Chimeric receptor genes and cells transformed therewith   

Abstract: Chimeric receptor genes suitable for endowing lymphocytes with antibody-type specificity include a first gene segment encoding a single-chain Fv domain of a specific antibody and a second gene segment encoding all or part of the transmembrane and cytoplasmic domains, and optionally the extracellular domain, of an immune cell-triggering molecule. The chimeric receptor gene, when transfected to immune cells, expresses the antibody-recognition site and the immune cell-triggering moiety into one continuous chain. The transformed lymphocytes are useful in therapeutic treatment methods.

This application is a continuation in part of U.S. application Ser. No. 08/084,994 filed Jul. 2, 1993, which is herein incorporated by reference in toto.

FIELD OF THE INVENTION

The present invention relates to chimeric receptor genes suitable for endowing lymphocytes with antibody-type specificity, to expression vectors comprising said chimeric genes and to lymphocytes transformed with said expression vectors. Various types of lymphocyte cells are suitable, for example, cytotoxic T cells, helper T cells, natural killer (NK) cells, etc. The transformed lymphocytes are useful in therapeutic treatment methods.

BACKGROUND OF THE INVENTION

Cells of the immune system are known to recognize and interact with specific molecules by means of receptors or receptor complexes which, upon recognition or an interaction with such molecules, causes activation of the cell to perform various functions. An example of such a receptor is the antigen-specific T cell receptor complex (TCR/CD3).

The T cell receptor for antigen (TCR) is responsible for the recognition of antigen associated with the major histocompatibility complex (MHC). The TCR expressed on the surface of T cells is associated with an invariant structure, CD3. CD3 is assumed to be responsible for intracellular signalling following occupancy of the TCR by ligand.

The T cell receptor for antigen-CD3 complex (TCR/CD3) recognizes antigenic peptides that are presented to it by the proteins of the major histocompatibility complex (MHC). Complexes of MHC and peptide are expressed on the surface of antigen presenting cells and other T cell targets. Stimulation of the TCR/CD3 complex results in activation of the T cell and a consequent antigen-specific immune response. The TCR/CD3 complex plays a central role in the effector function and regulation of the immune system.

Two forms of T cell receptor for antigen are expressed on the surface of T cells. These contain either α/β heterodimers or γ/δ heterodimers. T cells are capable of rearranging the genes that encode the α, β, γ and δ chains of the T cell receptor. T cell receptor gene rearrangements are analogous to those that produce functional immunoglobulins in B cells and the presence of multiple variable and joining regions in the genome allows the generation of T cell receptors with a diverse range of binding specificities. Each α/β or γ/δ heterodimer is expressed on the surface of the T cell in association with four invariant peptides. These are the γ, δ and ε subunits of the CD3 complex and the zeta chain. The CD3 γ, δ and ε polypeptides are encoded by three members of the immunoglobulin supergene family and are found in a cluster on human chromosome 11 or murine chromosome 9. The zeta chain gene is found separately from other TCR and CD3 genes on chromosome 1 in both the mouse and human. Murine T cells are able to generate a receptor-associated η chain through alternative splicing of the zeta m-RNA transcript. The CD3 chains and the zeta subunit do not show variability, and are not involved directly in antigen recognition.

All the components of the T cell receptor are membrane proteins and consist of a leader sequence, externally-disposed N-terminal extracellular domains, a single membrane-spanning domain, and cytoplasmic tails. The α, β, γ and δ antigen-binding polypeptides are glycoproteins. The zeta chain has a relatively short ectodomain of only nine amino acids and a long cytoplasmic tail of approximately 110 amino acids. Most T cell receptor α/β heterodimers are covalently linked through disulphide bonds, but many γ δ receptors associate with one another non-covalently. The zeta chain quantitatively forms either disulphide-linked ζ-η heterodimers or zeta-zeta homodimers.

Another example of a type of receptor on cells of the immune system is the Fc receptor. The interaction of antibody-antigen complexes with cells of the immune system results in a wide array of responses, ranging from effector functions such as antibody-dependent cytotoxicity, mast cell degranulation, and phagocytosis to immunomodulatory signals such as regulating lymphocyte proliferation, phagocytosis and target cell lysis. All these interactions are initiated through the binding of the Fc domain of antibodies or immune complexes to specialized cell surface receptors on hematopoietic cells. It is now well established that the diversity of cellular responses triggered by antibodies and immune complexes results from the structural heterogeneity of Fc receptors (FcRs).

FcRs are defined by their specificity for immunoglobulin isotypes. Fc receptors for IgG are referred to as FcγR, for IgE as FcεR, for IgA as FcαR, etc. Structurally distinct receptors are distinguished by a Roman numeral, based on historical precedent. We now recognize three groups of FcγRs, designated FcγRI, FcγRII, and FcγRIII. Two groups of FcεR have been defined; these are referred to as FcεRI and FcεRII. Structurally related although distinct genes within a group are denoted by A, B, C. Finally, the protein subunit is given a Greek letter, such as FcγRIIIAα, FcγRIIIAγ.

Considerable progress has been made in the last three years in defining the heterogeneity for IgG and IgE Fc receptors (FcγR, FcεR) through their molecular cloning. Those studies make it apparent that Fc receptors share structurally related ligand binding domains, but differ in their transmembrane and intracellular domains which presumably mediate intracellular signalling. Thus, specific FcγRs on different cells mediate different cellular responses upon interaction with an immune complex. The structural analysis of the FcγRs and FcεRI has also revealed at least one common subunit among some of these receptors. This common subunit is the γ subunit, which is similar to the ζ or η chain of the TCR/CD3, and is involved in the signal transduction of the FcγRIII and FcεRI.

