Composition comprising sortase anchored surface proteins of streptococcus uberis   

Abstract: The present invention provides an immunogenic composition comprising one or more Streptococcus uberis sortase-anchored surface proteins, or an immunogenic part thereof, wherein the composition is capable of eliciting an immune response, when administered to a subject.

The present invention relates to an immunogenic composition for use in eliciting an immune response to Streptococcus uberis, and in particular, to immunogenic compositions capable of eliciting a protective immune response.

Streptococcus uberis (S. uberis) is currently responsible for around 20-30% of all clinical mastitis cases in the UK and occurs at a similar incidence worldwide. Mastitis remains the most economically important infectious disease of dairy cattle throughout the world. The annual loss due to clinical mastitis in the UK has been estimated at approximately £170 million and between $1.5-2.0 billion in the USA. These losses can be attributed to a reduction in milk production, the associated costs of treatment and the culling of persistent and repeatedly infected cows. Micro organisms that cause mastitis can be divided into those that show a contagious route of transmission, such as Staphylococcus aureus and Streptococcus agalactiae, and those that additionally infect the udder frequently from an environmental reservoir, such as Escherichia coli and Streptococcus uberis. The application of various control measures over the past two decades, based on improved milking practices, post-milking teat disinfection and routine intra-mammary anti-microbial treatment after each lactation, has proved effective against pathogens with a solely contagious route of transmission, but has had little, if any, impact on the incidence of infection of the mammary gland from environmental reservoirs. The failure to control bovine mastitis caused by S. uberis is largely attributed to insufficient information on the pathogenesis of infection.

Bovine mastitis, which causes inflammation of the mammary gland (udder), usually arises as a result of intramammary infection by bacteria. The signs of mastitis vary according to factors in the host and the invading pathogen and intramammary infection may result in sub-clinical or clinical disease. Sub-clinical mastitis, by definition, shows no obvious signs of disease. Infection associated with clinical disease can range from visible abnormalities in the milk (protein aggregates or clots) accompanied by pain and swelling in the affected gland, to production of a secretion which is composed solely of aggregated protein in a serous fluid. In severe cases, there may be systemic signs such as elevated temperature and loss of appetite, which may develop to bacteraemia, septicaemia and lead to death of the animal.

Milk from an uninfected mammary gland contains leukocytes, including macrophages, neutrophils and lymphocytes typically below 150,000 cells/ml. Infection usually results in a localised inflammatory response, characterised by the influx of neutrophils into the infected quarter of the mammary gland and milk. The resulting milk cell count is used internationally as a surrogate measure of infection of the mammary gland and as a measure of milk quality and udder health. Milk from sub-clinically infected quarters usually has a cell count in excess of 250,000 cells/ml but this figure may vary widely. Milk from clinically infected quarters usually contains in excess of 2,000,000 cells/ml. The interaction between bacteria and/or their products and the large number of neutrophils in the secretion has been considered to be the principal cause underlying the decreased rate of milk production, degradation of the secretion and the induction of widespread inflammatory changes characteristic of mastitis.

One aim of this invention is to provide one or more compositions which can be used to elicit a protective immune response to Streptococcus uberis, and thereby prevent or reduce the incidence of mastitis.

According to a first aspect, the present invention provides an immunogenic composition comprising one or more Streptococcus uberis proteins, or an immunogenic part thereof, wherein the composition is capable of eliciting an immune response, when administered to a subject.

Preferably the one or more Streptococcus uberis proteins are sortase-anchored proteins, or an immunogenic part thereof.

A Streptococcus uberis sortase-anchored protein refers to any protein which in wild type Streptococcus uberis is anchored to the surface of the bacteria by the action of the enzyme sortase.

The one or more sortase-anchored proteins, or the one or more Streptococcus uberis proteins, may be selected from the group comprising the proteins SUB0145, SUB1095 and SUB1154 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

The immunogenic composition may comprise two or more Streptococcus uberis proteins, or an immunogenic part thereof.

The two or more sortase-anchored proteins, or the two or more Streptococcus uberis proteins, may be selected from the group comprising the proteins SUB0145, SUB1095 and SUB1154 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

The immunogenic composition may comprise proteins SUB0145, SUB1095 and SUB1154 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

The immunogenic composition may comprise proteins SUB1095 and SUB1154 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

The one or more sortase-anchored proteins, or the one or more Streptococcus uberis proteins, may be selected from the group comprising the proteins SUB0135, SUB0145, SUB0207, SUB0826, SUB0888, SUB1095, SUB1154, SUB1370, SUB1730 and SUB0241 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

The one or more sortase-anchored proteins, or the one or more Streptococcus uberis proteins, may be selected from the group comprising the proteins SUB0135, SUB0207, SUB0826, SUB0888, SUB1095, SUB1154, SUB1370, SUB1730 and SUB0241 or a protein with 50%, 60%, 70%, 80%, 90%, 95% or more, preferably 80% or more, sequence homology with one of the aforementioned proteins.

