization: A method for quantitating enzyme activity that causes phosphorylation or dephosphorylation of a peptide or protein substrate is provided. The method utilizes the differences in fluorescence polarization of a phosphorylated amino acid-containing fluorescence-emitting reporter molecule free in solution as compared to being bound to a binding molecule.... Agent: Invitrogen Corporation C/o Intellevate 20070026476 - Compounds, methods, complexes, apparatuses and uses relating to stabile forms of nad/nadh: The invention concerns stable nicotinamide adenine dinucleotide (NAD/NADH) and nicotinamide adenine dinucleotide phosphate (NADP/NADPH) derivatives, enzyme complexes of these derivatives and their use in biochemical detection methods and reagent matrices.... Agent: Roche Diagnostics Operations Inc. 20070026477 - Whole cell assay involving cathepsin s: The present invention relates to a method of identifying and evaluating chemical inhibitors of cathepsin S activity in whole cells. The present invention also relates to probes that are capable of forming irreversible adducts with cathepsin S at the active site. The probes used in the instant invention comprise radioactive... Agent: Merck And Co., Inc 20070026478 - Hemiasterlin affinity probes and their uses: Photoaffinity probes are provided that are based hemiasterlin and derivative compounds thereof. Use of these probes to identity ending sites for these and other drugs, particularly anti-tubulin drugs, are also provided as are methods for identifying new drugs (e.g., new anti-tubulin drugs) that bind to these binding sites.... Agent: Darby & Darby P.C. 20070026479 - Liquid protein markers for native gel electrophoresis: Marker sets are provided for use on nondenaturing gels. The protein molecular weight markers are provided in liquid form, and are stable in liquid form for at least two months at 4 degrees C. and at least one year at −20 degrees C. Methods of using the markers and kits... Agent: Invitrogen Corporation C/o Intellevate 20070026480 - Method and composition to evaluate cytochrome p450 2d6 isoenzyme activity using a breath test: The present invention relates, generally to a method of determining and assessing cytochrome P450 2D6 isoenzyme (CYP2D6)-related metabolic capacity in an individual mammalian subject via a breath assay, by determining the relative amount of 13CO2 exhaled by a the subject upon intravenous or oral administration of a 13C-labeled CYP2D6 substrate... Agent: Foley & Lardner LLP 20070026482 - Fluorogenic selective and differential medium for isolation of enterobacter sakazakii: Particular aspects provide novel compositions and methods useful for the growth, isolation and detection of microorganisms that have α-glucosidase activity (e.g., the bacterium E. sakazakii). Certain embodiments provide a novel growth and/or plating media, comprising a fluorogenic α-glucosidase substrate, which is both selective for and differential to E. sakazakii. In... Agent: Davis Wright Tremaine, LLP 20070026483 - System for staining fungi and protozoa: The present invention provides a method for the staining of fungi and microsporidia for observation with a light microscope based upon the presence of chitin in the composition of these organisms. With the method of the present invention a sample to be analyzed is treated with a solution of Ponceau... Agent: Smith Hopen, Pa 20070026481 - Toxic mold screening kit & method for the colorimetric determination of the presence or absence of the toxic mold stachybotrys chartarum and other toxic environmental molds: A method for the presumptive detection of the presence or absence and relative dominance of the toxic mold Stachybotrys chartarum collected from an environmental surface via a swab or other sampling device. The method of growth and color development of the sample utilizes dehydrated biological growth plates, pre measured hydration... Agent: Sean M. Reilly 20070026484 - Method to increase hydrophobic compound titer in a recombinant microorganism: Expression of at least one plant oleosin gene in a microbial cell engineered to produce hydrophobic/lipophilic compounds significantly increases the overall titer of the compound. The hydrophobic nature of the oleosin core is believed to increase the microbial host cell's internal storage capacity for any hydrophobic/lipophilic compound. The method is... Agent: E I Du Pont De Nemours And Company Legal Patent Records Center 20070026485 - Glycopegylation methods and proteins/peptides produced by the methods: The invention includes methods and compositions for remodeling a peptide molecule, including the addition or deletion of one or more glycosyl groups to a peptide, and/or the addition of a modifying group to a peptide.... Agent: Morgan, Lewis & Bockius LLP (sf) 20070026488 - Biosynthesis of bryostatins by polyketide synthases (pks): The present invention relates to the discovery, isolation and sequencing of novel polyketide synthase genes. These newly identified genes are involved in the biosynthesis of bryostatins. The genes are found to be expressed in all life stages of Bugula neritina, are associated with the bacterial symbiont