The low affinity receptor for IgG (FcγRIIIA), is composed of the ligand binding CD16α (FcγRIIIAα) polypeptide associated with the γ chain (FcγRIIIAγ). The CD16 polypeptide appears as membrane anchored form in polymorphonuclear cells and as transmembrane form (CD16TM) in NK. The FcγRIIIA serves as a triggering molecule for NK cells.

Another type of immune cell receptor is the IL-2 receptor. This receptor is composed of three chains, the α chain (p55), the γ chain (p75) and the γ chain. Whenl stimulated by IL-2, lymphocytes undergo proliferation and activation.

Antigen-specific effector lymphocytes, such as tumor specific T cells (Tc), are very rare, individual-specific, limited in their recognition spectrum and difficult to obtain against most malignancies. Antibodies, on the other hand, are readily obtainable, more easily derived, have wider spectrum and are not individual-specific. The major problem of applying specific antibodies for cancer immunotherapy, lies in the inability of sufficient amounts of monoclonal antibodies (mAb) to reach large areas within solid tumors\'. In practice, many clinical attempts to recruit the humoral or cellular arms of the immune system for passive anti-tumor immunotherapy have not fulfilled expectations. While it has been possible to obtain anti-tumor antibodies, their therapeutic use has been limited so far to blood-borne tumors (1, 2) primarily because solid tumors are inaccessible to sufficient amounts of antibodies (3). The use of effector lymphocytes in adoptive immunotherapy, although effective in selected solid tumors, suffers on the other hand, from a lack of specificity (such as in the case of lymphokine-activated killer cells (LAK cells) (4) which are mainly NK cells) or from the difficulty in recruiting tumor-infiltrating lymphocytes (TILs) and expanding such specific T cells for most malignancies (5). Yet, the observations that TILs can be obtained in melanoma and renal cell carcinoma tumors, that they can be effective in selected patients and that foreign genes can function in these cells (6) demonstrate the therapeutic potential embodied in these cells.

A strategy which has been recently developed (European Published Patent Application No. 0340793, Ref. 7-11) allows one to combine the advantage of the antibody\'s specificity with the homing, tissue penetration, cytokine production and target-cell destruction of T lymphocytes and to extend, by ex vivo genetic manipulations, the spectrum of anti-tumor specificity of T cells. In this approach the laboratory of the present inventors succeeded to functionally express in T cells chimeric T cell receptor (cTCR) genes composed of the variable region domain (Fv) of an antibody molecule and the constant region domain of the antigen-binding TCR chains, i.e., the α/β or γ/δ chains. In this gene-pairs approach, genomic expression vectors have been constructed containing the rearranged gene segments coding for the V region domains of the heavy (VH) and light (VL) chains of an anti-2,4,6-trinitrophenyl (TNP) antibody (Sp6) spliced to either one of the C-region gene segments of the α or β TCR chains. Following transfection into a cytotoxic T-cell hybridoma, expression of a functional TCR was detected. The chimeric TCR exhibited the idiotope of the Sp6 anti-TNP antibody and endowed the T cells with a major histocompatibility complex (MHC) nonrestricted response to the hapten TNP. The transfectants specifically killed TNP-bearing target cells, and produced interleukin-2 (IL-2) in response thereto across strain and species barriers. Moreover, such transfectants responded to immobilized TNP-protein conjugates, bypassing the need for cellular processing and presentation. The chimeric TCRs could provide T cells with an antibody-like specificity and, upon encountering antigen, were able to effectively transmit signals for T cell activation, secretion of lymphokines and specific target cell lysis in a MHC nonrestricted manner. Moreover, the cTCR bearing cells undergo stimulation by immobilized antigen, proving that receptor-mediated T-cell activation is not only nonrestricted but also independent of MHC expression on target cells (8, 9). New expression cassettes were also developed based on reverse transcription of mRNA and PCR amplification of rearranged VH and VL DNA, using primers based on 3′ and 5′ consensus sequences (12) of these genes which allow rapid construction of cTCR genes from any mAb-producing hybridoma. To determine the therapeutic potential of the chimeric TCR approach, we successfully constructed and functionally expressed cTCR genes composed of combining sites of anti-idiotypic antibody specific to the surface IgM of the 38C13 murine B lymphoma cell line.

Broad application of the cTCR approach is dependent on efficient expression of the cTCR genes in primary T cells. So far, utilizing protoplast fusion, lipofection or electroporation, we succeeded in expressing the cTCR in T cell hybridomas (8, 9) or human T cell tumors, such as Jurkat, but like others, achieved only limited and transient expression in non-transformed murine T cell lines. Although retroviral vectors have been demonstrated to be effective for transgene expression in human T cells (13, 14), due to the fact that two genes have to be introduced in order to express functional cTCR (CαVH+CβVL or CαVLαCβVH), and the very low efficiency of transduction of a single cell with two separate retroviral vectors, new vectors have to be tried which will allow the transduction of two genes in tandem (15).

Another strategy which has recently been developed employs joining of the extracellular ligand binding domain of receptors such as CD4, CD8, the IL-2 receptor, or CD16, to the cytoplasmic tail of either one of the γ/ζ family members (26-28, 38). It has been shown that crosslinking of such extracellular domains through a ligand or antibody results in T cell activation. Chimeric CD4 or CD16-γ/ζ molecules expressed in cytotoxic lymphocytes could direct specific cytolysis against appropriate target cells (26, 38). In PCT WO92/15322 it is suggested that the formation of chimeras consisting of the intracellular portion of T cell/Fc receptor ζ, ε or γ chains joined to the extracellular portion of a suitably engineered antibody molecule will allow the target recognition potential of an immune system cell to be specifically redirected to the antigen recognized by the extracellular antibody portion. However, while specific examples are present showing that such activation is possible when the extracellular portion of receptors such as the CD4 receptor are joined to such ζ, η or γ chains, no proof was presented that when a portion of an antibody is joined to such chains one can obtain expression in lymphocytes or activation of lymphocytes.