Reference to percentage homology relates to the percent identity between two aligned sequences. The percent identity refers to the residues in two proteins which are the same, when the protein sequences are aligned for maximum correspondence and when inversions and translocations are accounted for. Preferably the percent identity ignores any conservative differences between the aligned sequences which do not affect function. The percent identity between aligned sequences can be established by using well-established tools (such as the BLAST algorithm—Basic Local Alignment Search Tool; Altschul et al., (1990) J Mol. Biol. 215:403-10)

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0135. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0135.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0145. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0145.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0207. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0207.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0826. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0826.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0888. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0888.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB1095. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB1095.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB1154. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB1154.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB1370. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB1370.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB1730. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB1730.

In one embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is SUB0241. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0241.

In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0164. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0348. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB1739. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0206. In another embodiment one or more of the sortase-anchored proteins, or one or more of the Streptococcus uberis proteins, is not SUB0337.

An immunogenic part of a protein refers to a part of a larger protein which is capable of eliciting an immune response. Preferably the immune response elicited will recognise the part of the protein and the whole protein. Preferably the immunogenic part includes at least one epitope from the full length protein.

An immunogenic composition is a composition that is capable of eliciting an immune response to an antigen in the composition when the composition is administered to a subject. Preferably the immune response elicited is protective. Preferably the subject is a mammal, more preferably a ruminant, such as a cow, sheep or goat. The antigen in the immunogenic composition of the invention may be one or more proteins which are anchored to the surface of Streptococcus uberis by the enzyme sortase.

Preferably the immune response elicited by a composition of the invention is directed to the antigen in the composition and acts to prevent or reduce infection by Streptococcus uberis in a subject to whom the immunogenic composition has been administered. The immune response may recognise and destroy Streptococcus uberis. Alternatively, or additionally, the immune response elicited may impede or prevent replication of Streptococcus uberis. Alternatively, or additionally, the immune response elicited may impede or prevent Streptococcus uberis causing disease, such as mastitis, in the subject. Preferably, the immune response elicited by the composition is also capable of being directed to strains of Streptococcus uberis other than that from which the proteins in the composition are derived.

The immune response generated may be a cellular and/or antibody-mediated immune response. Usually, an immune response includes, but is not limited to, one or more of the following effects, the production of antibodies, B cells, helper T cells, suppressor T cells and/or cytotoxic T cells, directed to the one or more immunogenic proteins in the composition.

The composition may also comprise a further one or more antigens, in addition to one or more S. uberis sortase-anchored proteins, or one or more S. uberis proteins. The further antigens may also be capable of eliciting an immune response directed to the pathogenic organism from which they are derived. The further antigens may be derived from S. uberis or they may be derived from a different pathogenic organism.

The composition may be used to elicit/produce a protective immune response when administered to a subject. The protective immune response may cause S. uberis to be killed upon infecting a subject, or it may prevent or inhibit S. uberis from replicating and/or from causing disease in a subject.

The composition may be used as a prophylactic or a therapeutic vaccine against S. uberis

According to a further aspect, the invention provides a pharmaceutical composition comprising one or more S. uberis sortase-anchored proteins, or one or more S. uberis proteins, or part thereof, in combination with a pharmaceutically acceptable carrier or excipient.

Preferably the pharmaceutical composition comprises a composition according to any aspect of the invention.

Preferably the pharmaceutical composition is capable of producing a protective immune response to S. uberis.

The phrase “producing a protective immune response” as used herein means that the composition is capable of generating a protective response in a host organism, such as a cow, to whom it is administered. Preferably a protective immune response protects against subsequent infection by S. uberis. The protective immune response may eliminate or reduce the level of infection by reducing replication of S. uberis by affecting the mode of action of S. uberis. Preferably the protective immune response reduces or prevents disease caused by S. uberis.

Suitable acceptable excipients and carriers for use in a pharmaceutical composition will be well known to those skilled in the art. These may include solid or liquid carriers. Suitable liquid carriers include water and saline. The proteins of the composition may be formulated into an emulsion or they may be formulated into biodegradable microspheres or liposomes.