Endobugula sertula and are... Agent: Basil S. Krikelis Citizens Bank Center 20070026491 - Candida kefyr cytosine deaminase: A new cytosine deaminase gene and protein from Candida kefyr are provided. This protein has increased ability to convert the 5-fluorocytosine prodrug to its toxic form when compared against the E. coli enzyme.... Agent: Baker & Mckenzie LLP 20070026486 - Coumermycin/novobiocin-regulated gene expression system: A chimeric transactivator comprises a transcription activation domain, a repressor protein DNA binding domain and the bacterial DNA gyrase B subunit. A target gene is operatively linked to operator DNA sequences recognized by the repressor binding domain. The addition of the antibiotic coumermycin results in a coumermycin-switched dimerization of the... Agent: Cassan Maclean 20070026492 - Expression of g protein-coupled receptors with altered ligand binding and/or coupling properties: Modified forms of G protein-coupled receptors which display altered ligand binding and/or coupling properties are provided as well as cells expressing such receptors and assays utilizing these cells for screening and identifying pharmaceutically effective compounds that specifically modulate the activity of a these modified forms of G protein coupled receptors.... Agent: Edwards & Angell, LLP 20070026494 - Mammalian iap gene family, primers, probes and detection methods: Disclosed is substantially pure DNA encoding mammalian IAP polypeptides; and methods of using such DNA to express the IAP polypeptides in cells and animals to inhibit apoptosis. Also disclosed are conserved regions characteristic of the IAP family and primer and probes for the identification and isolation of additional IAP genes.... Agent: Philip Swain, Phd C/o Gowling Lafleur Henderson 20070026497 - Method for controlling metallophosphate precipitation in high cell density fermentations: The invention relates to the use of a phosphate glass as a phosphorous source in the media of high cell density bacterial fermentation processes in order to reduce metallophosphate precipitation reactions. The methods of the invention demonstrate a practical method for controlling levels of metallophosphate precipitation in both the nutrient... Agent: Amgen Inc. 20070026495 - Novel integrin ligand itgl-tsp: ITGL-TSP polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing ITGL-TSP polypeptides and polynucleotides in the design of protocols for the treatment of, angiogenic diseases (cancer, cancer metastasis, chronic inflammatory disorders, rheumatoid arthritis, atherosclerosis, macular degeneration, diabetic retmopathy), restenosis,... Agent: Human Genome Sciences Inc. Intellectual Property Dept. 20070026498 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070026499 - Nucleic acid sequences having gene transcription regulatory qualities: The invention is concerned with the systematic elucidation and identification of regulatory sequences. The invention provides among others screenings and detection methods with which regulatory sequences can be identified. The invention further provides regulatory sequences and use thereof in various fields such as, but not limited to, protein production, diagnostics,... Agent: Trask Britt 20070026496 - Process for producing polypeptides: A process is described for producing a polypeptide heterologous to E. coli wherein E. coli cells comprising nucleic acid encoding the polypeptide are cultured in a culture medium while feeding to the culture medium a transportable organophosphate, such that the nucleic acid is expressed. The polypeptide is then recovered from... Agent: Genentech, Inc. 20070026487 - Secreted and transmembrane polypeptides and nucleic acids encoding the same: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of... Agent: Heller Ehrman LLP 20070026493 - System and method for optimizing animal production using genotype information: A system for generating optimized values for variable inputs to an animal production system. The system includes a simulator engine configured to receive a plurality of animal information inputs and generate a performance projection. At least one of the animal information inputs is designated as a variable input and at... Agent: Cargill, Incorporated 20070026489 - Vegetarian protein a preparation and methods thereof: The invention relates to methods of producing Protein A without contamination of the Protein A by animal products. The invention also relates to a vegetarian fermentation media in which Staphylococcus aureus is grown to produce a vegetarian Protein A. The invention further relates to a vegetarian Protein A and the... Agent: Hamilton, Brook, Smith & Reynolds, P.C. 20070026500 - Crystalline neutrokine-alpha protein, method of preparation thereof, and method of use thereof: The invention relates to a Neutrokine-alpha protein in crystalline form, a method of preparing a Neutrokine-alpha protein in crystalline form, and methods of using a Neutrokine-alpha protein in crystalline form. In particular, the three-dimensional structure of a Neutrokine-alpha protein in crystalline form is used to design molecules that have biological... Agent: Human Genome Sciences Inc Intellectual Property Dept. 20070026501 - Immunogen, composition for immulogical use and process for producing antibody using the same: It is intended to provide an immunogen and a composition for immunological use by which a sufficient immune response is induced even by an antigen protein which has been considered unavailable to induce any effective immune responses for various reasons, and a method of producing an antibody using the same.... Agent: Browdy And Neimark, P.l.l.c. 624 Ninth Street, Nw 20070026503 - Polyomavirus cellular epitopes and uses therefor: The present invention relates to HLA-A*02-restricted cellular epitopes within the VP1 polypeptide of a human polyomavirus, BK virus, which is associated with polyomavirus-associated nephropathy in kidney transplant patients. Preferred peptides correspond to amino acids residues 107-116, 108-116 and 44-52 of BKV VP1, and are processed in vivo in natural infection... Agent: Rothwell, Figg, Ernst & Manbeck, P.C. 20070026502 - Specificity exchangers that redirect antibodies to a pathogen: Specificity exchangers and methods of making and using specificity exchangers are disclosed. Specificity exchangers are useful for preventing and treating human diseases including cancer and those resulting from pathogens such as bacteria, yeast, parasites, fungus, viruses, and the like. More specifically, specificity exchangers can redirect existing antibodies in a subject... Agent: Knobbe Martens Olson & Bear LLP 20070026504 - Method for producing l-fuculose and method for producing l-fucose: The present invention provides a method for producing L-fuculose and L-fucose which is suitable as an industrial method. L-Fuculose is synthesized from L-fucitol in the presence of a microorganism-derived protein having a dehydrogenase activity which results in production of L-fuculose from L-fucitol. The reaction system preferably contains NADH oxidase. L-Fuculose... Agent: Cermak & Kenealy LLP Acs LLC 20070026505 - Amino acid and metabolite biosynthesis: Bacterial strains that are engineered to increase the production of amino acids, including aspartate-derived amino acids (e.g., methionine, lysine, threonine, isoleucine, and S-adenosylmethionine (S-AM)) and cysteine, and related metabolites are described. The strains can be genetically engineered to harbor one or more nucleic acid molecules (e.g., recombinant nucleic acid molecules)... Agent: Fish & Richardson PC 20070026506 - Method for the production of taxol and/or taxanes from cultures of hazel cells: Method for the production of taxol and/or taxanes, comprising the steps of: a) inducing the formation of callus from a plant tissue explant, through in vitro culturing in a suitable nutritient medium, b) cultivating the callus in a liquid medium to obtain a cell suspension culture capable of producing taxol... Agent: Akerman Senterfitt 20070026507 - Microbial sulfoxidation and amidation of benzhdrylsulfanyl carboxylic acids and uses thereof: The present invention provides novel methods for the synthesis of racemic and enantiomers of modafinil via microbial oxidation-amidation transformation. The methods include the successive oxidation-amidation of benzhydrylsulfanyl carboxylic acid to produce racemic and enantiomers of modafinil using at least one microorganism of yeast, bacteria, or fungus. Also disclosed are pharmaceutical... Agent: Mckee, Voorhees & Sease, P.L.C 20070026508 - Enzymatic method of making 1,2-diol derivatives and their esters: The present invention relates to a new process for the preparation of optically active alcohols represented by the general formula 2 and their esters represented by the general formula 3 by enzymatic method from racemic alcohols represented by the general formula 1 in scheme 1. In more details, this invention... Agent: Ipla P.A. 20070026509 - Novel surface-active polysiloxane photoinitiators: Polymeric photoinitiators of the formula I or II wherein n and m independently of one another are 3-5; o is 10-16; p is 4-8; R is phenyl-CO—CO—O—; Y and Y′ independently of one another are C1-C10alkylene or —[(CH2)a—O—(CH2)b]c— wherein a is 2-10, b is 0-10, c is 1-3; with the... Agent: Ciba Specialty Chemicals Corporation Patent Department 20070026510 - Process for biochemical production of glyoxylic acid: The present invention provides an industrially advantageous process for biochemical production of glyoxylic acid from glyoxal. More specifically, the present invention provides a process for production of glyoxylic acid, which is characterized in that the process comprises allowing oxidoreductase that can convert glyoxal into glyoxylic acid, such as oxidase and... Agent: Sughrue Mion, PLLC 20070026511 - Methods for the administration of fv and related compositions: The present invention is generally directed to methods for the administration of compositions related to improved physical performance and post-exertion recovery, as well as the administered compositions. It is more specifically directed to compositions containing a FV extract and methods for using such compositions that, among other things, improve lactic... Agent: Sheppard, Mullin, Richter & Hampton LLP 20070026512 - Atomic structure of the catalytic domain for use in designing and identifying inhibitors of zap-70 kinase: The present invention relates to the three dimensional structure of ZAP-70 protein tyrosine kinase and describes methods of making a crystal of ZAP-70 and purification of the catalytic domain of ZAP-70 for use in crystallization. The invention also relates to the use of the three dimensional structure of the catalytic... Agent: Novartis Corporate Intellectual Property 20070026513 - Method for treating organic material utilizing solid-liquid two phase circulation process: An organic matter processing method for optimizing a cleaning speed of matter inside the solid-phase reactor, making a load of organic matter on a liquid-phase reactor, and preventing solid-phase reaction from stopping due to agglutination is provided. A part of organic matter and decomposed products is disposed by using a... Agent: Arent Fox PLLC 20070026514 - Electromagnetic treatment apparatus for enhancing pharmacological, chemical, and topical agent effectiveness and method for using same: A method for enhancing pharmacological, chemical, topical, and cosmetic effects comprising applying at least one reactive agent to a target pathway structure, configuring at least one waveform having at least. one waveform parameter, selecting a value of said at least one waveform parameter of said at least one waveform to... Agent: Len Taylor, Patent Attorney 20070026515 - Cell or drug encapsulation device having a wet seal: A biologically implantable containment device having a wet seal, the device being adaptable for drug formulations or cell suspensions. A porous membrane, in a tubular configuration, is formed and can be configured as part of a closed cell-tight system for loading. During loading, the containment device membrane is wet, while... Agent: Gore Enterprise Holdings, Inc. 20070026516 - Multilayered cell culture apparatus: A multilayered cell culture apparatus for the culturing of cells is disclosed. The cell culture apparatus is defined as an integral structure having a plurality of cell culture chambers in combination with tracheal space(s). The body of the apparatus has imparted therein gas permeable membranes in combination with tracheal spaces... Agent: Corning Incorporated 20070026518 - Controlling stem cell destiny with tunable matrices: The present invention provides a class of interpenetrating polymeric networks (IPNs) and semi-interpenetrating polymeric networks (sIPNs) which include a covalently grafted growth factor or differentiation factor for a stem cell.... Agent: Morgan, Lewis & Bockius LLP (sf) 20070026519 - Devices and methods for pharmacokinetic-based cell culture systems: Devices, in vitro cell cultures, systems, and methods are provided for microscale cell culture analogous (CCA) device.... Agent: Wilson Sonsini Goodrich & Rosati 20070026517 - Method and bioreactor for the cultivation and stimulation of three-dimensional, vitally and mechanically reistant cell transplants: A process and a bioreactor for the manufacturing of three-dimensional, vital and mechanically-resistant cell cultures that can be cultivated and stimulated within a short time of each other or simultaneously. The bioreactor has a basic body connected to a reactor lock so that it is pressure proof and sterile, this... Agent: Lerner Greenberg Stemer LLP 20070026520 - Novel cells, compositions, and methods: Disclosed are compositions and methods for producing cells and stem cells.... Agent: Needle & Rosenberg, P.C. 20070026521 - Polynucleotides for use in recombinant adeno-associated virus virion production: Accessory functions capable of supporting efficient recombinant AAV (rAAV) virion production in a suitable host cell are provided. The accessory functions are in the form of one or more vectors that are capable of being transferred between cells. Methods of producing rAAV virions are also provided. The methods can be... Agent: Robins & Pasternak Previous industry: Education and demonstrationNext industry: Chemistry: analytical and immunological testing ###### RSS FEED for 20091029: Integrate FreshPatents.com into your RSS reader/aggregator or website to track weekly updates. For more info, read this article. ###### Thank you for viewing Chemistry: molecular biology and microbiology patents on the FreshPatents.com website. These are patent applications which have been filed in the United States. There are a variety ways to browse Chemistry: molecular biology and microbiology patent applications on our website including browsing by date, agent, inventor, and industry. If you are interested in receiving occasional emails regarding Chemistry: molecular biology and microbiology patents we recommend signing up for free keyword monitoring by email. ### FreshPatents.com Support Results in 8.20166 seconds |
* Easy, fast online form * Protect your Inventions * US Patent Office filing Provisional Patent Utility Patent - - - - - - - - - - - - - - - - - - - - - - * Fast online form * Protect your Name/Design * US Government filing Trademark Services - - - - - - - - - - - - - - - - - - - - - - PATENT INFO |