SUMMARY

It has now been found according to the present invention that by fusing a single-chain Fv domain (scFv) gene of a specific antibody, composed of VL linked to VH by a flexible linker, with a gene segment encoding a short extracellular and the entire transmembrane and cytoplasmic domains of a lymphocyte-activation molecule, a chimeric gene is obtained which combines the antibody recognition site and the lymphocyte-signalling moiety into one continuous chain. Upon transfection of such chimeric scFv-receptor (c-scFvR) gene into lymphocytes, it is expressed in the cell as a functional receptor and endows the cells with antibody-type specificity.

The present invention thus relates to chimeric genes suitable to endow lymphocyte cells with antibody-type specificity. Various types of lymphocytes are suitable, for example, natural killer cells, helper T cells, suppressor T cells, cytotoxic T cells, lymphokine activated cells, subtypes thereof and any other cell type which can express chimeric receptor chain.

The chimeric gene comprises a first gene segment encoding the scFv of a specific antibody, i.e., DNA sequences encoding the variable regions of the heavy and light chains (VH and VL, respectively) of the specific antibody, linked by a flexible linker, and a second gene segment which comprises a DNA sequence encoding partially or entirely the transmembrane and cytoplasmic, and optionally the extracellular, domains of a lymphocyte-triggering molecule corresponding to a lymphocyte receptor or part thereof.

The present invention further relates to suitable vectors for transfectinG cells of the type defined above with the chimeric gene.

The present invention further relates to cells of the type defined above into which such chimeric gene has been introduced so as to obtain its expression, and also to pharmaceutical prophylactic and curative compositions containing an effective quantity of such cells.

In general terms, the present invention relates to a process for the generation of lymphocytes transfected with an expression vector containing a chimeric gene of the invention. As set out in the following, there was constructed a model system which comprises an expression vector which was transfected into cytotoxic T cells and which was functionally expressed in said cells, i.e., which directed the cellular response of the lymphocyte against a predefined target antigen in a MHC nonrestricted manner.

The genetically engineered lymphocyte cells of the present invention may be used in new therapeutic treatment processes. For example, T cells or NK cells isolated from a patient may be transfected with DNA encoding a chimeric gene including the variable region of an antibody directed toward a specific antigen, and then returned to the patient so that the cellular response generated by such cells will be triggered by and directed toward the specific antigen in a MHC nonrestricted manner. In another embodiment, peripheral blood cells of the patient are genetically engineered according to the invention and then administered to the patient.

Because of the restrictions imposed by corecognition of self MHC plus antigen, the acquisition of new specificity by grafting of TCR genes is limited to inbred combinations. Such manipulations are practically impossible in an outbred population. However, the present invention allows us to confer antibody specificity using not only the TCR components, but other lymphocyte-signalling chains, such as the zeta/eta chains of CD3, γ chain of the FcγR and FcεR, α, β and γ ψ chains of the IL-2R or any other lymphokine receptor, CD16 α-chain, CD2, CD28, and others. Thus, grafting the chimeric genes into NK cells which are not antigen-specific will endow them with antibody specificity.

FIG. 1 depicts a scheme of the chimeric scFvR expression vector. R represents any receptor chain, such as the zeta subunit of the CD3, gamma and CD16α subunits of the FCγRIII, Cα and Cβ of the TCR, β chain of the IL-2 receptor or any other chain or part thereof described herein. A depicts the preparation of the gene segments encoding the scFv of the VH and VL of a specific antibody linked by a flexible linker (hatched box). B represents the pRSV expression vector containing the kappa light chain leader (Lκ), into which the receptor gene prepared from lymphocytes described in C and the gene segment of A are introduced. Expression of the chimeric gene is driven by the long terminal repeat (LTR) promoter of the Rous sarcoma virus.

FIG. 2 illustrates the chimeric pRSVscFvRγ expression vector obtained according to the scheme of FIG. 1. The boxes from left to right represent DNA segments corresponding to the Rous sarcoma virus long terminal repeat promoter (LTR), kappa light chain leader (Lκ) and variable region (Vκ), the linker (hatched box), heavy chain variable region (VH) the human gamma chain, the G418-resistance gene (neor) and the simian virus 40 origin of replication. Restriction sites indicated are EcoRI (RI), SnaBI (Sn), NcoI (N), XbaI (Xb), SalI (S), BstEII (Bs), and XhoI (X). The arrowheads numbered 1 to 6 represent the flanking regions amplified by using the oligonucleotide primers 4, 5, 6, 7, 14 and 15, respectively shown in Table I, infra.

These primers were designed to match the consensus sequences of VH and VL. The relevant restriction sites are in bold letters.

FIG. 3 shows the fluorescence-activated cell sorter (FACS) analysis of immunofluorescence staining of MD.45 hybridoma and its TCR α-MD45.27J mutant, their corresponding scFvRγ-transfected STA and STB clones, or STZ cells, which result from transfection of the scFvRζ chimeric gene into MD45.27J. Solid line, staining with anti-Sp6 idiotypic antibody 20.5 or anti-CD3 mAb 145.2C11. Broken line represents control irrelevant antibody.

FIGS. 4A-4D show immunoblotting analysis of lysates prepared from scFvRγ transfectants and parental hybridomas developed by anti-Sp6 idiotypic mAb 20.5 (FIGS. 4A and 4C, respectively) and rabbit anti-human gamma chain (FIGS. 4B and 4D, respectively). Electrophoresis was on four separate gels. The molecular mass scales are related to B and D; the arrows point to the same bands in A and B or C and D.

