Inhibition of syk kinase expression   

Abstract: The present invention relates, in general, to Syk kinase and, in particular, to a method of inhibiting Syk kinase expression using small interfering RNA (siRNA).

This application claims priority from Provisional Application No. 60/484,299, filed Jul. 3, 2003, the entire contents of which are incorporated herein by reference.

TECHNICAL FIELD

The present invention relates, in general, to Syk kinase and, in particular, to a method of inhibiting Syk kinase expression using small interfering RNA (siRNA).

Double stranded RNA has been shown to be a powerful agent for interfering with gene expression in a number of organisms, including C. elegans and Drosophila, as well as plants (Bernstein et al, RNA 7:1509-2151 (2001), McManus et al, Nat. Rev. Genet. 3:737-747 (2992), Hutvagner et al, Curr. Opin. Genet. Dev. 12:225-232 (2002), Zamore, Nat. Struct. Biol. 8:746-750 (2001) Tuschl et al, Genes Dev. 13:3191-3197 (1999)). Early problems in silencing mammalian genes with double stranded RNA arose because the mammalian immune system destroys cells that contain double stranded RNA, through mechanisms such as the interferon response, evolved as defense against invading RNA viruses (Clarke et al, RNA 1:7-20 (1995)). It has been demonstrated, however, that very short RNA fragments (e.g., 20-23nt in length), designated small interfering RNA (siRNA), are able to escape the immune response. Thus introduced siRNAs can function well as gene silencing agents in mammalian cells (Elbashir et al, Nature 411:494-498 (2001), Elbashir et al, Genes Dev. 15:188-200 (2001), Paddison et al, Genes Dev. 16:948-958 (2002), Wianny et al, Nat. Cell Biol. 2:70-75 (2000)).

As it is presently understood, RNAi involves a multi-step process. Double stranded RNAs are cleaved by the endonuclease Dicer to generate 21-23 nucleotide fragments (siRNA). The siRNA duplex is resolved into 2 single stranded RNAs, one strand being incorporated into a protein-containing complex where it functions as guide RNA to direct cleavage of the target RNA (Schwarz et al, Mol. Cell. 10:537-548 (2002), Zamore et al, Cell 101:25-33 (2000)), thus silencing a specific genetic message (see also Zeng et al, Proc. Natl. Acad. Sci. 100:9779 (2003)).

Anti-sense DNA has also been widely used to inhibit gene expression (Roth et al, Annu. Rev. Biomed. Eng. 1:265-297 (1999)). Once inside the cell, anti-sense oligonucleotides (ASO) recognize, then bind tightly to complementary mRNA, thus preventing the mRNA from interacting with the protein translation machinery of the cell.

It has been demonstrated that inhibition of Syk kinase expression by Syk kinase mRNA ASO dramatically diminishes Fcγ receptor signaling (Matsuda et al, Molec. Biol. of the Cell 7:1095-1106 (1996)), and that Syk kinase mRNA ASO introduced by aerosol into rat lungs protects against Fcγ receptor-induced lung inflammation (Stenton et al, J. Immunol. 169:1028-1036 (2002)).

At least in certain systems, siRNA is more potent and reliable than ASO as an inhibitor of gene expression. The present invention results from studies designed to test the efficacy of siRNA as an inhibitor of Syk kinase expression.

SUMMARY

The present invention relates generally to Syk kinase. In a preferred embodiment, the invention relates to a method of inhibiting Syk kinase expression using small interfering RNA (siRNA) and to therapeutic strategies based on such a method.

Objects and advantages of the present invention will be clear from the description that follows.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. The sense strand of each Syk kinase siRNA is the same sequence as the target sequence with the exception of the initial template adenine dimer and terminal overhang thymidine dimer. The antisense strand of the siRNA is the reverse complement of the target sequence.

FIG. 2. Expression of Syk kinase in RBL-2H3 cells transfected with siRNA targeted to Syk kinase mRNA. RBL-2H3 cells were transfected with siRNA-1 (Lane 2), siRNA-2 (lane 3) or lipofectamine transfection control (Lane 1). Proteins in cell lysates were separated by SDS-PAGE and transferred to nitrocellulose. Top panel, Syk kinase immunoblot; bottom panel, actin immunoblot.

FIG. 3. Expression of Syk kinase in human monocytes transfected with siRNA targeted to Syk kinase mRNA. Monocytes were treated with siRNA (Lane 2) or lipofectamine transfection control (Lane 1). Proteins in cell lysates were separated by SDS-PAGE, transferred to nitrocellulose and immunoblotted with anti-Syk kinase antibody.