The composition may further comprise an adjuvant. Suitable adjuvants will be well known to those skilled in the art, and may include Freund\'s Incomplete Adjuvant (for use in animals), and metal salts, such as aluminium or calcium salts,

The composition may also comprise polymers or other agents to control the consistency of the composition, and/or to control the release of the proteins from the composition.

The composition may also comprise other agents such as diluents, which may include water; saline; glycerol or other suitable alcohols etc; wetting or emulsifying agents; buffering agents; thickening agents for example cellulose or cellulose derivatives; preservatives; detergents, antimicrobial agents; and the like.

Preferably the active ingredients in the composition are greater than 50% pure, usually greater than 80% pure, often greater than 90% pure and more preferably greater than 95%, 98% or 99% pure. With active ingredients approaching 100% pure, for example about 99.5% pure or about 99.9% pure, being used most often.

The composition of the present invention may be used as vaccine against infections caused by S. uberis. The vaccine may be administered prophylactically to animals at risk of exposure to S. uberis, and/or therapeutically to animals who have already been exposed to S. uberis.

Preferably, if the composition is used as a vaccine, the composition comprises an immunologically effective amount of antigen (comprised of S. uberis proteins). An “immunologically effective amount” of an antigen is an amount that when administered to an individual, either in a single dose or in a series of doses, is effective for treatment or prevention of infection by S. uberis. This amount will vary depending upon the health and physical condition of the individual to be treated and on the antigen. It is expected that the amount will fall in a relatively broad range that can be determined by routine trials.

The route of administration of the composition may vary depending on the formulation of the proteins in the composition. The composition may be arranged to be administered intramuscularly, intradermally, subcutaneously, intraperitonealy, intravenously or intramammaryl). Alternatively the composition may be arranged to be administered parenterally, such as by intranasal, oral, buccal, inhalation, epidermal, transcutaneous, topical, vaginal or rectal administration.

The composition may be arranged to be administered as a single dose or as part of a multiple dose schedule. Multiple doses may be administered as a primary immunisation followed by one or more booster immunisations. Suitable timing between priming and boosting immunisations can be routinely determined.

Compositions of the invention may be able to induce a serum bactericidal antibody response after being administered to a subject. These responses are conveniently measured in mice and the results are a standard indicator of vaccine efficacy.

The compositions of the invention may also, or alternatively, be able to elicit an immune response which effects proteins on the host cells to defend against infection by S. uberis, without necessarily destroying the bacteria.

According to a further aspect, the present invention provides the use of one or more S. uberis sortase-anchored proteins in the preparation of a medicament for eliciting an immune response. The medicament may be used for the prophylactic or therapeutic vaccination of subjects against S. uberis. The medicament may be a prophylactic or a therapeutic vaccine.

According a still further aspect, the present invention provides a method of protecting a human or non-human animal, preferably a cow, from the effects of infection by S. uberis comprising administering to the human or non-human animal a composition according to any other aspect of the invention.

According to another aspect, the invention provides a method for raising an immune response in a human or non-human animal, preferably a cow, comprising administering a composition according to the invention to the human or non-human animal. The immune response is preferably protective. The method may raise a booster response in a subject that has already been primed. The immune response may be prophylactic or therapeutic.

The uses, methods and compositions of the invention are preferably for the prevention and/or treatment of a disease caused by S. uberis.

The skilled man will appreciate that any of the preferable features discussed above can be applied to any of the aspects of the invention.

Preferred embodiments of the present invention will now be described, merely by way of example, with reference to the following figures and examples.

FIGS. 1A, B and C—show the results of bacterial isolation, somatic cell count and clinical response following challenge with wild type S. uberis 0140J and a S. uberis Srt mutant in dairy cattle. FIG. 1(A) shows the bacterial recovery of S. uberis following challenge. Data are represented as the geometric means of the number of bacteria obtained from the milk of animals challenged with either strain 0140J (squares; n=4) or the SrtA mutant (triangles; n=8). FIG. 1 (B) illustrates the inflammatory response following challenge with wild type and Srt mutant of S. uberis. Data are represented by the geometric means of the number of somatic cells obtained from the milk of animals challenged with either strain 0140J (squares; n=4) or the SrtA mutant (triangles; n=8). FIG. 1(C) illustrates the combined clinical scores from clinical manifestations following challenge with wild type and Srt mutant of S. uberis. Data are represented by the mean of clinical scores given for the appearance of the quarter and appearance of the milk, as outlined in FIG. 2 with either strain 0140J (squares; n=4) or the SrtA mutant (triangles; n=8);