FIGS. 5A and 5B show the composition of the scFvRγ dimers. FIG. 5A-Immunoblot analysis of anti-Sp6 precipitates prepared from STB (scFvRγ transfectant cells), and their parent (MD45.27J hybridoma cells). After electrophoresis under non-reducing conditions and blotting, the blot was allowed to react with anti-Sp6, anti-human gamma, or anti-mouse ζ antibodies. FIG. 5B—Immunoprecipitation of lysates made of surface-iodinated STB cells (scFvRγ transfectant cells) and their parent (MD45.27J hybridoma cells).

FIGS. 6A-6B illustrates that transfectants expressing scFvR are stimulated to produce IL-2 after stimulation with TNP-A.20 (FIG. 6A), or plastic immobilized TNP-FγG, without or with different concentrations of soluble TNP-FγG (FIG. 6B). GTAc.20 is an Sp6 double-chain cTCR transfectant described previously (9). The scFvR zeta-expressing STZ produced about 200 units (U) of IL-2 per ml after co-culture with TNP-A.20 at 8:1 stimulator-to-effector (S/E) cell ratio. Not shown are the responses of the transfectants to non-modified A.20 or FγG controls, which were completely negative, exactly like the background responses of the MD.45 and MD45.27J to TNP antigen.

FIGS. 7A and 7B show specific 51Cr release of TNP-A.20 cells after incubation with transfectants expressing scFvR. Effector cells were incubated with plastic-immobilized TNP-FγG for 8 hr before the killing assay. Kinetic assay was done at an effector-to-target (E/T) cell ratio of 10:1 (FIG. 7A); dose response was determined in a 9 hr assay (FIG. 7B). Control non-modified A.20 target cells incubated with the same effector cells in identical conditions did not release more 51 Cr than the spontaneous release (not shown).

FIGS. 8A-8D show surface expression of chimeric scFvRγ/ζ. T cell hybridoma transfected with the scFvRγ (N29γ1, N29γ15) or scFvRζ (N29ζM.1) chimeric genes composed of the variable region of N29 anti-HER2 mAb, were stained with anti-N29 idiotypic antibodies or control serum (broken lines) and analyzed by FACS.

FIGS. 9A and 9B show binding of detergent-solubilized scFvN29Rγ and scFvN29Rζ to Neu/HER2 antigen. The presence of chimeric receptors in cell lysates was evaluated by ELISA using HER2X-coated wells and anti-γ (FIG. 9A) or anti-ζ (FIG. 9B) antibodies. Functional molecules derived from hybridomas expressing the chimeric transgenes could bind to the immobilized antigen and expressed antigenic determinants specific to either γ or ζ polypeptides.

FIGS. 10A and 10B shows antigen-specific activation of chimeric receptor expressing cells by HER2-bearing stimulator cells (FIG. 10A) or immobilized HER2X protein (FIG. 10B). T cell hybridomas expressing the chimeric scFvN29Rγ/ζ genes underwent antigen-specific, but MHC unrestricted stimulation for IL-2 production following co-culture with either HER2-expressing cells of different origins or with plastic-bound purified HER2/Neu receptor. Stimulator cells used were human breast carcinoma cell lines SKBR3 and MDA 468, the human ovarian carcinoma cell line SKOV3 or HER2, a c-erbB-2 transfected 3T3-NIH fibroblasts (kindly provided by Dr. A. Ullrich). The Neu/HER2 protein is overexpressed in SKBR3, SKOV3 and HER2, while the MDA 468 cells have undetectable surface receptor. As shown, untransfected parental cells MD45.27J did not produce any IL-2 following incubation with Neu/HER2 expressing cells. In B, [filled square]-MD45.27J, untransfected cells; O-N29γ1, transfectant expressing scFvN29Rγ.

FIG. 11 shows that chimeric receptor expressing cells specifically lyse Neu/HER2 target cells. Non-transfected CTL hybridomas and the scFvN29Rγ expressing (N29γ1) or the scFvN29ζ expressing (MD45ζ1) transfectants were studied for their cytolytic potential either toward Neu/HER2 expressing NIH-3T3 murine fibroblasts or the human colon (N87) or breast (SKBR3) carcinoma cell lines. The percent 51Cr released by the parental cells at the same E:T were subtracted.

FIG. 12 shows that chimeric receptor expressing cells specifically lyse HER2 target cells. Non-transfected CTL hybridomas and the scFvN29Rζ expressing (N29γ1) or the scFvN29Rζ expressing (N29ζ18) transfectants were studied for their cytolytic potential either toward Neu/HER2 expressing NIH-3T3 murine fibroblasts (filled symbols) or the non-transfected NIH-3T3 cells (open symbols). Substantial and specific lysis of HER2 target cells was demonstrated by N29γ1 at all effector to target (E:T) ratios. Weak lysis of HER2 as compared to the untransfected fibroblasts was observed for N29ζ18, while the MD45 and MD45.27J, non-transfected hybridomas did not cause any significant 51Cr release. [filled triangle], [empty triangle], −N29γ1; [filled circle]-N29ζ18; [filled square], [empty square]-MD45.27J.

FIG. 13 shows transfer of the scFvR gene from the pRSVneo-scFvR to the pBJ1-neo vector. The scFvR was cut out from the pRSV vector using the SnaBI and introduced into the EcoRV site of the polylinker of the pBJ1 plasmid to drive the expression of the chimeric gene from the SRα promoter.