FIG. 4. Western blot analysis: Syk protein expression in HS-24 cells.

FIGS. 5A and 5B. (FIG. 5A) HS-24 cells, following siRNA treatment, were lysed and equal amounts of total protein in HS-24 cell lysates were resolved by 10% SDS gel electrophoresis, and analyzed by Western blot using monoclonal antibody to Syk or actin. Lane 1—no treatment, lane 2—siRNA-1 (control) 24 h treatment, lane 3—siRNA-1 48 h treatment, lane 4—siRNA-2 24 h treatment, lane 5—siRNA-2 48 h treatment. (FIG. 5B) RNA was isolated and RT-PCR was performed for Syk and β-actin. Lane. 1—no treatment, lane 2—siRNA-1 (control) 48 h treatment, lane 3—siRNA-2 48 h treatment.

FIGS. 6A and 6B. HS-24 cells plated on either polylysine coated plates (non stimulated, resting) or fibronectin coated plates (stimulated) were treated with siRNA-2, or siRNA-1 (control), or piceatannol. Cells were treated with 10 ng/ml of TNF during overnight culture. (FIG. 6A) Following siRNA (48 h) or piceatannol (16 h) treatment, cells were removed, immunostained with anti-CD54 (ICAM-1) and analysed by flow cytometry. (FIG. 6B) Cell culture supernatants were analysed for IL-6 release using an IL-6 ELISA kit. *P<0.05, **P<0.005 as compared to untreated cells (e.g., untreated with siRNA) stimulated with TNF. Results are representative of three to five independent. experiments. The data indicate that inhibition of Syk expression by siRNA-2 down-regulates TNF-induced ICAM-1 expression and IL-6 release, important in the inflammatory response.

FIGS. 7A and 7B. Effect of siRNA targeted to Syk kinase delivered via aerosol on total cell numbers in bronchoalveolar lavage (BAL) fluid of ovalbumin (OA) sensitized and challenged Brown Norway Rats after three treatments. (FIG. 7A provides data as bar graphs, FIG. 7B shows individual data points (individual animals).

FIGS. 8A-8D. Effect of siRNA targeted to Syk kinase delivered via aerosol on numbers of macrophages, neutrophils, lymphocytes and eosinophils in BAL fluid of OA sensitized and challenged Brown Norway rats after three treatments. (FIG. 8A provides data as bar graphs, FIG. 8B shows individual data points (individual animals) for macrophage numbers, FIG. 8C shows individual data points for neutrophil numbers, and FIG. 8D shows individual data points for eosinophil numbers.)

DETAILED DESCRIPTION

The present invention relates to RNA molecules that target Syk kinase mRNA. For example, the invention relates to RNA molecules about 19, 20 or 21 to about 23 nucleotides in length that direct cleavage and/or degradation of Syk kinase mRNA.

In a preferred embodiment, the present invention relates to the use of siRNA molecules, double stranded RNA molecules typically comprising two 20-23 nucleotide (nt) strands. SiRNAs suitable for use in the invention can be produced using any of a variety of approaches. The siRNA can be prepared in vitro and then introduced directly into cells (for example, by transfection). Alternatively, intracellular expression can be effected by transfecting into cells constructs (e.g., DNA-based vectors or cassettes) that express siRNA within cells.

More specifically, siRNA suitable for use in the invention can be prepared, for example, via chemical synthesis, in vitro transcription, enzymatic digestion of a longer dsRNA using an RNase III enzyme such as Dicer or RNase III, expression in cells from an siRNA expression plasmid or viral vector, or expression in cells from a PCR-derived siRNA expression cassette. Detailed descriptions of these various approaches are readily available and can be found, for example, at http://www.ambion.com/techlib/tn/103/2.html, www.bdbiosciences.com, www.oligoengine.com, www.genetherapysystems.com, www.dharmacon.com, http://www.mpibpc.gwdg.de/abteilungen/100/105/sirna.html, and/or in the references cited therein (which references are also incorporated herein by reference). (See also Sui et al, Proc Natl Acad Sci USA 99: 5515-20 (2002), Brummelkamp et al, Science 296:550-3 (2002), Paul et al, Nature Biotechnology 20:505-8 (2002), Lee et al, Nature Biotechnology 20: 500-5 (2002), Castanotto et al, RNA 8: 1454-60 (2002) and US Appln. 20030108923.)

Various approaches are available to enhance stability of RNA of the invention, (see, for example, U.S. Application Nos. 20020086356, 20020177570 and 20020055162, and U.S. Pat. Nos. 6,197,944, 6,590,093, 6,399,307, 6,057,134, 5,939,262, and 5,256,555, and references cited therein).

As indicated above, siRNA suitable for use in the invention can be prepared chemically. Advantageously, 2′ hydroxyls are protected during the synthetic process against degradation using, for example, acid labile orthoester protecting groups (see Scaringe et al, J. Am. Chem. Soc. 120:11820 (1998) and www.dharmacon.com (e.g., the ACE technology described therein)). The RNA oligomers can be simultaneously 2′ deprotected and annealed prior to use.

In chemically synthesized siRNA, at least one strand of the double stranded molecule can have a 3′ overhang from about 1 to about 6 nucleotides (e.g., pyrimidine and/or purine nucleotides) in length. Preferably, the 3′ overhang is from about 1 to about 5 nucleotides (e.g., thymidines or uridines), more preferably from about 1 to about 4 nucleotides and most preferably 2 or 3 nucleotides in length. Advantageously, each strand has an overhang. The length of the overhangs can be the same or different for each strand. Typically, both strands have overhangs of the same length. In a particular embodiment, the RNA of the present invention comprises 21 or 22 nucleotide strands that are paired and that have overhangs of from about 1 to about 3, particularly, about 2, nucleotides on the 3′ ends of both of the RNA strands.

As indicated above, siRNAs suitable for use in the invention can be prepared by enzymatic digestion of a longer dsRNA using an RNase III type enzyme (e.g., Dicer). (See references and web sites cited above.) For example, a commercially available Dicer siRNA generation kit can be used that permits generation of large numbers of siRNAs from full length target genes (Gene Therapy Systems, Inc, MV062603). SiRNA can be produced from target DNA and T7 RNA polymerase promoter sequences using PCR based cloning. Following RNA transcription from the target sequence, recombinant Dicer can cleave the transcribed RNAi into 22 by siRNAs.

Also as indicated above, siRNA molecules suitable for use in the present invention can also be recombinantly produced using methods known in the art. (See references and web sites cited above.) Recombinant technology permits in vivo transcription of siRNAs in mammalian cell. In accordance with this approach, vectors can be used that contain, for example, RNA polymerase III or U6 promoter sequences. Such vectors (including viral vectors and plasmid vectors (such as pSIREN)) can be used as expression vectors or as shuttle vectors in conjunction with viral systems (e.g., adenoviral or retroviral systems) to introduce siRNA into mammalian cells. Vectors can be engineered to express sense and anti-sense strands of siRNAs that anneal in vivo to produce functional siRNAs. Alternatively, hairpin RNA can be expressed by inserting into a vector the sense strand (e.g., about 20 nt) of the target, followed by a short spacer (e.g., about 4 to about 10 nt), then the antisense strand of the target (e.g., about 20 nt) and, for example, about 5-6 T\'s as transcription terminator. The resulting RNA transcript folds back to form a stem-loop structure comprising, for example, about a 20 by stem and about a 10 nt loop with 2-3 U\'s at the 3′ end. (See also Paddison et al (Proc. Natl. Acad. Sci. 99:1443-1448 (2002).) Constructs suitable for use in effecting in vivo production (including selection of vectors and promoters) can be readily designed by one skilled in the art and will vary, for example, with the cell/tissue target and the effect sought.

dsRNA can be used in the methods of the present invention provided it has sufficient homology to the targeted Syk kinase mRNA. SiRNA duplexes can be designed, for example, by searching Syk kinase cDNA for the target motif “AA(N)19”, wherein N is any nucleotide, motifs with approximately 30% to 70% G/C content being preferred, those of about 50% G/C content being more preferred. The sense strand of the siRNA duplex can correspond to nucleotides 3 to 21 of the selected AA(N)19 motif. The antisense strand of the siRNA duplex can have a sequence complementary to nucleotides 1 to 21 of the selected AA(N)19 motif. Further design details are provided at http://www.mpibpc.gwdg.de/abteilungen/100/105/sirna.html.

Preferred target sequences include sequences unique to. Syk kinase mRNA. For example, target sequences can be selected from sequences between the two SH2 domains of Syk kinase or between the second SH2 domain and the kinase domain. Certain specific DNA target sequences are described in the non-limiting Examples that follow. Additional targets include, but are not limited to, the following:

*Sequence % GC Identified homologies of 16-18/19 nucleotides AATATGTGAAGCAGACATGGA 42 mitochondrial ribosomal prot15 AATCAAATCATACTCCTTCCC 42 AAGAGAGTACTGTGTCATTCA 42 AAGGAAAACCTCATCAGGGAA 47 inositolhexaphosphate kinase, β globin on Chr11 AATCATACTCCTTCCCAAAGC 47 AATTTTGGAGGCCGTCCACAA 53 oxytokinase AAGACTGGGCCCTTTGAGGAT 58 AAGCAGACATGGAACCTGCAG 58 histamine receptor H3, GTP binding protein AACTTCCAGGTTCCCATCCTG 58 AAGCCTGGCCACAGAAAGTCC 63 AAGCCCTACCCATGGACACAG 63 AACCTGCAGGGTCAGGCTCTG 68 AAGGGGTGCAGCCCAAGACTG 68 γ glutamyl transferase, rb prot L27a AACTTGCACCCTGGGCTGCAG 68 calcium channel α1E subunit AAGTCCTCCCCTGCCCAAGGG 74 NADH; ubiquinone oxidoreductase MLRQ subunit AAGGCCCCCAGAGAGAAGCCC 74 AATCTCAAGAATCAAATCATA 26 AATGTTAATTTTGGAGGCCGT 42 AATCCGTATGAGCCAGAACTT 47 AATCGGCACACAGGGAAATGT 53 AACCGGCAAGAGAGTACTGTG 58 AAGGAGGTTTACCTGGACCGA 58

The siRNAs described herein can be used in a variety of ways. For example, the siRNA molecules can be used to target Syk kinase mRNA in a cell or organism. In a specific embodiment, the siRNA can be introduced into human cells or a human in order to mediate RNAi in the cells or in cells in the individual, so as to prevent or treat a disease or undesirable condition associated with Syk kinase expression (e.g., inflammation of the lungs, joints eyes or bladder). The siRNA can also be used in the treatment of the immune destruction of blood cells, e.g., red blood cells in autoimmune hemolytic anemia and platelets in immune thrombocytopenic purpurea (ITP) (e.g., by targeting Syk kinase mRNA in macrophages and spleen and liver cells). In accordance with the instant method, the Syk kinase gene is targeted and the corresponding mRNA (the transcriptional product of the targeted Syk kinase gene) is degraded by RNAi. When lung cells are the target, an siRNA-containing composition can be aerosolized and administered, for example, via inhalation. Administration to joints can be effected by injection of an siRNA-containing solution. Administration to the eyes can be effected, for example, by injection or by application of drops comprising the siRNA in a carrier. Administration to the bladder, etc. can be effected, for example, by washing or irrigating the target tissue with a composition containing the siRNA. Administration to the skin can be via topical administration (e.g., as a liquid, cream or gel).

In accordance with the invention, cells of an individual (e.g., blood mononuclear cells, basophiles or mast cells) can be treated ex vivo so as to effect degradation of the Syk kinase mRNA. The cells to be treated can be obtained from the individual using known methods and the siRNAs that mediate degradation of the corresponding Syk kinase mRNA can be introduced into the cells, which can then be re-introduced into the individual.

In a specific embodiment, the invention relates to the use of the above-described siRNAs to inhibit mediator (e.g., histamine) release from cells bearing an FcE receptor, such as mast cells. Inhibition of histamine (a mast cell mediator) release, for example, is of therapeutic importance in the treatment of asthma.

The siRNAs (or constructs suitable for use in effecting intracellular production of siRNA) of the invention can be administered systemically (e.g., via IV) or directly to the target tissue (e.g., via aerosol administration to the lung). Delivery can be effected using the techniques described herein (including liposome formulations). In addition to liposome formulations, polymer formulations can be used. Polyethylenimine (PEI) is an example of a suitable cationic polymer. Varying sizes of PEI can be used, including linear 22 kDa and branched 25 kDa PEI (other sizes, modified and unmodified, as well as biodegradable versions can be used). Delivery can also be effected using, for example, non-toxic viral delivery systems (e.g., an adeno-associated viral delivery system). Optimum dosing will depend on the patient, the siRNA, the mode of administration, and the effect sought. Optimum conditions can be established by one skilled in the art without undue experimentation.

Certain aspects of the invention can be described in greater detail in the non-limiting Examples that follows. (See also US Applications 20030084471, 20030108923 and 20020086356.)