FIG. 2—illustrates in tabular form the manifestation of a clinical response to infection with Streptococcus uberis. All quarters and milk samples were analyzed against these criteria at each milking following challenge;

FIG. 3—illustrates in tabular form the proteins found by bioinformatic examination of the S. uberis genome that were likely to be anchored by sortase; The genome of S. uberis was searched using the LPXXG motif for putative sortase-anchored proteins. The list of proteins identified was refined by using context and position of the motif, ie LPXXG toward the C-terminus and followed by a hydrophobic region and charged residues at a C-terminal position and the presence of a recognisable secretion signal peptide at the N-terminus;

FIG. 4A: lists sortase anchored proteins identified in cell wall extracts of S. uberis 0140J cultured in THB media. a Gene and protein annotation according to the genomic sequence of Streptococcus uberis 0140J (Ward et al 2009); b Theoretical molecular mass values for protein precursors obtained from Artemis database from the Wellcome Trust Sanger Institute (http://www.sanger.ac.uk/); c Number of unique peptide hits for each protein; d Percentage of protein sequence covered by experimentally detected peptides; e 2 peptides identified in the SrtA mutant cell wall fraction. FIG. 4B: lists sortase anchored proteins identified in cell wall extracts of S. uberis 0140J cultured in BHI media. a Gene and protein annotation according to the genomic sequence of Streptococcus uberis 0140J (Ward et al 2009); b Theoretical molecular mass values for protein precursors obtained from Artemis database from the Wellcome Trust Sanger Institute (http://www.sanger.ac.uk/); c Number of unique peptide hits for each protein; d Percentage of protein sequence covered by experimentally detected peptides; e 4 peptides identified in the SrtA mutant cell wall fraction;

FIGS. 5A and 5B—shows the identification of Sub1154 and Sub 1370 from extracts of Streptococcus uberis 0140J and srtA mutant. FIG. 5A—rabbit antiserum to Sub1154 was used to probe immunoblots blots of protein detergent extracts from 0140J (lane 2) and SrtA mutant (lane 3), concentrated, precipitated media from 0140J (lane 4), SrtA mutant (lane 5) and Sub1154 mutant (lane 6). Molecular weight standards are shown in lane 1. FIG. 5B-rabbit antiserum to Sub1370 was used to probe immunoblots blots of protein detergent extracts from 0140J (lane 1) and SrtA mutant (lane 2), concentrated, precipitated media from 0140J (lane 3), SrtA mutant (lane 4) and Sub1370 mutant (lane 5). Molecular weight standards are shown in lane 6;

FIGS. 6A to 6O—are the amino acid sequences of S. uberis sortase anchored proteins;

FIG. 6A is the sequence of SUB1370 (Seq ID No: 1) a zinc carboxypeptidase;

FIG. 6B is the sequence of SUB0145 (Seq ID No: 2) a Lactoferrin binding protein;

FIG. 6C is the sequence of SUB0135 (Seq ID No: 3) a frucan beta fructosidase precursor;

FIG. 6D is the sequence of SUB1730 (Seq ID No: 4);

FIG. 6E is the sequence of SUB0888 (Seq ID No: 5);

FIG. 6F is the sequence of SUB0207 (Seq ID No: 6);

FIG. 6G is the sequence of SUB1154 (Seq ID No: 7) a subtilin like serine protease;

FIG. 6H is the sequence of SUB1095 (Seq ID No: 8) a collagen like protein;

FIG. 6I is the sequence of SUB0826 (Seq ID No: 9) a putative surface anchored subtilase;

FIG. 6J is the sequence of SUB0164 (Seq ID No: 10) a putative truncated surface anchored fibronectin binding protein (but is encoded by a probable pseudogene);

FIG. 6K is the sequence of SUB0348 (Seq ID No: 11) a remnant of a putative collagen like protein (but is encoded by a pseudogene);

FIG. 6L is the sequence of SUB1739 (Seq ID No: 12) a putative surface anchored protein (but is encoded by a pseudogene);

FIG. 6M is the sequence of SUB0206 (Seq ID No: 13) a putative exported protein of unknown function;

FIG. 6N is the sequence of SUB0241 (Seq ID No: 14) a putative surface anchored protein of unknown function;

FIG. 6O is the sequence of SUB0337 (Seq ID No: 15) a putative surface located glutamine binding protein;

FIG. 7 shows the bacterial colonisation following challenge with wild type (0140J) and attenuated mutant strains lacking sub0145, sub1095 or sub1154. Data is expressed as geometric means of Log10 cfu/ml detected in milk samples obtained at each milking after experimental challenge.

The data presented below demonstrates that proteins anchored to the surface of S. uberis by sortase, a transamidase, are important in virulence and further describes some such proteins (eg sub1095, sub1154 and sub0145) are essential for virulence, and thus are required to be functional in order for this bacterium to cause disease. Proteins are good immunogens. Immune responses to these proteins in the form of antibodies is likely to ablate their function, thus the identified protein would be useful inclusions within immunogenic compositions intended to reduce or prevent infection or diseases caused by S. uberis.

Streptococcus uberis strain 0140J, originally isolated from a clinical case of bovine mastitis in the UK, was used throughout this study. The bacterium was routinely grown in Todd Hewitt or Brain Heart Infusion broth.

Skimmed milk was produced from raw bovine milk collected aseptically from several cows from within the dairy herd at the Institute for Animal Health. Milk was collected from animals that were free of intramammary infection. Following centrifugation (3,000×g, 10 min); skimmed milk was removed carefully from the upper fat-layer and the pellet of sedimented cells. The sterility of the skimmed milk was determined by plating 500 μl of milk directly onto blood agar containing aesculin (1.0%, w/v; ABA) and by enrichment culture of 5 ml of milk in and equal volume of Todd Hewitt broth followed by isolation of single colonies on ABA. In both cases, plates were incubated at 37° C. for 18 h. Skimmed milk was stored at 4° C. and used within 72 h.

Other bacterial strains and reagents were used as described in the text.

Isolation of srtA-Mutant by Genotypic Selection.

The srtA (Sub0881) mutant was isolated following PCR screening of a S. uberis 0140J pGhost9::ISS1 mutant bank following a similar protocol to that described previously (Taylor, D. L. et al, 2003. J Bacteriol 185:5210-5219; Ward, P. N. et al 2001 Infect Immun 69:392-399). Briefly, overnight cultures from individual 96-well plates were pooled and genomic DNA was prepared for use as template in PCR amplification reactions containing a locus-specific primer, P261 (srtA) and an ISS1-specific primer, P247 or P250. Amplification was conducted using thirty-five cycles (95° C. for 20 s, 54° C. for 1 min, and 72° C. for 3 min) and was performed with AmpliTaq Gold master mix (ABI). The products were visualized following gel electrophoresis, staining with ethidium bromide and transillumination with UV light. Following plate identification, a well location was similarly identified using genomic DNA pooled from the columns and rows of the target plate. Following isolation of the mutant clone, excision of the plasmid vector was promoted by growth at the permissive temperature (28° C.) without antibiotic selection. Loss of the pGhost9 vector and retention of ISS1 were confirmed by Southern blotting as described previously (Ward, P. N. et al 2001 Infect Immun 69:392-399). Presence of the insertion in srtA was confirmed by PCR amplification of the open reading frame and sequencing of the resulting product across the junction between ISS1 and the disrupted ORF. The PCR primers used are as shown in Table 1 below:

TABLE 1 PCR primers. P247 ISS1 fwd (SEQ ID NO: 16); P250 ISS1 rev (SEQ ID NO: 17); P261 (SEQ ID NO: 18); P409 (SEQ ID NO: 19); P410 (SEQ ID NO: 20); P615 (SEQ ID NO: 21); P630 (SEQ ID NO: 22); P480 (SEQ ID NO: 23); P481 (SEQ ID NO: 24); P621 (SEQ ID NO: 25). Sequence Annealing Designation (5′-3′) Application Template temp (° C.) P247 ISS1 GCTCTTCGGATTTTCGGTATC ISS1 probe pGh9::ISS1 58 fwd P250 ISS1 CATTTTCCACGAATAGAAGGACTGTC ISS1 probe pGh9::ISS1 61 rev P261 TGGTTGAAGCAGAAGCTGAA Screening pGh9::ISS1 55 for ISS1 within srtA ORF vs P247 P409 GAGCAATTGCAAAATGAAAAGC Amplification S. uberis 58 of Sub1154 0140J ORF genomic DNA

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Composition comprising sortase anchored surface proteins of streptococcus uberis patent application.
###


Other recent patent applications listed under the agent The University Of Nottingham: