Pharmaceutical compositions and methods to vaccinate against disseminated candidiasis and other infectious agents   

This application is a continuation-in-part application of U.S. Ser. No. 11/123,875, filed May 5, 2005, which is a continuation-in-part application of U.S. Ser. No. 10/245,802, filed Sep. 13, 2002, which is a continuation-in-part of U.S. Ser. No. 09/715,876, filed Nov. 18, 2000, which is based on, and claims the benefit of, U.S. Provisional Application Ser. No. 60/166,663 filed Nov. 19, 1999, all of which are herein incorporated by reference in its entirety.

This invention was made with government support under Public Health Service grants PO-1AI-37194, RO1Ai-19990, and MO1 RR0425. The United States Government has certain rights in this invention

BACKGROUND OF THE INVENTION

This invention relates to Candida albicans surface adhesin proteins, to antibodies resulting from an immune response to vaccination with C. albicans surface adhesion proteins and to methods for the prevention and/or treatment of candidiasis and other bacterial infections with C. albicans surface adhesion proteins.

There has been a dramatic increase in the incidence of nosocomial infections caused by Candida species in recent years. The incidence of hematogenously disseminated candidal infections increased 11-fold from 1980 to 1989. This increasing incidence has continued into the 1990s. Infections by Candida species are now the fourth most common cause of nosocomial septicemia, are equal to that of Escherichia coli, and surpass the incidence caused by Klebsiella species. Furthermore Candida species are the most common cause of deep-seated fungal infections in patients who have extensive burns. Up to 11% of individuals undergoing bone marrow transplantation and 13% of those having an orthotopic liver transplant will develop an invasive candidal infection.

Candida albicans, the major pathogen in this genus, can switch between two morphologies: the blastospore (budding yeast) and filamentous (hyphae and pseudohyphae) phases. Candida mutants that are defective in genes regulating filamentation are reported to have reduced virulence in animal models. This reduced virulence suggests that the ability to change from a blastospore to a filament is a key virulence factor of C. albicans. To date, no essential effectors of these filamentation pathways have been identified in C. albicans. See Caesar-TonThat, T. C. and J. E. Cutler, “A monoclonal antibody to Candida albicans enhances mouse neutrophil candidacidal activity,” Infect. Immun. 65:5354-5357, 1997.

Staphylococcus aureus infections also are common and increasingly result in drug resistance to antibiotics. For example, S. aureus is a common cause of skin and skin structure infections, endocarditis and bacteremia in the U.S. and throughout the world. Formerly community acquired S. aureus (CA-S. aureus) infections were nearly uniformly susceptible to penicillinase-resistant beta lactams such as cefazolin, oxacillin, methicillin, penicillin and amoxicillin. However, over the past decade, epidemics of beta-lactam resistant S. aureus (MRSA) infection have been seen in multiple locales throughout the world, especially community acquired MRSA (CA-MRSA). In many places MRSA has become the predominant S. aureus strain causing CA infections. A recent, prospective, population-based survey in three states in the U.S. estimated that the incidence of CA-MRSA infections is 500 cases per 100,000 population, which translates to approximately 1.5 million cases per year in the U.S. alone. The increasing frequency of drug-resistant S. aureus infections highlights the need for new ways to prevent and treat these infections.

The identification of effectors in the regulatory pathways of the organism that contribute to virulence offers the opportunity for therapeutic intervention with methods or compositions that are superior to existing antifungal agents. The identification of cell surface proteins that affect a regulatory pathway involved in virulence is particularly promising because characterization of the protein enable immunotherapeutic techniques that are superior to existing antifungal agents when fighting a candidal infection.

The virulence of Candida albicans is regulated by several putative virulence factors of which adherence to host constituents and the ability to transform from yeast-to-hyphae are among the most critical in determining pathogenicity. While potent antifungal agents exist that are microbicidal for Candida, the attributable mortality of candidemia is approximately 38%, even with treatment with potent anti-fungal agents such as amphotericin B. Also, existing agents such as amphotericin B tend to exhibit undesirable toxicity. Although additional antifungals may be developed that are less toxic than amphotericin B, it is unlikely that agents will be developed that are more potent. Therefore, either passive or active immunotherapy to treat or prevent disseminated candidiasis is a promising alternative to standard antifungal therapy.

Thus, there exists a need for effective immunogens that will provide host immune protection and passive immunoprotection against Candida, S. aureus and other immunogenically related pathogens. The present invention satisfies this need and provides related advantages as well.

SUMMARY

The invention provides a vaccine including an isolated Als protein family member having cell adhesion activity, or an immunogenic fragment thereof, with an adjuvant in a pharmaceutically acceptable medium. The invention also provides a method of treating or preventing disseminated candidiasis. The method includes administering an immunogenic amount of a vaccine an isolated Als protein family member having cell adhesion activity, or an immunogenic fragment thereof, in a pharmaceutically acceptable medium. A method of treating or preventing disseminated candidiasis also is provided that includes administering an effective amount of an isolated Als protein family member having cell adhesion activity, or an functional fragment thereof, to inhibit the binding or invasion of Candida to a host cell or tissue. The Als protein family member can be derived from a Candida strain selected from the group consisting of Candida albicans, Candida krusei, Candida tropicalis, Candida glabrata and Candida parapsilosis and the Als protein family member includes Als1p, Als3p, Als5p, Als6p, Als7p or Als9p. Also provided is a method of treating or preventing Staphylococcus aureus infections. The method includes administering an immunogenic amount of a vaccine an isolated Als protein family member having cell adhesion activity, or an immunogenic fragment thereof, in a pharmaceutically acceptable medium.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A, 1B show the mediation of Als1p adherence of C. albicans to human umbilical vein endothelial cells. Values represent the mean±SD of at least three independent experiments, each performed in triplicate. (A) Endothelial cell adherence of ALS1l/als2 alsl/alsl and ALS1-complemented mutants and wild-type CAI12(30)(B) Endothelial cell adherence of PADH1-ALS1 mutant that overexpresses ALS1, compared to wild type C. albicans. Statistical treatment was obtained by Wilcoxon ran sum test and corrected for multiple comparisons with the Bonferroni correction. *P<0.001 for all comparisons.

FIG. 2A-D shows the cell surface localization of Als1p on filaments of C. albicans indirect immunofluorescence. Filamentation of C. albicans was induced by incubating yeast cells in RPMI 1640 medium with glutamine for 1.5 hours at 37° C. Als1p was detected by incubating organisms first with anti-Als1p mouse mAb followed by FITC-labeled goat anti-mouse IgG. C. albicans cell surface was also stained with anti-C. albicans polyclonal Ab conjugated with Alexa 594 (Molecular Probes, Eugene, Oreg.). Areas with yellow staining represent Als1p localization. (A) C. albicans wild-type. (B) als1/als1 mutant strain. (C) als1/als1 complemented with wild type ALS1 (D) PADH1-ALS1 overexpression mutant.

FIG. 3A, 3B show the mediation of Als1p on C. albicans filamentation on solid medium. C. albicans blastospores were spotted on Lee\'s agar plates and incubated at 37° C. for 4 days (A) or 3 days (B).

FIG. 4A, 4B show the control of ALSl expression and the mediation of C. albicans filamentation by the EFG1 filamentation regulatory pathway. (A) Northern blot analysis showing expression of ALS1 in (i) mutants deficient in different filamentation regulatory pathways. (ii) efg1/efg1 mutant complemented with either EFG1 or PADH1-ALS1. Total RNA was extracted from cells grown in RPM1 1640+glutaine medium at 37° C. for 90 minutes to induce filamentation. Blots were probed with ALS1 and TEF1. (B) Photomicrographs of the efg1/efg1 mutant and efg1/efg1 mutant complemented with PADH1-ALS1 grown on Lee\'s agar plates at 37° C. for 4 days.

FIG. 5A, 5B show the reduction of virulence in the mouse model of hematogenously disseminated candidiasis by (A) Male Balb/C mice (n=30 for each yeast strain) were injected with stationary phase blastospores (106 per mouse in 0.5 ml of PBS). Curves are the compiled results of three replicate experiments (n=30 mice for each strain). The doubling times of all strains, grown in YPD at 30° C., ranged between 1.29 to 1.52 hours and were not statistically different from each other. Southern blot analysis Of total chromosomal DNA was used to match the identity of the genotype of C. albicans strains retrieved from infected organs with those of C. albicans strains used to infect the mice. Statistical analysis was obtained by Wilcoxon rank sum test and corrected for multiple comparisons with the Bonferroni correction. *P<0.002 for the als1/als1 mutant versus each of the other strains. (B) Histological micrographs of kidneys infected with C. albicans wild-type, homozygous als1 null mutant, or heterozygous ALS1 complemented mutant. Kidney samples were retrieved 28 hours (a) or 40 (b) hours post infection, fixed in paraformaldehyde and sections were stained with silver (magnification ×400). Arrows denote C. albicans cells.

FIG. 6 shows the prophylactic effect of anti-ALS antibody against disseminated candidiasis as a function of surviving animals over a 30-day period for animals infused with anti-Als1p polyserum.

FIG. 7 is polypeptide sequence alignment of the N-terminal portion of select ALS polypeptides arranged by adherence phenotype. The top three lines are the sequences from ALS1, 3 and 5 polypeptides (SEQ ID NOS: 1-3, respectively), which bind endothelial cells. The bottom three are sequences from ALS6, 7 and 9 polypeptides (SEQ ID NOS; 4-6, respectively), which do not bind endothelial cells. The last line represents the ALS polypeptide family consensus sequence (SEQ ID NO:7).

FIG. 8 shows Als proteins confer substrate-specific adherence properties when heterologously expressed in Saccharonzyces cerevisiae. Each panel demonstrates the percentage adherence of one Alsp expression strain (filled bars) to a variety of substrates to which C. albicans is known to adhere. Adherence of S. cerevisiae transformed with the empty vector (empty bars) is included in each panel as a negative control. Gel, gelatin; FN, fibronectin; LN, laminin; FaDU, FaDU epithelial cells; EC, endothelial cells. *, p<0.01 when compared with empty plasmid control by single factor analysis of variance. Results are the mean±S.D. of at least three experiments performed in triplicate.

FIG. 9 shows domain swapping demonstrates that substrate-specific adherence is determined by the composition of the N-terminal domain of Als proteins. A representation of the ALS gene or construct being tested is depicted as a bar composed of sequences from ALS5 (black) or ALS6 (white). Adherence properties of each mutant are displayed as a photomicrograph illustrating the adherence of transformed S. cerevisiae to fibronectin-coated beads and a graph demonstrating the adherence to gelatin (black bars) and endothelial cells (gray bars) as measured in the 6-well plate assay. Results are mean±S.D. of at least three experiments, each performed in triplicate.

FIG. 10 shows a subset of Als proteins mediate endothelial cell invasion when expressed in S. cerevisiae. A, endothelial cell adherence of S. cerevisiae strains expressing Als proteins or transformed with the empty plasmid (control). Data represent the total number of endothelial cell-associated organisms and are expressed as cells per high power field. B, degree of endothelial cell invasion of Alsp expressing S. cerevisiae strains presented as the number of intracellular organisms per high power field. *, p<0.01 when compared with empty plasmid control by single factor analysis of variance. Results are the mean±S.D. of at least three experiments performed in triplicate.

FIG. 11 shows an alignment of the N-terminal amino acid sequence of Als proteins of known function demonstrates an alternating pattern of CRs and HVRs. A, percentage of consensus identity among the N-terminal regions of Als proteins of known function. Note that the signal peptide region (amino acids 1-20) is not shown. Open boxes indicate the regions designated as HVRs 1-7. B, schematic alignment of Als proteins (SEQ ID NOS:1-6, respectively) showing the composition of the individual HVRs. The sequences are arranged to compare proteins with an affinity to multiple substrates with those that bind few or no identified substrates. The number of amino acids in each conserved region is indicated in parentheses.

FIG. 12 shows CD and FTIR spectra of the Als1 protein N-terminal domain. A, circular dichroism spectrum of 10 μM Als1p in phosphate-buffered saline. B, FTIR spectrum of Als1p self-film hydrated with D2O vapor.

FIG. 13 shows a comparison of predicted physicochemical properties of N-terminal domains among the Als protein family. Hydrophobic, electrostatic, or hydrogen-bonding features are projected onto water-accessible surfaces of each domain. Hydrophobics are shown as follows: brown, most hydrophobic; blue, most hydrophilic. Electrostatics (spectral continuum) is shown as follows: red, most positive charge (+10 kcal/mol); blue, most negative charge (−10 kcal/mol). Hydrogen-bonding potential (H-binding) is shOwn as follows: red, donor; blue, acceptor. Als proteins are distinguishable into three groups based on the composite of these properties. For example, note the similar hydrophobic, electrostatic, and hydrogen-bonding profiles among Als group A proteins, Als1p, Als3p, and Als5p. In contrast, Als group B members, Als6p and Als7p, display striking differences in hydrophobic and electrostatic features from those of Als group A. In addition to biochemical profiles, note the differences in predicted structure among these domains.

FIG. 14. Conceptual model of structural-functional relationships in Als family proteins. Als proteins are composed of three general components: an N-terminal domain, tandem repeats, and a serine/threonine-rich C-terminal domain containing a glycosylphosphatidylinositol anchor that interfaces with the C. albicans cell wall. As illustrated, Als proteins contain multiple conserved anti-parallel β-sheet regions (CR1-n) that are interposed by extended spans, characteristic of the immunoglobulin superfamily. Projecting from the β-sheet domains are loop/coil structures containing the HVRs. The three-dimensional physicochemical properties of specific Als protein HVRs probably govern interactions with host substrates that confer adhesive and invasive functions to Candida. For illustrative purposes, only three N-terminal β-sheet/coil domains and their respective CR/HVR components are shown. Note that this projection is viewed at right angles to the structural images shown in FIG. 13.

FIG. 15. Immunization of mice (retired breeders) with rAls1p-N improves survival during subsequent disseminated candidiasis. Survival of mice immunized with Als1p plus adjuvant. N=16 mice per group in duplicate experiments on different days; Adj.=adjuvant. *p<0.05 vs adjuvant.

FIG. 16. Immunization with rAls1p-N improves the survival of both retired breeder and juvenile mice. Survival of retired breeder (A) and juvenile (B) mice infected with a rapidly fatal, 106 inoculum of C. albicans. N=16 mice per group in duplicate experiments on different days; Adj.=adjuvant. *p<0.05 vs adjuvant control.

FIG. 17. Anti-rAls1p-N titers do not correlate with survival. Titers of anti-rAls1p-N polyclonal antibodies raised in Balb/c mice immunized with varying doses of rAls1p-N with or without adjuvant. Adj.=adjuvant. * p≦0.005 for 200 μg vs. all others.

FIG. 18. Only the protective dose of rAls1p-N induces an increase in C. albicans-stimulated Th1 splenocytes. Induction of Th1 (CD4+IFN-γ+IL-4−) and Th2 (CD4+IFN-γ−IL-4+) splenocytes by different doses of the rAls1p-N vaccine. Splenocytes from immunized mice (n=9 per group) were stimulated for 48 h with heat-killed pre-germinated C. albicans and then analyzed by 3-color flow cytometry. *p=0.03 vs. adjuvant.

FIG. 19. Only the protective dose of rAls1p-N induces an increase in rAls1p-N-stimulated delayed type hypersensitivity. Delayed type hypersensitivity, assessed by footpad swelling, in mice (n=9-12 per group) vaccinated with rAls1p-N or CFA alone. Mice were immunized with the indicated amount of rAls1p-N and then injected with 50 μg of rAls1p-N into the footpad. Footpad swelling was assessed 24 h later. *p<0.05 versus adjuvant, 0.2 μg, and 200 μg.

FIG. 20. The rAls1p-N vaccine requires T cells, but not B cells, to induce protective immunity. Survival of B cell-deficient, T cell-deficient (nude), and congenic wild-type Balb/c control mice (n=7 or 8per group) was simultaneously assessed after vaccination with rAls1p-N+adjuvant or adjuvant alone. *p<0.04 versus adjuvant alone, ¶p=0.003 versus wild-type adjuvant-treated.

FIG. 21. SQ vaccination with rAls1p-N induces an in vivo DTH response in immunocompetent mice. Footpad swelling was assessed 24 h after injection of 50 μg of rAls1p-N into the footpad in BALB/c mice (n=10 per group). Median values are displayed as black bars. *p=0.002 vs. control by Wilcoxon Rank Sum test.

FIG. 22. The rAls1p-N vaccine improves survival of immunocompetent mice with hematogenously disseminated candidiasis and reduces tissue fungal burden. A) Survival of vaccinated or control BALB/c mice (n=7 or 10 per group for 2.5 or 5×105 inocula, respectively) mice subsequently infected via the tail-vein with C. albicans. Each experiment was terminated at 30 days post-infection with all remaining mice appearing well. *p<0.05 vs. Control by Log Rank test. B) Kidney fungal burden in BALB/c mice (n=7 per group) infected via the tail vein with 5×105 blastospores of C. albicans. The y axis reflects the lower limit of detection of the assay. Median values are displayed as black bars. *p=0.01 vs control by Wilxocon Rank Sum test.

FIG. 23. The rAls1p-N vaccine induces a DTH reaction in neutropenic mice and improves their survival during subsequent hematogenously disseminated candidiasis. A) Footpad swelling was assessed 24 h after injection of 50 μg of rAls1p-N into the footpad in BALB/c mice (n=10 for Control, n=8 for rAls1p-N). * p=0.006 vs Control by Wilcoxon Rank Sum test. B) Survival of neutropenic BALB/c mice (n=16 per group from 2 experiments) infected with 2.5×104 blastospores of C. albicans. *p=0.007 vs adjuvant control by Log Rank test.

FIG. 24. The rAls1p-N vaccine diminishes the severity of histopathological fungal lesions on the tongues of mice with oropharyngeal candidiasis. N=4 mice per group. Inflammatory score generated by a blinded observer as described in the text. *p=0.03 by Wilcoxon Rank Sum test.

FIG. 25 shows that rAls3p-N but not rAls1p-N vaccine diminishes fungal colonization of vagina of mice inoculated with C. albicans (*p=0.01 vs mice vaccinated with CFA alone, by Wilcoxon Rank Sum test) N=11 mice per group.

FIG. 26 shows an Als1p homology map versus S. aureus clumping factor A (c1n67A). Consensus functional sites from C. albicans Als1p and S. aureus ClfA were mapped onto the Als1p homology model. Numerous residues from the N-termini of Als1p and ClfA map to a consensus cleft motif, which is where binding to substrate is predicted to occur for both adhesins.

FIG. 27 shows that rAls1p-N and rAls3p-N vaccines improve the survival of staphylococcemic mice. (*p<0.003 vs mice vaccinated with CFA alone, by Log Rank test). N 22 mice per group.

FIG. 28 shows that antibody titers do not correlate with degree of protection in individual vaccinated mice, but they do distinguish unvaccinated from vaccinated mice. Titers of anti-rAls1p-N or anti-rAls3p-N polyclonal antibodies raised in Balb/c mice immunized with CFA alone, or CFA+20 μg of rAls1p-N or rAls3p-N, respectively. Overall there is a significant correlation between antibody titers and survival (rho=0.474, p=0.0057), indicating that antibody titers can be used as a surrogate marker for vaccine protection. However, when data from mice receiving CFA alone are excluded, there is no correlation between antibody titers and survival of mice vaccinated with rAls1p-N or rAls3p-N (rho 0.041143, p=0.847), indicating that antibodies are likely not the predominant mechanism of protection of the vaccine.

FIG. 29 shows that the rAls1p-N vaccine protects outbred, CD1 mice from hematogenously disseminated candidiasis. A) CD1 mice (n=8 per group) were vaccinated SQ with rAls1p-N (20 μg)+CFA, or CFA alone, and infected via the tail-vein with C. albicans SC5314 fourteen days after the boost. B) CD1 mice (n=8 per group) were vaccinated SQ with rAls1p-N at various doses with alum, or with alum alone, and infected via the tail-vein with C. albicans SC5314 fourteen days after the boost. * p<0.05 vs. adjuvant control by Log Rank test.

FIG. 30 shows that the rAls1p-N vaccine improves the survival of Balb/c mice infected with one of several strains of C. albicans. Survival of Balb/c mice immunized with rAls1p-N plus CFA versus CFA alone and infected via the tail-vein with C. albicans 15563 (7×105 blastospores), 16240 (4×105 blastospores), or 36082 (4×105 blastospores) (n=8 mice per group). *p<0.05 ys adjuvant control by Log Rank test.

FIG. 31 shows that the rAls1p-N vaccine reduces tissue fungal burden in Balb/c mice infected with several non-albicans species of Candida. Balb/c mice (n=5 per group) were vaccinated with CFA or CFA+rAls1p-N (20 μg) and infected via the tail-vein with C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis. Infectious inocula are shown in parentheses below the species names. Kidney fungal burden was determined on day five post-infection. The y axis reflects the lower limit of detection of the assay. *p<0.05 vs. adjuvant control by non-parametric Steel test for multiple comparisons.

FIG. 32 shows that rAls3p-N-immunized mice generated antibodies that cross-reacted against rAls1p-N. Titers of individual mice immunized with CFA alone, CFA+rAls1p-N, or CFA+rAls3p-N. N=7 mice per group for CFA and CFA+rAls3p-N; n=6 mice for CFA+rAls1p-N. *p<0.05 vs. CFA alone; **p<0.002 vs. CFA alone & p<0.011 vs. CFA+rAls1p-N by Maim Whitney U test. Bars denote medians.

FIG. 33 shows that both rAls1p-N and rAls3p-N primed mice for in vivo delayed type hypersensitivity responses. Mice (n=7 per group for CFA and CFA+rAls3p-N; n=6 for CFA+rAls1p-N) were vaccinated with CFA alone, CFA+rAls1p-N, or CFA+rAls3p-N. Delayed type hypersensitivity in vivo was measured by footpad swelling. *p<0.05 vs. CFA alone by Mann Whitney U test. Bars denote medians.

FIG. 34 shows that the rAls1p-N and rAls3p-N vaccines mediated similar efficacy against murine hematogenously disseminated candidiasis. Survival of Balb/c mice (n=15 per group from 2 experiments for CFA and CFA+rAls3p-N, and n=14 from 2 experiments for CFA+rAls1p-N) infected via the tail vein with 5×105 blastospores of C. albicans. The experiment was terminated at day 28 post-infection with all remaining mice appearing well. *p≦0.0001 vs CFA control by Log Rank test.

FIG. 35 shows that in vivo delayed-type hypersensitivity correlated with survival during disseminated candidiasis. Anti-rAls1p-N or anti-rAls3p-N antibody titers and footpad swelling reactions were measured in mice (n=7 per group for CFA or CFA+rAls3p-N, n=6 for CFA+rAls1p-N) two days prior to infection via the tail-vein with C. albicans. Correlations determined with the Spearman Rank sum test.

FIG. 36 shows that the rAls3p-N vaccine significantly reduced tissue fungal burden during murine oropharyngeal candidiasis. Tongue fungal burden in mice (n=7 for CFA and 8 for rAls1p-N or rAls3p-N vaccinated groups) with oropharyngeal candidiasis. The y axis reflects the lower limit of detection of the assay. *p=0.005 vs. CFA by Mann Whitney U test.

FIG. 37 shows that rAls3p-N reduced vaginal fungal burden compared to both CFA alone and CFA+rAls1p-N in murine candidal vaginitis. Vaginal fungal burden in mice (n=11 per group from 2 experiments) vaccinated with CFA, CFA+rAls1p-N, or CFA+rAls3p-N. The y axis reflects the lower limit of detection of the assay. *p≦0.02 vs CFA and CFA+rAls1p-N by Steel test for multiple comparisons.

DETAILED DESCRIPTION

Candida albicans and Staphylococcus aureus are common pathogen in humans. For example, C. albicans, while normally a harmless commensal, this organism can cause a variety of conditions ranging from superficial mucocutaneous infection such as vaginal and/or oropharyngeal candidiasis, to deep organ involvement in disseminated candidiasis. Prior to causing disease, the fungus colonizes the gastrointestinal tract, and in some cases skin and mucous membranes. Adherence to host mucosal surfaces is a key prerequisite for this initial step. After colonization, C. albicans enters the bloodstream via infected intravascular devices or by transmigration through gastrointestinal mucosa compromised by chemotherapy or stress ulcerations. Organisms then disseminate via the bloodstream, bind to and penetrate the vascular endothelium to egress from the vascular tree, and invade deep organs such as liver, spleen, and kidney.

The identification and functional characterizations of a variety of exemplary Als protein family members described herein allow this family of proteins to be effectively utilized in the treatment of candidiasis. Specific binding activity to diverse substrates and other selective cell adhesion functions can be exploited in the production of vaccines for active or passive immunization, in the production of peptide, analogue of mimetic inhibitors of cell adhesion to reduce or prevent initial infection by inhibiting binding, adhesion or invasion of a host cell. Moreover, the differential binding and invasion profiles allow design and use of broad spectra or targeted inhibition of Als protein family member activities. Additionally, functional fragments that confer binding and/or invasive activity allow elimination of unwanted foreign protein sequences, thus, increasing the efficacy of the Als family protein member vaccine or therapeutic inhibitor.

The nature of the pathogenesis of C. albicans by adherence to endothelial cells is discussed in U.S. Pat. No. 5,578,309 which is specifically incorporated herein by reference in its entirety. For a description of the ALS1 gene and characteristics thereof, including the characterization of the gene product as an adhesin see, Fu, Y., G. Rieg, W. A. Forizi, P. H. Belanger, J. E. J. Edwards, and S. G. Filler. 1998. Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells. Infect. Immun. 66:1783-1786; Hoyer, L. L. 1997. Fu Y, Ibrahim A S, Sheppard D C, Chen Y-C, French S W, Cutler J E, Filler S G, Edwards, J E, Jr. 2002. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Molecular Microbiology 44:61-72. Sheppard D C, Yeaman M R, Welch W H, Phan Q T, Fu Y, Ibrahim A S, Filler S G, Zhang M, Waring A J, Edwards, Jr., J E 2004. Functional and Structural Diversity in the Als Protein Family of Candida albicans. Journal Biological Chemistry. 279: 30480-30489. The ALS gene family of Candida albicans. International Society for Human and Animal Mycology Salsimorge, Italy: (Abstract); Hoyer, L. L., S. Scherer, A. R. Shatzman, and G. P. Livi. 1995. Candida albicans ALSI: domains related to a Saccharonzyces cerevisiae sexual agglutinin separated by a repeating motif. Mol. Microbiol. 15:39-54.

In this regard, the human fungal pathogen Candida albicans colonizes and invades a wide range of host tissues. Adherence to host constituents plays an important role in this process. Two members of the C. albicans Als protein family (Als1p and Als5p) have been found to mediate adherence and exemplify the binding, adhesion and cell invasion activities of Als protein family members. As described herein, members of the ALS gene family were cloned and expressed in S. cerevisiae to characterize their individual functions. Distinct Als proteins conferred distinct adherence profiles to diverse host substrates. Using chimeric Als5p-Als6p constructs, the regions mediating substrate-specific adherence were localized to the N-terminal domains in Als proteins. In particular, a subset of Als proteins also mediated endothelial cell invasion, a previously unknown function of this family. Consistent with these results, homology modeling revealed that Als members contain anti-parallel β-sheet motifs interposed by extended regions, homologous to adhesions or invasins of the immunoglobulin superfamily. This finding was confirmed using circular dichroism and Fourier transform infrared spectrometric analysis of the N-terminal domain of Als1p. Specific regions of amino acid hypervariability were found among the N-terminal domains of Als proteins, and energy-based models predicted similarities and differences in the N-terminal domains that probably govern the diverse function of Als family members. Collectively, these results indicate that the structural and functional diversity within the Als family provides C. albicans with an array of cell wall proteins capable of recognizing and interacting with a wide range of host constituents during infection.

The invention provides a vaccine having an isolated Als protein family member having cell adhesion activity, or an immunogenic fragment thereof, and an adjuvant in a pharmaceutically acceptable medium. The vaccine can be an Als protein family member derived from a Candida species such as Candida albicans, Candida krusei, Candida tropicalis, Candida glabrata or Candida, parapsilosis. The Als protein family member can be, for example, Als1p, Als3p, Als5p, Als6p, Als7p and Als9p, or an immunogenic fragment thereof. All other Als protein family members within an Candida species can similarly be employed as a vaccine of the invention.

The present invention utilizes the gene product of C. albicans agglutinin like sequence protein family member as a vaccine to treat, prevent, or alleviate disseminated candidiasis. The vaccine is effective against different strains of C. albicans as well as against different Candida species. The Als protein family member can be, for example, Als1p, Als3p, Als5p, Als6p, Als7p and Als9p. The invention exploits the role of the ALS gene products in the adherence of and invasion by C. albicans to endothelial and/or epithelial cells and the susceptibility of the Als protein family member-expressed surface protein for use as a vaccine to retard the pathogenesis of the organism.

Pursuant to this invention, an ALS family member gene encodes a surface adhesin that is selected as the target of an immunotherapeutic strategy against C. albicans. A demonstration that the expression product of the ALS1 gene, the Als1p protein, has structural characteristics typical of surface proteins and is, in fact, expressed on the cell surface of C. albicans is one criterion for proteins that act as adhesins to host tissues. The Als protein family members can be structurally characterized as having a signal peptide at the N-terminus, a glycosylphosphatidylinosine (GPI) anchorage sequence in the C-terminus, and a central region comprising repeats rich in threonine and serine. Also, Als protein family members have N—, and 0-glycosylation sites, typical of proteins that are expressed on the cell surface. Indirect immunofluorescence using a monoclonal antibody directed against the N-terminus of ALs1p, for example, revealed that ALs1p is expressed during the log phase of blastospores. This expression of ALs1p is increased during hyphal formation and is localized to the junction where the hyphal element extends from the blastospores as indicated by the diffused surface staining. Furthermore, this monoclonal antibody blocked the enhanced adherence of C. albicans overexpression mutant to endothelial cells, thereby establishing the principle for immunotherapy applications using ALs1p. Functional characteristics as they relate to cell adhesion and invasion of other Als family members are described further below in Example VI.

Thus, according to one aspect, the invention provides an Als family member surface adhesion protein, designated, for example, Als1p, Als3p, Als5p, Als6p, Als7p and Als9p, or a functional fragment, conjugate or analogue thereof, having useful properties when formulated in a pharmaceutical composition and administered as a vaccine with or without an adjuvant. An Als protein family member, combination of two or more Als protein family members or one or more functional fragments, analogues, conjugates or derivatives thereof, can be obtained from, for example, Candida albicans. Similar adhesin or invasin molecules or analogues or derivatives thereof can be of candidal origin and can be obtainable, for example, from species belonging to the genera Candida, for example Candida parapsilosis, Candida krusei, Candida glabrata and Candida tropicalis. A surface adhesin or invasin protein according to the invention can be obtained in isolated or purified form, and thus, according to one embodiment of the invention a substantially pure Als protein family member Candida surface adhesin protein, or functional fragment, immunogenic fragment, analogue, conjugate or derivative thereof, is formulated as a vaccine to cause an immune response in a patient to elicit an immune response against Candida and/or to block adhesion of the organism to the endothelial cells. Fragments of Als protein family members that exhibit similar binding, adhesion or invasion activity as an intact Als protein family member is referred to herein as a functional fragment. Fragments of Als protein family members that are capable of eliciting an antibody or cellular immune response against a Candida species are referred to herein as an immunogenic fragment. Exemplary functional fragments include the N-terminal polypeptide region of the Als protein family member described further below in Example VI. Exemplarily immogenic fragments include the N-terminal Als polypeptide region, the C-terminal Als polypeptide region as well as any other Als fragment that is sufficient to generate an antibody, cellular or both an antibody and cellular immune response. Such immogenic fragments can be as small as about four amino acids and as large as the intact polypeptide as well as include all polypeptide lengths in between.

An analogue or derivative of the surface adhesion protein according to the invention can be identified and further characterized by the criteria described herein for an ALS family member gene and/or gene product. For example, a null mutant of the analogue or derivative would share markedly reduced adhesion to endothelial cells compared to controls. Similarly, over-expression of the analogue or derivative in an appropriate model would show an increased adherence to endothelial cells compared to controls and would be confirmed as a cell surface adhesin in accord with the criteria described above. Also, antisera to an analogue or derivative can cross-react with anti-Als protein family member antibodies and can exhibit increased survival times when administered in a mouse model of disseminated candidiasis as disclosed herein.

The invention also provides a method of treating or preventing disseminated candidiasis. The method includes administering an immunogenic amount of a vaccine an isolated Als protein family member having cell adhesion or invasion activity, or an immunogenic fragment thereof, in a pharmaceutically acceptable medium. The vaccine can be administered with or without an adjuvant. The Als protein family member can be derived from different Candida strains as well as from different Candida species such as Candida albicans, Candida krusei, Candida tropicalis, Candida glabrata and Candida, parapsilosis. An Als protein family member used in the method of treating or prevention disseminated candidias includes Als1p, Als3p, Als5p, Als6p, Als7p and Als9p.

The effectiveness of the vaccines of the invention against different Candida strains, different Candida species, other bacteria and infectious agents and their wide range of immune activity are described further below and exemplified in the Examples. For example, Example V shows that anti-ALS antibodies are effective against mucosal and hematogenously disseminated candidal infections. Example VII shows that vaccination with rAls1p-N improves survival during murine disseminated candidiasis by enhancing cell-mediated immunity. Example VIII shows that the vaccines of the invention reduce fungal burden and improve survival in both immunocompetent and immunocompromised mice. Example IX shows the effectiveness of the ALS vaccines of the invention against S. aureus infections. Example X exemplifies that the vaccines of the invention are effective against different strains of C. albicans and against different species such as C. glabrata, C. krusei, C. parapsilosis and C. tropicalis as well as effectiveness in different animal models. Example XI also exemplifies the effectiveness of the different vaccines of the invention in different animal models as well as provides a comparison of the different responses elicited and potency of two representative ALS vaccines.

The invention further provided is a method of treating or preventing disseminated candidiasis that includes administering an effective amount of an isolated Als protein family member having cell adhesion activity, or an functional fragment thereof, to inhibit the binding or invasion of Candida to a host cell or tissue. The Als protein family member can be derived from Candida albicans, Candida krusei, Candida tropicalis, Candida glabrata, and Candida, parapsilosis. An Als protein family member used in the method of treating or prevention disseminated candidias includes Als1p, Als3p, Als5p, Als6p, Als7p and Als9p. The cell adhesion activity includes binding to gelatin, fibronectin, laminin, epithelial cells or endothelial cells and/or promoting cell invasion.

In addition, the invention also provides a method of treating or preventing Staphylococcus aureus infections using the Als protein family members described herein. In particular, the method of treating or preventing Staphylococcus aureus infections includes administering an immunogenic amount of a vaccine an isolated Als protein family member having cell adhesion activity, or an immunogenic fragment thereof, in a pharmaceutically acceptable medium.

Als1p and Als3p are particularly efficacious because of significant homology, to S. aureus cell surface proteins. The sequence and structural homology of, for example, Als1p and Als3p, are described further below in Example IX. Given the teachings and guidance provided herein, those skilled in the art will understand that the vaccines and methods of the invention can be applied to the treatment of Candida and Staphylococcus infections alike. Similarly, given the teachings and methods described herein, those skilled in the art also will understand that the vaccines and methods of the invention also can be applied to other pathogens having cell surface polypeptides with similar immunogenicity, sequence and/or structural homology to the Als protein family members described herein, including fungus, bacteria and the like.

Immunotherapeutic and/or Als polypeptide inhibition of cell adhesion or invasion strategies against Candida or Staphylococcus infection can operate at the level of binding to the vascular endothelial cells as well as through a downstream effector of the filamentation regulatory pathway. An immunotherapeutic strategy or inhibition of binding using a soluble Als protein family member or functional fragment is useful in this context because: (i) the morbidity and mortality associated with hematogenously disseminated candidiasis and other infectious pathogens remains unacceptably high, even with currently available antifungal therapy; (ii) a rising incidence of antifungal and antibiotic resistance is associated with the increasing use of antifungal and antibacterial agents, iii) the population of patients at risk for serious Candida and Staphylococcus infections is well-defined and very large, and includes post-operative patients, transplant patients, cancer patients and low birth weight infants; and iv) a high percentage of the patients who develop serious Candida infections are not neutropenic, and thus may respond to a vaccine or a competitive polypeptide or compound inhibitor. For these reasons, Candida and Staphylococcus are attractive fungal and bacterial targets for passive immunotherapy, active immunotherapy or a combination of passive or active immunotherapy. Additionally, Candida also is attractive for competitive inhibition using an Als protein family member polypeptide, functional fragment thereof and/or a compound or mimetic thereof that binds to one or more Als family members and prevents binding of Candida to a host cell receptor.

Given the teachings and guidance provided herein, those skilled in the art will understand that immunotherapeutic methods well know in the art can be employed with the Als protein family members of the invention, immunogenic fragments, analogues, conjugates, and/or derivatives thereof, to use one or more of the molecule as an immunogen in a pharmaceutically acceptable composition administered as a vaccine with or without an adjuvant. For the purposes of this invention, the terms “pharmaceutical” or “pharmaceutically acceptable” refer to compositions formulated by known techniques to be non-toxic and, when desired, used with carriers or additives that can be safely administered to humans. Administration can be performed using well known routes including, for example, intravenous, intramuscular, intraperitoneal or sub-cutaneous injection. Such vaccines of the inventions also can include buffers, salts or other solvents known to these skilled in the art to preserve the activity of the vaccine in solution. Similarly, any of a wide range of adjuvants well known in the art can be employed with the vaccine of the invention to elicit, promote or enhance a therapeutically effective immune response capable of reducing or blocking binding, invasion and/or infection of Candida or Staphylococcus to a susceptible host cell.

Similarly, given the teachings and guidance provided herein, those skilled in the art also will understand that therapeutic methods well known in the art for administering and selectively blocking the binding of cell surface molecules to their cognate receptors also can be employed with the Als protein family members of the invention, functional fragments, analogues, conjugates and/or derivatives thereof, to use one or more of the Als protein family member as an inhibitor in a pharmaceutically acceptable composition. As with vaccine formulations, inhibitory formulations can similarly be administered using well known method in the art including, for example, intravenous intramuscular, intraperitoneal or sub-cutaneous injection. Such inhibitory compositions that bind Als family member receptors and block an Als protein family member binding also can include buffers, salts or other solvents known to these skilled in the art to preserve the activity of the vaccine in solution. Further, any of a wide range of formulations well known in the art can be employed with the inhibitory compositions of the invention to target and/or enhance delivery or uptake so as to reduce or inhibit binding, invasion and/or infection of Candida or Staphylococcus to a susceptible host cell.

With respect to the molecule used as a therapeutic immunogen or receptor binding inhibitor pursuant to the present invention, those of skill in the art will recognize that the Als protein family member molecules can be truncated or fragmented without losing the essential qualities as an immunogenic vaccine or cell adhesion or invasion inhibitor. For example, an Als protein family member can be truncated to yield an N-terminal fragment by truncation from the C-terminal end with preservation of the functional properties described above and further below in the Examples. Similarly, C-terminal fragments can be generated by truncation from the N-terminal end with preservation of their functional properties. Other modifications in accord with the teachings and guidance provided herein can be made pursuant to this invention to create other Als protein family member functional fragments, immunogenic fragments, analogs or derivatives thereof, to achieve the therapeutically useful properties described herein with the native protein.

One aspect of the therapeutic effectiveness of Als protein family members and methods of the invention achieves interference with regulation of filamentation, to block adherence of the organism to host constituents, and to enhance clearance of the organism by immunoeffector cells and other physiological mechanisms. Since endothelial cells cover the majority of the vasculature, strategies to block the adherence, invasion and/or both of the organism to endothelial cells using antibodies, Als family member proteins, polypeptide or peptides or any combination thereof include useful embodiment of the present invention. As described previously, such adherence and/or invasion blocking therapies include active or passive immunotherapy or inhibitory binding directed against the candidal adhesins, invasins, or cognate receptors disclosed herein. Thus, for example, any suitable host can be injected with protein and the serum collected to yield the desired anti-adhesin antibody after appropriate purification and/or concentration. Prior to injection, the adhesin or invasin protein or a combination thereof, can be formulated in a suitable vehicle preferably a known immunostimulant such as a polysaccharide or delivery formulation such as liposomes or time-released compositions. Thus, according to a further aspect, invention provides a pharmaceutical composition comprising a candidal adhesin or invasin protein together with one or more pharmaceutically acceptable excipients in a formulation for use as a vaccine or Als receptor inhibitor.

The method of the invention is ameliorating and/or preventing candidal or Staphylococcus infection by blocking the adherence of C. albicans to the endothelial or epithelial cells of a host constituent or by, for example, antibody binding to the Staphylococcus and allowing immune mechanisms remove the pathogen. Thus, according to one aspect of the invention, a pharmaceutical composition comprising an Als protein family member adhesin or invasin protein, functional or immunogenic fragment, derivative, analogue, or conjugate thereof is formulated as a vaccine or Als receptor inhibitor in a pharmaceutical composition containing a biocompatible carrier for injection or infusion and is administered to a patient. Also, direct administration of antiserum raised against Als family member protein or isolated or recombinant Als family member protein can be used to block the adherence of C. albicans to a mammalian host constituent or effect the removal of a Staphylococcus pathogen. Antiserum against adhesin protein can be obtained by known techniques, Kohler and Milstein, Nature 256: 495-499 (1975), and may be humanized to reduce antigenicity, see U.S. Pat. No. 5,693,762, or produced in transgenic mice leaving an unrearranged human immunoglobulin gene, see U.S. Pat. No. 5,877,397. Similarly, isolated or recombinant Als protein family member also can be produced using methods well known to those skilled in the art including, for example, the recombinant production described in the Examples below.

A still further use of the invention, for example, is using the Als protein family member adhesin or invasin protein to develop vaccine strategies for the prevention and/or amelioration of candidal or Staphylococcus infections. Thus, according to one aspect of the invention, for example, standard immunology techniques can be employed to construct a multi-component vaccine strategy that can enhance and/or elicit immune response from a host constituent to bock adherence of C. albicans or to effect the elimination of Staphylococcus pathogens.

A still further use of the invention, for example, is developing DNA vaccine strategies. Thus, according to one aspect of the invention, for example, the ALS family member polynucleotides encoding Als protein family member adhesin or invasin or a functional fragment thereof is administered according to a protocol designed to yield an immune response to the gene product. See e.g., Feigner U.S. Pat. No. 5,703,055.

A still further use of the invention, for example, is developing combination vaccine strategies. Thus, according to one aspect of the invention, for example, anti-ALS protein family member antibodies may be used with antibodies in treating and/or preventing candidal or Staphylococcus infections. See U.S. Pat. No. 5,578,309.

The following Examples illustrate the immunotherapeutic utility of the ALS1 adhesin as the basis for preventive measures or treatment of dissemiated candidiasis. Example 1 describes the\'preparation of an ALS1 null mutant and a strain of C. albicans characterized by overexpression of ALS1 to confirm the mediation of adherence to endothelial cells. Example 2 describes the localization of Als1p and the implication of the efg filamentation regulatory pathway. Example 3 describes the purification of ALS1 adhesin protein. Example 4 describes the preparation of rabbit polyclonal antibodies raised against the ALS1 surface adhesin protein to be used to demonstrate the blocking of the surface adhesin protein. Example 5, describes the blocking of adherence in vivo, using polyclonal antibodies raised against the ALS1 surface adhesion protein as described herein according to the invention to protect against disseminated candidiasis in a mouse model. Example VI describes the structural and functional characteristics of Als protein family members.

It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also included within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.

The URA blaster technique was used to construct a null mutant of C albicans that lacks express of the Als1p. The als1/als1 mutant was constructed in C. albicans strain CAI4 using a modification of the Ura-blaster methodology (Fonzi and Irwin, Genetics 134, 717 (1993)) as follows: Two separate als1-hisG-IRA3-hisG-als1 constructs were utilized to disrupt the two different alleles of the gene. A 4.9 kb AsLSI coding sequence was generated with high fidelity PCR (Boehringer Mannheim, Indianapolis, Ind.) using the primers: 5′-CCCTCGAGATGCTTCAACAATTTACATTGTTA-3′ (SEQ ID NO:8) and 5′-CCGCTCGAGTCACTAAATGAACAAGGACAATA-3′ (SEQ ID NO:9). Next, the PCR fragment was cloned into pGEM-T vector (Promega, Madison, Wis.), thus obtaining pGEM-T-ALS1. The hisG-URA3-hisG construct was released from pMG-7 by digestion with Kpn1 and Hind3 and used to replace the portion of ALS1 released by Kpn1 and Hind3 digestion of pGEM-T-ALS1. The final als1-hisG-URA3-hisG-als1 construct was released from the plasmid by digestion with Xhol and used to disrupt the first allele of ALS1 by transformation of strain CAI-4.

A second als1-hisG-URA3-hisG-als1 construct was generated in two steps. First, a Bg12-Hind3 hisG-URA3-hisG fragment of pMB7 was cloned into the BamH1-Hind3 sites of pUC19, thereby generating pYC2. PYC2 was then digested with Hind3, partially filled in with dATP and dGTP using T4 DNA polymerase, and then digested with Sma1 to produce a new hisGURA3-hisG fragment. Second, to generate ALS1 complementary flanking regions, pGEM-T-ALS1 was digested with Xbal and then partially filled in with dCTP and dTTP. This fragment was digested with Hpa1 to delete the central portion of ALS1 and then ligated to the hisG-URA3-hisG fragment generating pYC3. This plasmid was then digested by Xhol to release a construct that was used to disrupt the second allele of the ALS1. Growth curves were done throughout the experiment to ensure that the generated mutations had no effect on growth rates. All integrations were confirmed by Southern blot analysis using a 0.9 kb ALS1 specific probe generated by digestion of pYF5 with XbaI and HindIII.

The null mutant was compared to C. albicans CAI-12 (a URA+revertant strain) for its ability to adhere in vitro to human umbilical vein endothelial cells. For adherence studies, yeast cells from YPD (2% glucose, 2% peptone, and 1% yeast extract) overnight culture, were grown in RPMI with glutamine at 25° C. for 1 hour to induce Als1p expression. 3×102 organisms in Hanks balanced salt solution (HBSS) (Irvine Scientific, Irvine, Calif.) were added to each well of endothelial cells, after which the plate was incubated at 37° C. for 30 minutes. The inoculum size was confirmed by quantitative culturing in YPD agar. At the end of incubation period, the nonadherent organisms were aspirated and the endothelial cell monolayers were rinsed twice with HBSS in a standardized manner. The wells were over laid with YPD agar and the number of adherent organisms were determined by colony counting. Statistical treatment was obtained by Wilcoxon rank sum test and corrected for multiple comparisons with the Bonferroni correction. P<0.001.

Referring to FIG. 1, a comparison of the ALS1/ALS1 and als1/als1 strain showed that the ALS1 null mutant was 35% less adherent to endothelial cells than C. albicans CAI-12. To reduce background adherence, the adherence of the wild-type strain grown under non-ALS1 expressing conditions was compared with a mutant autonomously expressing Als1p. This mutant was constructed by integrating a third copy of ALS1 under the control of the constitutive ADH1 promoter into the wild-type C. albicans. To achieve constitutive expression of the ALS1 in C. albicans, a blunt-ended PCR generated URA3 gene is ligated into a blunt-edged Bg12 site of pOCUS-2 vector (Novagen, Madison, Wis.), yielding pOU-2. A 2.4 kb Not1-Stul fragment, which contained C. albicans alcohol dehydrogenase gene (ADH1) promoter and terminator (isolated from pLH-ADHpt, and kindly provided by A. Brown, Aberdeen, UK), was cloned into pOU-2 after digestion with Not1 and Stul. The new plasmid, named pOAU-3 had only one Bg12 site between the ADH1 promoter and terminator. ALS1 coding sequence flanked by BamH1 restriction enzyme sites was generated by high fidelity PCR using pYF-5 as a template and the following primers: 5′-CGGGATCCAGATGCTTCA-ACAATTTACATTG-3′ (SEQ ID NO:10) and 5′-CGGGATCCTCACTAATGAACAAGGACAATA-3′ (SEQ ID NO:11). This PCR fragment was digested with BamH1 and then cloned into the compatible Bg12 site of pOAU-3 to generate pAU-1. Finally, pAU-1 was linearized by XbaI prior to transforming C. albicans CAI-4. The site-directed integration was confirmed by Southern Blot analysis. Referring to FIG. 1B, overexpressing ALS1 in this PADH1-ALS1 strain resulted in a 76% increase in adherence to endothelial cells compared to the wild-type C. albicans. In comparing endothelial cell adherence of the wild-type to that of the overexpressing mutant, yeast cells were grown overnight in YPD at 25° C. (non-inducing condition of Als1p). Als1p expression was not induced to reduce the background adherence of the wile-type, thus magnifying the role of Als1p in adherence through PADH1-ALS1 hybrid gene. The adherence assay was carried out as described above. Statistical treatment was obtained by Wilcoxon rank sum test and corrected for multiple comparisons with the Bonferroni correction. P<0.001.

A monoclonal anti-Als1p murine IgG antibody was raised against a purified and truncated N-terminus of Als1p (amino acid #17 to #432) expressed using Clontech YEXpress™ Yeast Expression System (Palo Alto, Calif.). The adherence blocking capability of these monoclonal anti-Als1p antibodies was assessed by incubating C. albicans cells with either anti-Als1 antibodies or mouse IgG (Sigma, St. Louis, Mo.) at a 1:50 dilution. After which the yeast cells were used in the adherence assay as described above. Statistical treatment was obtained by Wilcoxon rank sum test and corrected for multiple comparisons with the Bonferroni correction. P<0.001. The results revealed that the adherence of the PADH1-ALS1 strain was reduced from 26.8%±3.5% to 14.7%±5.3%. Thus, the effects of ALS1 deletion and overexpression demonstrate that Als1p mediates adherence of C. albicans to endothelial cells.

For Als1p to function as an adhesin, it must be located on the cell surface. The cell surface localization of Als1p was verified using indirect immunofluorescence with the anti-Als1p monoclonal antibody. Diffuse staining was detected on the surface of blastospores during exponential growth. This staining was undetectable on blastospores in the stationary phase. Referring to FIG. 2A, when blastospores were induced to produce filaments, intense staining was observed that localized exclusively to the base of the emerging filament. No immunofluorescence was observed with the als1/als1 mutant, confirming the specificity of this antibody for Als1p. See FIG. 2B. These results establish that Als1p is a cell surface protein.

The specific localization of Als1p to the blastospore-filament junction implicates Als1p in the filamentation process. To determine the mechanism, the filamentation phenotype of the C. albicans ALS1 mutants was analyzed. Referring to FIG. 3A, the als1/als1 mutant failed to form filaments after a 4 day incubation on Lee\'s solid medium, while both the ALS1/ALS1 AND ALS1/als1 strains as well as the ALS1-complemented mutant produced abundant filaments at this time point. The als1/als1 mutant was capable of forming filaments after longer periods of incubation. Furthermore, overexpressing ALS1 augmented filamentation: the PADH1-ALS1 strain formed profuse filaments after a 3 day incubation, whereas the wild-type strain produced scant filaments at this time point. See FIG. 3B. To further confirm the role of Als1p in filamentation, a negative control was provided using mutant similar to the ALS1 overexpression mutant, except the coding sequence of the ALS1 was inserted in the opposite orientation. The filamentation phenotype of the resulting strain was shown to be similar to that of the wild-type strain. The filament-inducing properties of Als1p are specific to cells grown on solid media, because all of the strains described above filamented comparably in liquid media. The data demonstrates that Als1p promotes filamentation and implicates ALS1 expression in the regulation of filamentation control pathways. Northern blot analysis of ALS1 expression in mutants with defects in each of these pathways, including efg1/efg1, cph1/cph1, efg1/efg cph1/cph1, tup1/tup1, and cla4/cla4 mutants were performed. Referring to FIG. 4A, mutants in Which both alleles of EFG1 had been disrupted failed to express ALS1. Introduction of a copy of wild-type EFG1 into the efg1/efg1 mutant restored ALS1 expression, though at a reduced level. See FIG. 4B. Also, as seen in FIG. 4A, none of the other filamentation regulatory mutations significantly altered ALS1 expression (FIG. 4A). Thus, Efg1p is required for ALS1 expression.

If Efg1p stimulates the expression of ALS1, which in turn induces filamentation, the expression of ALS1 in the efg1/efg1 strain should restore filamentation. A functional allele of ALS1 under the control of the ADH1 promoter was integrated into the efg1/efg1 strain. To investigate the possibility that ALS1 gene product might complement the filamentation defect in efg1 null mutant, an Ura efg1 null mutant was transformed with linearized pAU-1. Ura+ clones were selected and integration of the third copy of ALS1 was confirmed with PCR using the primers: 5′-CCGTTTATACCATCCAATC-3′ (SEQ ID NO:13) and 5′-CTACA TCCTCCAATGATATAAC-3′ (SEQ ID NO:14). The resulting strain expressed ALS1 autonomously and regained the ability to filament on Lee\'s agar. See FIGS. 4B and C. Therefore, Efg1p induces filamentation through activation of ALS1 expression.

Because filamentation is a critical virulence factor in C. albicans delineation of a pathway that regulates filamentation has important implications for pathogenicity. Prior to ALS1, no gene encoding a downstream effector of these regulatory pathways had been identified. Disruption of two other genes encoding cell surface proteins, HWP1 AND INTI, results in mutants with filamentation defects. Although HWP1 expression is also regulated by Efg1p, the autonomous expression of HWP1 in the efg1/efg1 mutant fails to restore filamentation. Therefore Hwplp alone does not function as an effector of filamentation downstream of EFG1. Also, the regulatory elements controlling INT1 expression are not know. Thus, Als1p is the first cell-surface protein identified that functions as a downstream effector of filamentation, thereby suggesting a pivotal role for this protein in the virulence of C. albicans.

The contribution of Als1p to C. albicans virulence was tested in a model of hematogenously disseminated candidiasis, A. S. Ibrahim et al., Infect. Immun. 63, 1993 (1995). Referring to FIG. 5A, mice infected with the als1/als1 null mutant survived significantly longer than mice infected with the ALS1/ALS1 strain, the ALS1/als1 mutant or the ALS1-complemented mutant. After 28 hours of infection, the kidneys of mice infected with the als1/als1 mutant contained significantly fewer organisms (5.70±0.46 log10 CFU/g) (P<0.0006 for both comparisons). No difference was detected in colony counts of organisms recovered from spleen, lungs, or liver of mice infected with either of the strains at any of the tested time points. These results indicate that Als1p is important for C. albicans growth and persistence in the kidney during the first 28 hours of infection. Referring to FIG. 5B, examination of the kidneys of mice after 28 hours of infection revealed that the als1/als1 mutant produced significantly shorter filaments and elicited a weaker inflammatory response than did either the wild-type of ALS1-complemented strains. However, by 40 hours of infection, the length of the filaments and the number of leukocytes surrounding them were similar for all three strains.

The filamentation defect of the als1/als1 mutant seen on histopathology paralleled the in vitro filamentation assays on solid media. This mutant showed defective filamentation at early time points both in vivo and in vitro. This defect eventually resolved with prolonged infection/incubation. These results suggest that a filamentation regulatory pathway that is independent of ALS1 may become operative at later time points. The activation of this alternative filamentation pathway by 40 hours of infection is likely the reason why mice infected with the als1/als1 mutant subsequently succumbed in the ensuing 2-3 days.

Collectively, these data demonstrate that C. albicans ALS1 encodes a cell surface protein that mediates both adherence to endothelial cells and filamentation. Als1p is the only identified downstream effector of any known filamentation regulatory pathway in C. albicans. Additionally, Als1p contributes to virulence in hematogenous candidal infection. The cell surface location and dual functionality of Als1p make it an attractive target for both drug and immune-based therapies.

The ALS1 protein synthesized by E. coli is adequate as an immunogen. However eukaryotic proteins synthesized by E. coli may not be functional due to improper folding or lack of glycosylation. Therefore, to determine if the ALS1 protein can block the adherence of C. albicans to endothelial cells, the protein is, preferably, purified from genetically engineered C. albicans.

PCR was used to amplify a fragment of ALS1, from nucleotides 52 to 1296. This 1246 bp fragment encompassed the N-terminus of the predicted ALS1 protein from the end of the signal peptide to the beginning of the tandem repeats. This region of ALS1 was amplified because it likely encodes the binding site of the adhesin, based on its homology to the binding region of the S. cerevisiae Aga1 gene product. In addition, this portion of the predicted ALS1 protein has few glycosylation sites and its size is appropriate for efficient expression in E. coli.

The fragment of ALS1 was ligated into pQE32 to produce pINS5. In this plasmid, the protein is expressed under control of the lac promoter and it has a 6-hits tag fused to its N-terminus so that it can be affinity purified. We transformed E. coli with pINS5, grew it under inducing conditions (in the presence of IPTG), and then lysed the cells. The cell lysate was passed through a Ni2+-agarose column to affinity purify the ALS1-6His fusion protein. This procedure yielded substantial amounts of ALS1-6His. The fusion protein was further purified by SDS-PAGE. The band containing the protein was excised from the gel so that polyclonal rabbit antiserum can be raised against it. It will be appreciated by one skilled in the art that the surface adhesin protein according to the invention may be prepared and purified by a variety of known processes without departing from the spirit of the present invention. The sequence of Als1p is listed in FIG. 7.

To determine whether antibodies against the ALS1 protein block the adherence of Candida albicans to endothelial and epithelial cells, and the selected host constituent in vitro, rabbits were inoculated with S. cerevisiae transformed with ALS1 protein. The immunization protocol used was the dose and schedule used by Hasenclever and Mitchell for production of antisera that identified the antigenic relationship among various species of Candida. Hasenclever, H. F. and W. O. Mitchell. 1960. Antigenic relationships of Torulopsis glabrata and seven species of the genus Candida. J. Bacteriol. 79:677-681. Control antisera were also raised against S. cerevisiae transformed with the empty plasmid. All yeast cells were be grown in galactose to induce expression of the ALS genes. Before being tested in the adherence experiments, the serum was heat-inactivated at 56 C to remove all complement activity.

Sera from immunized rabbits were absorbed with whole cells of S. cerevisiae transformed with empty plasmid to remove antibodies that are reactive with components of the yeast other than ALS1 protein. The titer of the antisera was determined by immunofluorescence using S. cerevisiae that express the ALS1 gene. FITC-labeled anti-rabbit antibodies were purchased from commercial sources (Southern Biotechnology, Inc). Affinity-purified secondary antibodies were essential because many commercially available sera contain antibodies reactive with yeast glucan and mannan. The secondary antibodies were pretested using Candida albicans as well as S. cerevisiae transformed with the plasmid and were absorbed as needed to remove any anti-S. cerevisiae or anti-Candida antibodies. Negative controls were 1) preimmune serum 2) S. cerevisiae transformed with the empty plasmid, and 3) S. cerevisiae transformed with the ALS gene but grown under conditions that suppress expression of the ALS gene (glucose).

In addition to the above experiments, Western blotting was used to provide further confirmation that an antiserum binds specifically to the ALS protein against which it was raised. S. cerevisiae transformed with the ALS1 were grown under inducing conditions and their plasma membranes were isolated by standard methods. Panaretou R and P. Piper. 1996. Isolation of yeast plasma membranes. p. 117-121. In I. H. Evans. (ed.), Yeast Protocols. Methods in Cell and Molecular Biology. Humana Press, Totowa, N.J. Plasma membranes were also prepared from S. cerevisiae transformed with the empty plasmid and grown under identical conditions. The membrane proteins were separated by SDS-PAGE and then transferred to PVDF membrane by electroblotting. Harlow, E. and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press. After being blocked with nonfat milk, the blot was incubated with the ALS antiseru. The preabsorbed antiserum did not react with proteins extracted from S. cerevisiae containing empty plasmid. This antiserum blocked the adherence of S. cerevisiae pYF5 (a clone that expresses Candida albicans ALS1) to endothelial cells.

Having identified the antisera that block the adherence of a clone of S. cerevisiae transformed with an ALS gene under the above conditions, these antisera were demonstrated to protect mice from intravenous challenge with Candida albicans.

The antisera against the ALS proteins were first tested in the murine model of hematogenously disseminated candidiasis. Affinity-purified anti-ALS antibodies are effective in preventing adhesion of yeast cells to various substrates (see EXAMPLE 3). Affinity-purification is useful in this system because antibody doses can be accurately determined. Moreover, the unfractionated antisera will undoubtedly contain large amounts of antibody directed toward antigens on the S. cerevisiae carrier cells. Many of these anti-Saccharomyces antibodies would likely bind to C. albicans and make interpretation of the results impossible. Additionally, it is quite possible that the procedure used to elute antibodies from S. cerevisiae that express the ALS protein may also elute small amounts of yeast mannan or glucan that could have adjuvant-like activity. The immunoaffinity-purified antibodies are further purified before use. They may also be preabsorbed with mouse splenocytes.

Antibody doses may be administered to cover the range that brackets the levels of serum antibody that can be expected in most active immunization protocols and to cover the range of antibody doses that are typically used for passive immunization in murine models of candidiasis. See Dromer, F., J. Charreire, A. Contrepois, C. Carbon, and P. Yeni. 1987, Protection, of mice against experimental cryptococcosis by anti-Cryptococcus neoformwns monoclonal antibody, Infect. Immun. 55:749-752; Han, Y. and J. E. Cutler. 1995, Antibody response that protects against disseminated candidiasis, Infect. Immun. 63:2714-2719; Mukherjee, J., M. D. Scharff, and A. Casadevall. 1992, Protective murine monoclonal antibodies to Cryptococcus neoformwns, Infect. Immun. 60:4534-4541; Sanford, J. E., D. M. Lupan, A. M. Schlageter, and T. R. Kozel. 1990, Passive immunication against Cryptococcus neoformans with an isotype-switch family of monoclonal antibodies reactive with cryptococcal polysaccharide, Infect. Immun. 58:1919-1923. BALB/c Mice (femal, 7 week old, the NCI) were given anti-ALS that had been absorbed with mouse splenic cells by an intraperitoneal (i.p.) injection. Control mice received prebled serum that had been absorbed with mouse spenic cells, intact anti-ALS serum, or DPBS, respectively. For the pre-absorption, 2 ml of anti-ALS or prebled sera were mixed with 100 μl of mouse (BALB/c, 7 weeks old female, NCI) splenic cells (app. 9×106 cells per ml) at room temperature for 20 minutes. The mixture was washed with warm sterile DPBS by centrifugation (@300×g) for 3 minutes. This procedure was repeated three times. The volume of i.p. injection was 0.4 ml per mouse. Four hours later, the mice were challenged with C. albicans (strain CA-1; 5×105 hydrophilic yeast cells per mouse by i.v. injection. Then, their survival times were measured. See FIG. 6.

Previous studies have shown that antibodies administered via the intraperitoneal route are rapidly (within minutes) and almost completely transferred to the serum (Kozel and Casadevall, unpublished observations). As a control for effects of administering the antibody preparations, a parallel group of mice were treated with antibodies isolated from pre-immune serum that has been absorbed with S. cerevisia transformed with the ALS gene. The survival time and numbers of yeast per gram of kidney were measured. Again, referring to FIG. 6, mice infected intravenously with 106 blastopores of ALS1 null mutant had a longer median survival time when compared to mice infected with Candida albicans CAI-12 or Candid albicans in which one allele of the ALS1 had been deleted (p=0.003).

These results indicate that immunotherapeutic strategies using the ALS1 proteins as a vaccine have a protective prophylactic effect against disseminated candidiasis.

Isolation and characterized of the C. albicans ALS1 gene by heterologous complementation of nonadherent S. cerevisiae has been previously described (Fu et al., Infect. Immun. 66:1783-1786 (1998)). ALS1 encodes a cell surface protein that mediates adherence to endothelial and epithelial cells. Disruption of both copies of this gene in C. albicans is associated with a 35% reduction in adherence to endothelial cells, and overexpression of ALS1 increases adherence by 125% (Fu et al., Mol. Microbiol. 44:61-72 (2002)).

ALS1 is a member of a large C. albicans gene family consisting of at least eight members originally described by Hoyer et al. (Hoyer et al., Trends Microbiol. 9:176-180 (2001), Zhao et al., Microbiology 149:2947-2960 (2003)). These genes encode cell surface proteins that are characterized by three domains. The N-terminal region contains a putative signal peptide and is relatively conserved among Als proteins. This region is predicted to be poorly glycosylated (Zhao et al., Microbiology 149:2947-2960 (2003), Hoyer et al., Genetics 157:1555-1567 (2001)). The central portion of these proteins consists of a variable number of tandem repeats (˜36 amino acids in length) and is followed by a serine-threonine-rich C-terminal region that contains a glycosylphosphatidylinositol anchor sequence (supra). Whereas the proteins encoded by this gene family are known to be expressed during infection (Hoyer et al., Infect. Immun. 67:4251-4255 (1999), Zhang et al., Genome Res. 13:2005-2017 (2003)), the function of the different Als proteins has not been investigated in detail.

Heterologous expression of Als proteins in nonadherent S. cerevisiae was performed to evaluate the function of Als proteins and to avoid the high background adherence mediated by the multiple other adhesins expressed by C. albicans. This heterologous expression system has been used extensively for the study of C. albicans genes, including the isolation and characterization of the adhesins ALS1, ALS5, and EAP1 (Li et al., Eukaryot Cell 2:1266-1273 (2003), Fu et al, Infect. Immun. 66:1783-1786 (1998), Gaur et al., Infect. Immun. 65:5289-5294 (1997)). As described further below, using this model system Als proteins were demonstrated to have diverse adhesive and invasive functions. Consistent with these results, homology modeling indicated that Als proteins are closely related in structure to adhesin and invasin members of the immunoglobulin superfamily of proteins. Structural analyses using CD and Fourier transform infrared (FTIR) 1 spectrometry confirmed that the N-terminal domain of Als1p is composed of anti-parallel β sheet, turn, α-helical, and unstructured domains consistent with the structures of other members of the immunoglobulin superfamily. Finally, comparative energy-based models suggest differences in key physicochemical properties of the N-terminal domains among different Als proteins that may govern their distinct adherence and invasive biological functions.

To clone ALS family members and express them in S. cerevisiae, ALS1, -3, -5, -6, -7, and -9 were successfully amplified and expressed as described below. Briefly, for cloning and other culture steps, S. cerevisiae strain S150-2B (leu2 his3 trp1 ura3) was used for heterologous expression as has been described previously (Fu et al., Infect. Immun. 66:2078-2084 (1998)). C. albicans strain SC5314 was used for genomic cloning. All strains were grown in minimal defined medium (1× yeast nitrogen base broth (Difco), 2% glucose, and 0.5% ammonium sulfate, supplemented with 100 μg/ml L-leucine, -L tryptophan, L-histidine, and adenine sulfate) solidified with 1.5% bacto-agar (Difco) as needed. Growth of ura-strains was supported by the addition of 80 μg/ml uridine (Sigma). Plasmids pGK103, containing ALS5, pYF5, containing ALS1, and pALSn, containing ALS9, have been described previously (Fu et al., Infect. Immune. 66:1783-1786 (1998), Gaur et al., Infect. Immune. 65:5289-5297 (1997), Lucinod et al., Proceedings of the 102nd Annual Meeting of the American Society for Microbiology, pp. 204, American Society for Microbiology, Salt Lake City, Utah. (2002)). Plasmid pADH1, obtained from A. Brown (Aberdeen, UK) contains the C. albicans alcohol dehydrogenase gene (ADH1) promoter and terminator, which are functional in S. cerevisiae (Bailey et al., J. Bacteriol. 178:5353-5360 (1996)). This plasmid was used for constitutive expression of ALS genes in S. cerevisiae.

Human oral epithelial and vascular endothelial cells were obtained and cultured as follows. The FaDu oral epithelial cell line, isolated from a pharyngeal carcinoma, was purchased from the American Type Culture Collection (ATCC) and maintained as per their recommended protocol. Endothelial cells were isolated from umbilical cord veins and maintained by our previously described modification of the method of Jaffe et al. (Fu et al., Mol. Microbiol. 44:61-72 (2002), Jaffe et al., J. Clin. Invest. 52:2745-2756 (1973)). All cell cultures were maintained at 37° C. in a humidified environment containing 5% CO2.

For cloning the ALS genes, genomic sequences of members of the ALS family were identified by BLAST searching of the Stanford data base (available on the World Wide Web at URL: sequence.stanford.edu/group/candida/search.html). PCR primers were generated to specifically amplify each of the open reading frames that incorporated a 5′ BglII and a 3′ XhoI restriction enzyme site and are shown below in Table I (SEQ ID NOS:14-19 (ALS 1, 3, 5, 6, 7 and 9 sense primers, respectively); SEQ ID NOS:20-25 ((ALS 1, 3, 5, 6, 7 and 9 antisense primers, respectively)). Each gene was cloned by PCR using the Expand® High Fidelity PCR system (Roche Applied Science). ALS3, ALS6, and ALS7 were amplified from C. albicans SC5314 genomic DNA, whereas ALS1, ALS5, and ALS9 were amplified from plasmids that had been previously retrieved from C. albicans genomic libraries (Fu et al., Infect. Immune. 66:1783-1786 (1998), Gaur et al., Infect. Immune. 65:5289-5297 (1997), Lucinod et al., Proceedings of the 102nd Annual Meeting of the American Society for Microbiology, pp. 204, American Society for Microbiology, Salt Lake City, Utah. (2002)). PCR products were ligated into pGEM-T-Easy (Promega) for sequencing. Sequence-verified ALS open reading frames were then released from pGEM-T-Easy by BglII-XhoI co-digestion and ligated into pADH1, such that the ALS gene of interest was under the control of the ADH1 promoter. S. cerevisiae strain S150-2B was transformed with each of the ALS overexpression constructs as well as the empty pADH1 construct using the lithium acetate method. Expression of each ALS gene in S. cerevisiae was verified by Northern blot analysis before phenotypic analyses were performed.

TABLE I PCR primers used to amplify the coding regions of ALS gene for heterologous expression in S. cerevisia ALS gene Sense (5′-3′) Antisense (5′-3′) ALS1 AGATCTCAGATGCTTCAACAATTTA CTCGAGTCACTAAATGAA CATTG CAAGGACAATA ALS3 GAAGATCTATGCTACAACAATATAC CCGCTCGAGTTAAATAAA ATTGTTACTC CAAGGATAATAATGTGATC ALS5 AGATCTCAACTACCAACTGCTAACA CTCGAGACCATATTATTTG GTACAATC ALS6 AGATCTCATTCACCGACAATGAAGA CTCGAGTTGGTACAATCCC CA GTTTGA ALS7 AGATCTTCAACAGTCTAATACCTAT CTCGAGACTTGATTGAATT GA ATACCATATA ALS9 AGATCTCGAATGCTACCACAATTCC CTCGAGTCTTAGCACCCTG TA ACGTAGCT

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Pharmaceutical compositions and methods to vaccinate against disseminated candidiasis and other infectious agents patent application.
###


Other recent patent applications listed under the agent :