FIGS. 14A-14E. FIG. 14A shows schematic representation of rosette formation by T cells expressing the anti-IgE scFvCβ chimeric gene. Sheep red blood cells (SRBC) were coated with TNP and then with anti-TNP of the IgE class. The IgE-TNP-SRBC-complex was incubated with the T cells transfected with the scFvR comprising the scFv of the anti-IgE 84-1c mAb, and observed under microscope for rosette formation. FIG. 14B shows results of the rosette formation on scFvR-transfected JRT.T3.5 cells. Parental JRT.T3.5 cells were used as negative and the 84.1c as positive controls. Results are given in percentage of cells that form rosettes. FIG. 14C shows inhibition of rosette formation of transfectants expressing scFvR. The transfectants were incubated with IgE, anti-Fc and anti-MYC, IgG (as negative control) and then with the SRBC-conjugate and counted. FIG. 14D shows rosette formation of the JSB.15 transfectant. FIG. 14E shows rosette formation of the MD.45 derived transfectants expressing the scFvR.MD.45 was used as negative control.

FIGS. 15A-15B. FIG. 15A shows schematic representation of the ELISA used to screen transfectants expressing scFvCβ chimeric gene (R is Cβ). Plates were covered with IgE and lysates of the transfectants were added, then anti-human α/β TCR antibodies were added and the reaction was developed with goat anti-mouse peroxidase. FIG. 15B shows results of some transfectants expressing the scFvR in the ELISA anti-human β TCR antibodies.

FIG. 16 shows stimulation of transfectants with immobilized IgE or anti-CD3 for IL-2 production. Plates were coated with 2.5 μg/ml of either IgE or anti-CD3 purified antibodies and transfectant cells were incubated in the presence of phorbol 12-mirystate 13-acetate (PMA), (10 ng/ml) for 20-24 hours. Supernatants were collected and IL-2 production was determined using the IL-2 dependent cell line CTLL. Untransfected JRT.T3.5 cell was used as negative control and controls for the different media were also included in the CTLL assay.

FIG. 17 shows stimulation for IL-2 production with IgE positive B cells. The SPE-7 IgE secretor hybridoma was fixed with 0.25% glutaraldehyde for 10 min. at 0° C. and mixed with the transfectants in different effector/stimulator (E/S) ratio. Cells were incubated for 20-24 hours and supernatants were collected and assayed for IL-2 production.

FIGS. 18A and 18B show specific inhibition of IgE production by cytotoxic hybridoma expressing the anti-IgE scFvR. Spleen cells were stimulated with 20 μg/ml LPS and 100 U/ml IL-4 for four days. At day 4 spleen cells were washed and MD.45 cytotoxic hybridoma expressing the scFv was added and IgE and IgG concentrations were measured after 24, 48 and 72 hours. 84.1c hybridoma cells were included as control as well as the MD.45.

FIG. 19 is a schematic representation of the chimeric scFv-CD16 gene.

FIGS. 20A-20D show surface staining of rat basophilic leukemia (RBL) cells transfected with the scFvCD16 gene. Immunofluorescence staining was performed with anti-Sp6 idiotypic mAb 20.5 and irrelevant mouse antibody as negative control. The shift to the right in the FACS staining pattern is due to chimeric receptor expressing cells.

FIGS. 21A-21D show surface staining of RBL cells transected with scFvRγ or scFvRζ chimeric genes. Immunofluorescence staining was performed with anti-Sp6 idiotypic mAb 20.5 and irrelevant mouse antibody as negative control.

FIGS. 22A and 22B show surface staining of murine thymoma BW5147 cells transfected with the scFvCD16 gene. Immunofluorescence staining was performed with anti-Sp6 idiotypic mAb 20.5 and irrelevant mouse antibody as negative control.

FIG. 23 shows stimulation of BW5147 cells co-transfected with scFvCD16 and normal γ chain by TNP-labeled A.20 target cells. BW-scFvCD16 clone 45 (A) or clone 50 (B) were co-cultured at different target: stimulation ratios with TNP modified irradiated A.20 cells. IL-2 produced into the supernatant was determined following 24 hours by the MTT assay.

FIGS. 24A and 24B show stimulation of BW5147 cells cotransfected with scFvCD16 and normal γ chain by immobilized TNP-Fowl γ-globulin (TNP-FγG). Different concentrations of TNP-FγG at different TNP:FγG ratios were used to coat the wells of a microculture plate. IL-2 was determined in the supernatant of 24 hr cultures of BW-scFvCD16 clone 5 (FIG. 24A) or clone 50 (FIG. 24B). Incubation of either one of the cells with immobilized FγG by itself (filled squares) did not stimulate the cells. The parental BW cells did not make any IL-2 in response to TNP-FγG under the same conditions (not shown).

FIGS. 25A-25D show surface staining of RBL cells transfected with the scFvIL2R gene. Immunofluorescence staining was performed with anti-Sp6 idiotypic mAb 20.5 and irrelevant mouse antibody as negative control.

FIGS. 26A-26D show that BW5147 cells transfected with scFvR express surface chimeric receptors. BW5147 cells transfected with Sp6-scFvR were reacted with 1:200 dilution of ascites of 20.5 anti-Sp6 idiotypic antibody or anti-MOv18 ascites in the same dilution as control, followed by FITC labeled anti-mouse Ig. Immunofluorescence was detected by FACS. BW.Sp6-CD16 are cells co-transfected with scFvCD16 and γ chain. Cells transfected with scFvCD16 alone did not stain above the untransfected BW cells.

FIG. 27 shows stimulation of scFvR-BW5147 transfectants with TNP-A.20 cells. Different BW-scFvR transfectants were incubated with various amounts of TNP-A.20 cells for 24 hrs. IL-2 was determined by the MTT colorimetric assay. BWG are scFvRγ transfectants and BWZ are scFvRζ transfectants.

FIG. 28 shows that scFvR transfected BW5147 cells respond to immobilized TNP. Different BW-scFvR transfectants were incubated with TNP15-FγG coated wells for 24 hrs. IL-2 was determined by the MTT colorimetric assay. The abscissa describes the concentrations of TNP-FγG used to coat the wells of a microtitre plate. BWG are scFvRζ transfectants and BWZ are scFvRζ transfectants.

DETAILED DESCRIPTION

To overcome the difficulties of the prior method involving the gene-pairs approach (the “T-body” approach) and to extend its applicability to other cells and receptor molecules, a new alternative design was developed according to the invention. It is based on a single-chain approach to the cTCR and on the demonstrated ability to express in bacteria an antibody single-chain Fv domain (scFv) (16, 17). Such scFv domains, which join the antibody\'s heavy and light variable (VH and VL) gene segments with a flexible linker, have proven to exhibit the same specificity and affinity as the natural Fab′ fragment. Thus, one immediate application of the scFv is to construct chimeric molecules composed of scFv linked to one of the TCR constant domains.

According to the invention, chimeric molecules were constructed composed of the scFv linked to receptor subunits that might serve to transduce the signal from the scFv and confer antibody specificity to T cells as well as other lymphocytes. This construction is preferably accomplished in the manner shown in FIG. 1 at A, DNA or RNA from antibody forming cells is isolated. cDNA is prepared from mRNA and amplification of the antibody light and heavy variable regions (VH and VL) by PCR using a VL-5′ (XbAI), VL-3 (SalI), VH-5′ (SalI) and VH-3′ (BstEII) specific primers. As shown at B, To the pRSV2-neo plasmid a leader sequence from the S1C5 kappa chain was introduced down stream from the LTR promoter. At C, RNA from T lymphocytes was isolated and from the cDNA prepared the α, β chains of the TCR, γ, ζ subunits of the CD3, CD16α of the FCγRIII, or IL-2 receptors (commonly denoted here as R) can be amplified using a specific set of primers for each chain. All the primers include a Xbal at their 5′ end and a few bases downstream of the XbaI or the BstEII site. At the 3′ end, all receptor chains contain a SnaBI site. Following introduction of the leader sequence into the pRSV2-neo plasmid the receptor was introduced at the Xbal site of the pRSVneoLκ vector obtaining pRSVneoLκ-R. The amplified VL (digested with XBaI-SalI) and VB (digested with SalI-BstEII) regions are introduced into the XbaI-BstEII digested pRSVneoLκ-R plasmid in a three-piece ligation. The resulting plasmid pRSVscFvR contains the complete chimeric single chain receptor. The receptor (R) gene segment described in FIGS. 13-18 is the human TCR Cβ.

Thus, the new strategy according to the invention enables the use of other receptor molecules which might serve to transduce the signal from the scFv and confer antibody specificity to T cells as well as other immune cells. In fact, it allows the expression of the scFv as the antigen recognition unit of chimeric molecules composed of the transmembrane and cytoplasmic domains of receptor molecules of immune cells, such as T cells and natural killer MO cells. Such receptors pan be single or multi-chain in nature and not necessarily belong to the Ig gene superfamily.

Candidate molecules for this approach are receptor molecules which take part in signal transduction as an essential component of a receptor complex, such as receptors which trigger T cells and NK activation and/or proliferation. Examples of triggers of T cells are subunits of the TCR, such as the α, β, γ or δ chain of the TCR, or any of the polypeptides constituting the CD3 complex which are involved in the signal transduction, e.g., the γ, δ, ε, and ζ and η CD3 chains. Among the polypeptides of the TCR/CD3 (the principal triggering receptor complex of T cells), especially promising are the zeta and its eta isoform chain, which appear as either homo- or hetero-S-S-linked dimers, and are responsible for mediating at least a fraction of the cellular activation programs triggered by the TCR recognition of ligand (18, 19). These polypeptides have very short extracellular domains which can serve for the attachment of the scFv.

Additional examples of immune cell trigger molecules are any one of the IL-2 receptor (IL-2R) p55 (a) or p75 (β) or γ chains, especially the p75 and γ subunits which are responsible for signaling T cell and NK proliferation.

Further candidate receptor molecules for creation of scFv chimeras in accordance with the present invention include the subunit chains of Fc receptors.

In the group of NK-stimulatory receptors the most attractive candidates are the γ- and CD16α-subunits of the low affinity receptor for IgG, FcγRIII. Occupancy or cross-linking of FcγRIII (either by anti-CD16 or through immune complexes) activates NK cells for cytokine production, expression of surface molecules and cytolytic activity (20, 21). In NK cells, macrophages\', and B and T cells, the FcγRIII appears as a heterooligomeric complex consisting of a ligand-binding a chain associated with a disulfide-linked γ or zeta chain. The FcγRIIIA signalling gamma chain (22) serves also as part of the FcεRI complex, where it appears as a homodimer, is very similar to the CD3 zeta chain, and in fact can form heterodimers with it in some cytolytic T lymphocytes (CTL) and NK cells (23-25). Most recently prepared chimeras between these polypeptides and the CD4 (26), the CD8 (27), IL-2 receptor chain (28) or CD16 extracellular domains, proved to be active in signalling T cell stimulation even in the absence of other TCR/CD3 components.

In addition to the receptor molecules discussed above, there are lymphocyte accessory and adhesion molecules such as CD2 and CD28, which transduce a co-stimulatory signal for T-cell activation. These co-stimulatory receptors can also be used in accordance with the present invention.

Besides the specific receptor chains specifically mentioned herein, the single chain Fv chimeras can be made by joining the scFv domain with any receptor or co-receptor chain having a similar function to the disclosed molecules, e.g., derived from granulocytes, B lymphocytes, mast cells, macrophages, etc. The distinguishing features of desirable immune cell trigger molecules comprise the ability to be expressed autonomously (i.e.; as a single chain), the ability to be fused to an extracellular domain such that the resultant chimera is expressed on the surface of an immune cell in to which the corresponding gene was genetically introduced, and the ability to take part in signal transduction programs secondary to encounter with a target ligand.

The scFv domain must be joined to the immune cell triggering molecule such that the scFv portion will be extracellular when the chimera is expressed. This is accomplished by joining the scFv either to the very end of the transmembrane portion opposite the cytoplasmic domain of the trigger molecule or by using a spacer which is either part of the endogenous extracellular portion of the triggering molecule or from other sources. The chimeric molecules of the present invention have the ability to confer on the immune cells on which they are expressed MHC nonrestricted antibody-type specificity. Thus, a continuous polypeptide of antigen binding and signal transducing properties can be produced and utilized as a targeting receptor on immune cells. In vivo, cells expressing these genetically engineered chimeric receptors will home to their target, will be stimulated by it to attract other effector cells, or, by itself, will mediate specific destruction of the target cells. In a preferred embodiment, the target cells are tumor cells and the scFv domain is derived from an antibody specific to an epitope expressed on the tumor cells. It is expected that such anti-tumor cytolysis can also be independent of exogenous supply of IL-2, thus providing a specific and safer means for adoptive immunotherapy.

In preferred embodiments, the immune cells are T-cells or NK-cells. The antibody scFvR design of the present invention will thus involve retargeting lymphocytes in vivo in an MHC-non-restricted manner. Thus, the T-cells can be re-targeted in vivo to tumor cells or any other target of choice toward which antibodies can be raised.

The term “single-chain Fv domain” is intended to include not only the conventional single-chain antibodies as described in references 16 and 17, the entire contents of which are hereby incorporated herein by reference, but also any construct which provides the binding domain of an antibody in single-chain form as, for example, which may include only one or more of the complementarity determining regions (CDRs), also known as the hypervariable regions, of an antibody.

The gene encoding the transmembrane and cytoplasmic portions of the receptor molecule may correspond exactly to the natural gene or any gene which encodes the protein in its natural amino acid sequence. Furthermore, the present invention comprehends muteins characterized by certain minor modifications to the amino acid structure of the molecule, such that the mutant protein molecules are substantially similar in amino acid sequence and/or 3D structure, and possess a similar biological activity, relative to the native protein.

The transformed cells of the present invention may be used for the therapy of a number of diseases. Current methods of administering such transformed cells involve adoptive immunotherapy or cell-transfer therapy. These methods allow the return of the transformed immune system cells to the blood stream. Rosenberg, S. A., Scientific American 62 (May 1990); Rosenberg et al., The New England Journal of Medicine 323(9):570 (1990).

The transformed cells of the present invention may be administered in the form of a pharmaceutical composition with suitable pharmaceutically acceptable excipients. Such compositions may be administered to any animal which may experience the beneficial effects of the transformed cell of the present invention, including humans.

Those of ordinary skill in the art will further understand that the antibodies which are used to make the scFv portion of the present invention may be any antibody, the specificity of which is desired to be transferred to the immune cell. Such antibody may be against tumor cells, cells expressing viral antigens, anti-idiotypic or anti-clonotypic antibodies in order to specifically eliminate certain B-cells and T-cells, or antibodies against the constant region of immunoglobulin determinants. Thus, for example, if the antibody is specific to the constant portion of IgE, it can serve to eliminate IgE-producing B-cells in order to alleviate allergy, etc. This list of possible antibodies is not intended to be exclusive and those of ordinary skill in the art will be aware of many additional antibodies for which important utilities exist upon combination with the receptor in accordance with the present invention.

The genes of the present invention can be introduced into the immune cells by any manner known in the art, such as, for example, calcium phosphate transfection, electroporation, lipofection, transduction by retrovirus vector, use of a retroviral vector or a viral vector, etc.

The scFvR design is advantageous over the cTCR one. It requires the expression of only one gene instead of the gene pair required for the cTCR, thereby providing simpler construction and transfection.

Furthermore, the scFvR design can be employed to confer antibody specificity on a larger spectrum of signaling molecules composed of only one chain. Additionally, the scFv maintains both VH and VL together in one chain; thus, even upon mixed pairing of chimeric with endogenous chains, the antigen-binding properties of the molecule are conserved. Finally, the fact that gamma and zeta constitute the signaling chains of the TCR/CD3, the FcγRIII and the FCERI expands the feasibility of exploiting the chimeric receptor for retargeting other hematopoietic cells, such as NK cells, basophils, or mast cells in addition to T cells.

The chimeric scFvRγ of the invention or any of the simple modifications thereof described below, that combine the specificity of an antibody as a continuous single-chain and the effector function of cytotoxic T cells and NK cells or regulatory function of helper T cells, constitute an important consequential development for targeted immunotherapy. This approach exploits the scFv as the antigen-recognition unit and the potent cytotoxic responses of NK cells and T cells and/or the ability of T cells to secrete lymphokines and cytokines upon activation at the target site, thus recruiting, regulating and amplifying other arms of the immune system.

The chimeric scFv receptors can confer on the lymphocytes the following functions: antibody-type specificity toward any predefined antigen; specific “homing” to their targets; specific recognition, activation, and execution of effector function as a result of encountering the target; and specific and controlled proliferation at the target site. Endowing the lymphocytes with an Fv from an antibody may also serve for controlled and selective blocking of the aforementioned functions using soluble haptens or Fab′ of anti-idiotypic antibodies.

Candidate immune cells to be endowed with antibody specificity using this approach are: NK cells, lymphokine-activated killer cells (LAK), cytotoxic T cells, helper T cells, and the various subtypes of the above. These cells can execute their authentic natural function and can serve, in addition, as carriers of foreign genes designated for gene therapy, and the chimeric receptor shall serve in this case to direct the cells to their target. This approach can be applied also to anti-idiotypic vaccination by using helper T cells expressing chimeric receptors made of Fv of antiidiotypic antibodies. Such “designer lymphocytes” will interact and stimulate idiotype-bearing B cells to produce antigen-specific antibodies, thus bypassing the need for active immunization with toxic antigens.

The invention will now be illustrated by the following non-limiting examples.

In this example, the following materials and methods were used.

A. Cell lines and antibodies. MD.45 is a cytolytic T-lymphocyte (CTL) hybridoma of BALB/c mice allospecific to H-2b (29). MD45.27J is a TCR α-mutant of MD.45. A.20 is a B lymphoma of BALB/c origin (ATCC#T1B 208). Cells were cultured in Dulbecco\'s modified Eagle\'s medium (DMEM) supplemented with 10% fetal calf serum (FCS). Sp6, an anti-TNP mAb, and 20.5, an anti-Sp6 idiotype mAb, were provided by G. Kohler (30). Anti-human FcεRIγ chain polyclonal and monoclonal (4D8) (31) antibodies were provided by J.-P. Kinet and J. Kochan, respectively, and rabbit antibodies to murine zeta chain by M. Baniyash.

B. Constructions of chimeric genes. All the recombinant DNA manipulations were carried out as described in updated editions of Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., and Ausubel et al. (1987) Current Protocols in Molecular Biology, John Wiley & Sons. The specific genes encoding the VH and VL Of the Sp6 anti-TNP antibody were derived from the genomic constructs described for the preparation of the cTCR (12, 32) by PCR amplifications using oligodeoxynucleotide primers designed according to the 5′ and 3′ consensus amino acid sequences of immunoglobulin V regions (33) introducing the Xba I and BstEII restriction sites at the ends of the scFv. In constructing the scFv we used the VL-linker-VR design containing a linker sequence similar to linker 212 described by Colcher et al. (34). Accordingly, the VL-3′ and the VH-5′ primers include sequences comprising the 5′ and 3′ parts of the linker, introducing Sal I in their 3′ and 5′ ends, respectively. Table I lists the oligonucleotide primers used in the different constructions. In the examples, reference is made to the number of the specific primer used. Following digestion of the purified PCR products with Xba I and Sal I (VL) and Sal I and BstEII (VH), the fragments were ligated into the Xba I and BstEII sites of a pRSV2neo-based expression vector containing the leader of S1C5 kappa light chain (provided by S. Levy) and TCR constant region β chain (cβ), prepared for the expression of anti-38C.13 cDNA cTCR genes (12). The Cβ of this plasmid was then replaced with either the gamma chain amplified from a human cDNA clone (35) or the zeta chain amplified from Jurkat cDNA by using primers introducing BstEII and Xho T at the 5′ and 3′ ends. A schematic diagram of the final scFvRγ expression vector is depicted in FIG. 2. The sequences of the oligodeoxynucleotide primers used for the construction of the chimeric scFvRγ and scFvRζ are delineated Table 1.

TABLE I Primers used for construction of the various scFvR Base code R = A or G S = C or G TACGTA SnaBI GTCGAC SaII GGATCC Ba Y = C or T K = G or T CTCGAG XhoI GGTGACC BstEII AAGCTT Hi W = A or T M = A or C TCTAGA XbaI GAATTC EcoRI GGTACC Kp Primers for cDNA Reverse Transcription SEQ. ID. NO. 1 mouse Cγ1 5′ GGCCAGTGGATAGAC 3′ SEQ. ID. NO. 2 mouse kappa 5′ GATGGTGGGAAGATG 3′ SEQ. ID. NO. 3 rat Cγ3 5′ CCATGRYGTATACCTGTGG 3′ Primers for Single chain Fv SEQ. ID. NO. 4 VK-5′ 5′ CCCGTCTAGAGGAGAYATYGTWATGACCCAGTCTCCA 3′ SEQ. ID. NO. 5 VK-3′ 5′ CCCGTCGACCCTTTWATTTCCAGCTTWGTSCC 3′ SEQ. ID. NO. 6 VH-5′ 5′ CGGGTCGACTTCCGGTAGCGGCAAATCCTCTGAAGGCAAAGGTSAGG SEQ. ID. No. 7 VH-3′ 5′ TGMRGAGACGGTGACCGTRGTYCCTTGGCCCCAG 3′ Receptor primers SEQ. ID. NO. 8 5′ Cα (Xhol) 5′ CCTCGAGATAAAAAATATCCAGAACCCTGACCCTGCC 3′ SEQ. ID. NO. 9 5′ Cα (BstEII) 5′ CGGTCACCGTCTCCTCAAATATCCAGAACCCTGACCCTGCC 3′

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Chimeric receptor genes and cells transformed therewith patent application.

Patent Applications in related categories:

20130122026 - Dna vaccine for alzheimer's disease - The present invention provides a recombinant vector which comprises DNA encoding amyloid β and DNA encoding a Th2 cytokine, as well as a DNA vaccine for Alzheimer's disease which comprises this vector. The present invention aims to provide a DNA vaccine for Alzheimer's disease. ...

20130122025 - Method of rapidly producing improved vaccines for animals - A method of quickly producing a vaccine for a biotype of pathogenic microorganism is described, where a nucleic acid molecule or fragment thereof is obtained from a biological sample from an animal exposed to the microorganism, a protective molecule is prepared based on the nucleic acid molecule of interest or ...

20130122027 - Neoepitope detection of disease using protein arrays - A biosensor for use in detecting the presence of diseases, the biosensor comprising a detector for detecting a presence of at least one marker indicative of a specific disease. A method of determining efficacy of a pharmaceutical for treating a disease or staging disease by administering a pharmaceutical to a ...


###


Other recent patent applications listed under the agent Yeda Research And Development Co., Ltd.: