Methods and compositions for treating neuropathic pain   

The present application is a divisional application of U.S. application Ser. No. 11/101,906 filed Apr. 8, 2005, which claims priority to U.S. Provisional Patent Application Ser. No. 60/560,535, filed Apr. 8, 2004, and U.S. Provisional Patent Application Ser. No. 60/567,757, filed Jun. 2, 2004, the disclosures of which are hereby incorporated by reference in their entireties.

This application contains a sequence listing provided in the form of a text file named SEQTXT—019496-009020US.TXT, which was created on Apr. 20, 2010 and containing 40,960 bytes. The information contained in this file is hereby incorporated by reference in its entirely.

Neuropathic pain, also referred to as a chronic pain, is a complex disorder resulting from injury to the nerve, spinal cord or brain. There is evidence that nerve fibers in subjects with neuropathic pain develop abnormal excitability, particularly hyper-excitability, Zimmerman (2001) Eur J Pharmacol 429(1-3):23-37. Although the American Pain Society estimates that nearly 50 million Americans are totally or partially disabled by pain, there are currently very few effective, well-tolerated treatments available. Wetzel et al. (1997) Ann Pharmacother 31(9):1082-3). Indeed, existing therapeutics cause a range of undesirable side effects primarily due to the difficulty in developing small-molecule drugs capable of specifically targeting the receptor/channel of choice.

Studies have shown the existence of primary sensory neurons that can be excited by noxious heat, mechanical damage, intense pressure or irritant chemicals, but not by innocuous stimuli such as warmth or light touch. These nociceptors selectively detect pain-inducing stimuli and appear to be distinct from other sensory mechanisms. This suggests that by suppressing the molecular mechanism of nociception it might be possible to limit the perception of painful stimuli without compromising general sensory awareness.

Transduction of noxious stimuli in nociception is mediated by cellular receptors that typically include non-selective ion channels (e.g., vanilloid receptor, VR1), sodium ion channels (e.g., PN3/NaV1.8), tyrosine receptor kinases (e.g., TrkA), and GPCRs (e.g., bradykinin receptors). The majority of these receptors are expressed only in neuronal cells that are involved in both chronic and acute nociception, making them possible targets for therapeutic intervention aimed at limiting the pain response. Conventional therapeutic approaches typically focus on attempting to identify ligands that function as antagonists for these receptors. However, a major barrier to this approach is the cross-reactivity of receptor antagonists with other receptors of similar structure that are distinct from the pain-related targets.

The study of the molecular mechanisms triggering neuropathic pain has identified several genes that are abnormally expressed in sensory neurons of the Dorsal Root Ganglion (DRG) in models of neuropathic pain, including Vanilloid Receptor 1 (VR1), a non-selective cationic channel responding to thermal, pH and capsacin stimulation (Hudson et al. (2001) Eur J Neurosci 13(11):2105-2114; Walker et al. (2003) J. Pharmacol. Exp Ther 304(1):56-62; Tyrosine kinase A receptor or high-affinity NGF receptor (TRKA), which has been shown to be upregulated in DRG neurons after chronic spinal cord injury (Qiao et al. (2002) J. Comp Neurol. 449(3):217-230); (iii) the sodium channel Nav1.8 (also referred to as PN3 or SCN10A) (Coward et al. (2000) Pain 85(1-2):41-50); and nitric oxide synthase (NOS) (Zimmerman, supra). Lai et al. (2002) Pain 95(1-2):143-152, showed that reduced levels of Nav1.8 correlate with inhibition of neuropathic pain in the rat spinal nerve injury model of chronic pain.

However, the modulation of genes aberrantly expressed in neuropathic pain has not been previously described. Furthermore, the ability to alter expression of these genes may have utility in treating and/or preventing many forms of pain.

SUMMARY

A variety of zinc finger proteins (ZFPs) and methods utilizing such proteins are provided for use in treating neuropathic pain. ZFPs that bind to a target site in genes that are aberrantly expressed in subjects having neuropathic pain are described. In addition, ZFPs that bind to a target site in genes expressed at normal levels in subjects experiencing neuropathic pain, modulation of whose expression results in decreased pain perception, are also provided. For example, using the methods and compositions described herein, genes that are over-expressed in the dorsal root ganglia (DRG) of pain patients (e.g., VR1, TRKA and/or Nav1.8) can be repressed, while genes that are under-expressed in the same populations can be activated.

The ZFPs can be fused to a regulatory domain as part of a fusion protein. By selecting either an activation domain or a repression domain for fusion with the ZFP, one can either activate or repress gene expression. Thus, by appropriate choice of the regulatory domain fused to the ZFP, one can selectively modulate the expression of a target gene and hence various physiological processes correlated with neuropathic pain.

By engineering ZFPs that bind to (and modulate expression of) genes encoding molecular targets involved in neuropathic pain to varying degrees, the extent to which a physiological process (e.g., pain) is modulated can be varied, thereby enabling treatment to be tailored. This can be achieved because multiple target sites (e.g., 9, 12 or 18 base pair target sites) in any given gene can be acted upon by the ZFPs provided herein. Thus, in some methods, a plurality of ZFPs (or fusions comprising these ZFPs) is administered. These ZFPs can then bind to different target sites located within a single target gene (e.g., VR1, TRKA, Nav1.8, etc.). Alternatively, the ZFPs can bind to target sites in different genes (e.g., two or more of VR1, TRKA, NAV1.8, etc.). Such ZFPs can in some instances have a synergistic effect. In certain methods, the plurality of fusion proteins includes different regulatory domains.

Also provided herein are polynucleotides and nucleic acids that encode the ZFPs disclosed herein. Additionally, pharmaceutical compositions containing the nucleic acids and/or ZFPs are also provided. For example, certain compositions include a nucleic acid that encodes one of the ZFPs described herein operably linked to a regulatory sequence, combined with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence allows for expression of the nucleic acid in a cell. Protein-based compositions include a ZFP as disclosed herein and a pharmaceutically acceptable carrier or diluent.

These and other embodiments will readily occur to those of ordinary skill in the art in view of the disclosure herein.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a graph depicting repression of VR1 gene expression in rat cells transfected with a plasmid encoding a fusion of a KOX repression domain and a VR1-targeted ZFP (designated 6332, 6337, 6338). The fusion proteins are designated 6332-KOX, 6337-KOX, and 6338-KOX. “NTC” refers to a non-transfected control.

FIG. 2 is a graph depicting repression of VR1 gene expression in rat cells transfected with a plasmid encoding a fusion of a KOX repression domain and a VR1-targeted ZFP (designated 6144, 6149, 6150). The fusion proteins are designated 6144-KOX, 6149-KOX, and 6150-KOX. “eGFP” refers to an enhanced Green Fluorescent Protein (GFP) control.

FIG. 3 is a graph depicting results of FACS and shows repression of VR1 protein levels in rat cells transfected with a plasmid encoding 6144-KOX, 6149-KOX, 6150-KOX a fusion of a KOX repression domain and a VR1-targeted ZFP (designated 6144, 6149, 6150). The fusion proteins are designated 6144-KOX, 6149-KOX, 6150-KOX, 6332-KOX, 6337-KOX, and 6338-KOX. “GFP” refers to FACS results obtained with a GFP control.

FIG. 4 is a graph depicting repression of TrkA gene expression by in rat cells transfected with a plasmid encoding a fusion of a KOX repression domain and a TrkA-targeted ZFP (designated 6182, 6297) and a plasmid encoding puromycin resistance. Puromycin selection is used to kill untransfected cells. The fusion proteins are designated 6182-KOX and 6297-KOX. “Puromycin cntrl” refers to controls co-transfected with a control plasmid and the plasmid encoding puromycin resistance.

FIG. 5 is a graph depicting results of FACS and showing repression of TrkA protein levels in rat cells co-transfected with a plasmid encoding 6182-KOX or 6297-KOX and a plasmid encoding puromycin resistance. “Puromycin cntrl” refers to controls co-transfected with a control plasmid and the plasmid encoding puromycin resistance.

FIG. 6 is a graph depicting repression of NAV1.8 in human cells transfected with a plasmid encoding a fusion of a KOX repression domain and a NAV1.8-targeted ZFP (designated 6584, 6585, 6586, 6587, 6590, 6591, 6621, and 6622). The fusion proteins are designated 6584-KOX, 6585-KOX, 6586-KOX, 6587-KOX, 6590-KOX, 6591-KOX, 6621-KOX, and 6622-KOX. “eGFP” refers to an enhanced Green Fluorescent Protein (GFP) control.

FIG. 7 is a graph showing levels of human TrkA mRNA, normalized to human GAPDH mRNA, in K562 cells transfected with plasmids encoding ZFP/KOX fusion proteins. The identity of the encoded protein is shown on the abscissa: EF-1a refers to the promoter controlling expression of the fusion protein; Kox refers to the presence of a KOX repression domain in the encoded protein, and the number refers to the particular TrkA-targeted zinc finger binding domain (see Tables 1 and 5 for DNA target sequences and recognition domain amino acid sequences, respectively, for these zinc finger domains). EF-1aGFPKox and pBluescript are control plasmids: EF-1aGFPKox lacks an engineered zinc finger binding domain; pBluescript is a vector lacking sequences encoding a fusion protein. Bars show the standard error of the mean for duplicate determinations.

FIG. 8 is an autoradiographic image of a protein blot in which lysates from cells transfected with plasmids encoding TrkA-targeted ZFP/KOX fusion proteins were analyzed. The top panel shows assays for the presence of TrkA and TFIIB. The lower panel shows assays for the presence of the zinc finger/Kox fusion proteins, using a primary mouse anti-FLAG M2 monoclonal antibody and a donkey anti-mouse IgG-horseradish peroxidase secondary antibody. Abbreviations and protein identifications are the same as in FIG. 7.

DETAILED DESCRIPTION

Practice of the methods, as well as preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et af. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor .Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, “Chromatin” (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, “Chromatin Protocols” (P. B. Becker, ed.) Humana Press, Totowa, 1999.

The term “zinc finger protein” or “ZFP” .refers to a protein having DNA binding domains that are stabilized by zinc. The individual DNA binding domains are typically referred to as “fingers.” A ZFP has least one finger, typically two, three, four, five, six or more fingers. Each finger binds from two to four base pairs of DNA, typically three or four base pairs of DNA. A ZFP binds to a nucleic acid sequence called a target site or target segment. Each finger typically comprises an approximately 30 amino acid, zinc-chelating, DNA-binding subdomain. An exemplary motif characterizing one class of these proteins (C2H2 class) is -Cys-(X)2-4-Cys-(X)12-His-(X)3-5-His (where X is any amino acid) (SEQ ID NO: 1). Additional classes of zinc finger proteins are known and are useful in the practice of the methods, and in the manufacture and use of the compositions disclosed herein (see, e.g., Rhodes et al. (1993) Scientific American 268:56-65 and US Patent Application Publication No. 2003/0108880). Studies have demonstrated that a single zinc finger of this class consists of an alpha helix containing the two invariant histidine residues coordinated with zinc along with the two cysteine residues of a single beta turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

A “target site” is the nucleic acid sequence recognized by a ZFP. A single target site typically has about four to about ten base pairs. Typically, a two-fingered ZFP recognizes a four to seven base pair target site, a three-fingered ZFP recognizes a six to ten base pair target site, a four.finger ZFP recognizes a 12-14 by target sequence and a six-fingered ZFP recognizes an 18-20 by target sequence, which can comprise two adjacent nine to ten base pair target sites or three adjacent 6-7 by target sites.

A “target subsite” or “subsite” is the portion of a DNA target site that is bound by a single zinc finger, excluding cross-strand interactions. Thus, in the absence of cross-strand interactions, a subsite is generally three nucleotides in length. In cases in which a cross-strand interaction occurs (i.e., a “D-able subsite,” see WO 00/42219) a subsite is four nucleotides in length and overlaps with another 3- or 4-nucleotide subsite.

“Kd” refers to the dissociation constant for a binding molecule, i.e., the concentration of a compound (e.g., a zinc finger protein) that gives half maximal binding on the of the compound to its target under given conditions (i.e., when (target]<<Kd), as measured using a given assay system (see, e.g., U.S. Pat. No. 5,789,538). The assay system used to measure the Kd should be chosen so that it gives the most accurate measure of the actual Kd of the ZFP. Any assay system can be used, as long is it gives an accurate measurement of the actual Kd of the ZFP. In one embodiment, the Kd for a ZFP is measured using an electrophoretic mobility shift assay (“EMSA”). Unless an adjustment is made for ZFP purity or activity, the Kd calculations may result in an overestimate of the true Kd of a given ZFP. Preferably, the Kd of a ZFP used to modulate transcription of a gene is less than about 100 nM, more preferably less than about 75 nM, more preferably less than about 50 nM, most preferably less than about 25 nM.

A “gene,” for the purposes of the present disclosure, includes a DNA region encoding a gene product, as well as all DNA regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions. Genes involved in neuropathic pain include, but are not limited to, VR1, TRKA, and Nav1.8.

Furthermore, the term “gene” includes nucleic acids that are substantially identical to a native gene. The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm such as those described below for example, or by visual inspection.

The phrase “substantially identical,” in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 75%, preferably at least 85%, more preferably at least 90%, 95% or higher or any integral value therebetween nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm such as those described below for example, or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 10, preferably about 20, more preferably about 40-60 residues in length or any integral value therebetween, preferably over a longer region than 60-80 residues, more preferably at least about 90-100 residues, and most preferably the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence for example.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection [see generally, Current Protocols in Molecular Biology, (Ausubel, F. M. et al., eds.) John Wiley & Sons, Inc., New York (1987-1999, including supplements such as supplement 46 (April 1999)]. Use of these programs to conduct sequence comparisons are typically conducted using the default parameters specific for each program.

Another example of an algorithm that is suitable for determining percent sequence 25 identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. This is referred to as the neighborhood word score threshold (Altschul et al., supra.). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. For determining sequence similarity the default parameters of the BLAST programs are suitable. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=−4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length 15 (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. The TBLATN program (using protein sequence for nucleotide sequence) uses as defaults a word length (W) of 3, an expectation (E) of 10, and a BLOSUM 62 scoring matrix. (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992)). In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat\'l. Acad. Sci. USA 90:5873-5877 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. “Hybridizes substantially” refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target polynucleotide sequence. The phrase “hybridizing specifically to” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.

A further indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid, as described below.

“Conservatively modified variations” of a particular polynucleotide sequence refers to those polynucleotides that encode identical or essentially identical amino acid sequences, or where the polynucleotide does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance, the codons CGU, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are “silent variations,” which are one species of “conservatively modified variations.” Every polynucleotide sequence described herein that encodes a polypeptide also describes every possible silent variation, except where otherwise noted. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each “silent variation” of a nucleic acid that encodes a polypeptide is implicit in each described sequence.

A polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. A “conservative substitution,” when describing a protein, refers to a change in the amino acid composition of the protein that does not substantially alter the protein\'s activity. Thus, “conservatively modified variations” of a particular amino acid sequence refers to amino acid substitutions of those amino acids that are not critical for protein activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, etc.) such that the substitutions of even critical amino acids do not substantially alter activity. Conservative substitution tables providing functionally similar amino acids are well known in the art. See, e.g., Creighton (1984) Proteins, W. H. Freeman and Company. In addition, individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also “conservatively modified variations.”

A “functional fragment” or “functional equivalent” of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one ore more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid, binding to a regulatory molecule) are well known in the art. Similarly, methods for determining protein function are well known. For example, the DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. See Ausubel et al., supra. The ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two-hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al. (1989) Nature 340:245-246; U.S. Pat. No. 5,585,245 and PCT WO 98/44350.

The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties. In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T. Thus, the term polynucleotide sequence is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. The terms additionally encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-0-methyl ribonucleotides, and peptide-nucleic acids (PNAs). The nucleotide sequences are displayed herein in the conventional 5′-3′ orientation.

“Chromatin” is the nucleoprotein structure comprising the cellular genome. “Cellular chromatin” comprises nucleic acid, primarily DNA, and protein including histones and non-histone chromosomal proteins. The majority of eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores. A molecule of histone H1 is generally associated with the linker DNA. For the purposes of the present disclosure, the term “chromatin” is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin.

A “chromosome” is a chromatin complex comprising all or a portion of the genome of a cell. The genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell. The genome of a cell can comprise one or more chromosomes.

An “episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.

An “exogenous molecule” is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. Normal presence in the cell is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally functioning endogenous molecule.

An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules. Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Pat. Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-. binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylates, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.

An exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., protein or nucleic acid (i.e., an exogenous gene), providing it has a sequence that is different from an endogenous molecule. Methods for the introduction of exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer and viral vector-mediated transfer.

By contrast, an “endogenous molecule” is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions.

An “endogenous gene” is a gene that is present in its normal genomic and chromatin context. An endogenous gene can be present, e.g., in a chromosome, an episome, a bacterial genome or a viral genome.

The phrase “adjacent to a transcription initiation site” refers to a target site that is within about 50 bases either upstream or downstream of a transcription initiation site. “Upstream” of a transcription initiation site refers to a target site that is more than about 50 bases 5′ of the transcription initiation site (i.e., in the non-transcribed region of the gene). “Downstream” of a transcription initiation site refers to a target site that is more than about 50 bases 3′ of the transcription initiation site.

A “fusion molecule” is a molecule in which two or more subunit molecules are linked, typically covalently. The subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules. Examples of the first type of fusion molecule include, but are not limited to, fusion polypeptides (for example, a fusion between a ZFP DNA-binding domain and a transcriptional activation domain) and fusion nucleic acids (for example, a nucleic acid encoding the fusion polypeptide described supra). Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.

“Gene expression” refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of a mRNA. Gene products also include RNAs that are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.

“Gene activation” refers to any process that results in an increase in production of a gene product. A gene product can be either RNA (including, but not limited to, mRNA, rRNA, tRNA, and structural RNA) or protein. Accordingly, gene activation includes those processes that increase transcription of a gene and/or translation of a mRNA. Examples of gene activation processes that increase transcription include, but are not limited to, those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (by, for example, blocking the binding of a transcriptional repressor). Gene activation can constitute, for example, inhibition of repression as well as stimulation of expression above an existing level. Examples of gene activation processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability. In general, gene activation comprises any detectable increase in the production of a gene product, in some instances an increase in production of a gene product by about 2-fold, in other instances from about 2- to about 5-fold or any integer therebetween, in still other instances between about 5- and about 10-fold or any integer therebetween, in yet other instances between about 10- and about 20-fold or any integer therebetween, sometimes between about 20- and about 50-fold or any integer therebetween, in other instances between about 50- and about 100-fold or any integer therebetween, and in yet other instances between 100-fold or more.

“Gene repression” and “inhibition of gene expression” refer to any process that results in a decrease in production of a gene product. A gene product can be either RNA (including, but not limited to, mRNA, rRNA, tRNA, and structural RNA) or protein. Accordingly, gene repression includes those processes that decrease transcription of a gene and/or translation of a mRNA. Examples of gene repression processes which decrease transcription include, but are not limited to, those which inhibit formation of a transcription initiation complex, those which decrease transcription initiation rate, those which decrease transcription elongation rate, those which decrease processivity of transcription and those which antagonize transcriptional activation (by, for example, blocking the binding of a transcriptional activator). Gene repression can constitute, for example, prevention of activation as well as inhibition of expression below an existing level. Examples of gene repression processes that decrease translation include those that decrease translational initiation, those that decrease translational elongation and those that decrease mRNA stability. Transcriptional repression includes both reversible and irreversible inactivation of gene transcription. In general, gene repression comprises any detectable decrease in the production of a gene product, in some instances a decrease in production of a gene product by about 2-fold, in other instances from about 2- to about 5-fold or any integer therebetween, in yet other instances between about 5- and about 10-fold or any integer therebetween, in still other instances between about 10- and about 20-fold or any integer therebetween, sometimes between about 20- and about 50-fold or any integer therebetween, in other instances between about 50- and about 100-fold or any integer therebetween, in still other instances 100-fold or more. In yet other instances, gene repression results in complete inhibition of gene expression, such that no gene product is detectable.

“Modulation” refers to a change in the level or magnitude of an activity or process. The change can be either an increase or a decrease. For example, modulation of gene expression includes both gene activation and gene repression. Modulation can be assayed by determining any parameter that is indirectly or directly affected by the expression of the target gene (e.g. VR1, TRKA, Nav1.8). Such parameters include, e.g., changes in RNA or protein levels, changes in protein activity, changes in product levels, changes in downstream gene expression, changes in reporter gene transcription, (luciferase, CAT, β-galactosidase, β-glucuronidase, green fluorescent protein (see, e.g., Mistili & Spector, Nature Biotechnology 15:961-964 (1997)); changes in signal transduction, phosphorylation and dephosphorylation, receptor-ligand interactions, second messenger concentrations (e.g., cGMP, cAMP, IP3, and Ca2+), cell growth, and vascularization. These assays can be in vitro, in vivo, and ex vivo. Such functional effects can be measured by any means known to those skilled in the art, e.g., measurement of RNA or protein levels, measurement of RNA stability, identification of downstream or reporter gene expression, e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, ligand binding assays; changes in intracellular second messengers such as caMP and inositol triphosphate (IP3); changes in intracellular calcium levels; cytokine release, and the like.

A “regulatory domain” or “functional domain” refers. to a protein or a protein domain that has transcriptional modulation activity when tethered to a DNA binding domain, i.e., a ZFP. Typically, a regulatory domain is covalently or non-covalently linked to a ZFP (e.g., to form a fusion molecule) to effect transcription modulation. Regulatory domains can be activation domains or repression domains. Activation domains include, but are not limited to, VP16, VP64 and the p65 subunit of nuclear factor Kappa-B. Repression domains include, but are not limited to, KRAB, KOX, MBD2B and v-ErbA. Additional regulatory domains include, e.g., transcription factors and co-factors (e.g., MAD, ERD, SID, early growth response factor 1, and nuclear hormone receptors), endonucleases, integrases, recombinases, methyltransferases, histone acetyltransferases, histone deacetylases etc. Activators and repressors include co-activators and co-repressors (see, e.g., Utley et al., Nature 394:498-502 (1998)). Alternatively, a ZFP can act alone, without a regulatory domain, to effect transcription modulation.

The term “operably linked” or “operatively linked” is used with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. An operatively linked transcriptional regulatory sequence is generally joined in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer can constitute a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.

With respect to fusion polypeptides, the term “operably linked” or “operatively linked” can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked. For example, with respect to a fusion polypeptide in which a ZFP DNA-binding domain is fused to a transcriptional activation domain (or functional fragment thereof), the ZFP DNA-binding domain and the transcriptional activation domain (or functional fragment thereof) are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the transcriptional activation domain (or functional fragment thereof) is able to activate transcription.

The term “recombinant,” when used with reference to a cell, indicates that the cell replicates an exogenous nucleic acid, or expresses a peptide or protein encoded by an exogenous nucleic acid. Recombinant cells can contain genes that are not found within the native (non-recombinant) form of the cell. Recombinant cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain a nucleic acid endogenous to the cell that has been modified without removing the nucleic acid from the cell; such modifications include those obtained by gene replacement, site-specific mutation, and related techniques.

A “recombinant expression cassette,” “expression cassette” or “expression construct” is a nucleic acid construct, generated recombinantly or synthetically, that has control elements that are capable of effecting expression of a structural gene that is operatively linked to the control elements in hosts compatible with such sequences. Expression cassettes include at least promoters and optionally, transcription termination signals. Typically, the recombinant expression cassette includes at least a nucleic acid to be transcribed (e.g., a nucleic acid encoding a desired polypeptide) and a promoter. Additional factors necessary or helpful in effecting expression can also be used as described herein. For example, an expression cassette can also include nucleotide sequences that encode a signal sequence that directs secretion of an expressed protein from the host cell. Transcription termination signals, enhancers, and other nucleic acid sequences that influence gene expression, can also be included in an expression cassette.

A “promoter” is defined as an array of nucleic acid control sequences that direct transcription. As used herein, a promoter typically includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of certain RNA polymerase II type promoters, a TATA element, CCAAT box, SP-1 site, etc. As used herein, a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. The promoters often have an element that is responsive to transactivation by a DNA-binding moiety such as a polypeptide, e.g., a nuclear receptor, Gal4, the lac repressor and the like.

A “constitutive” promoter is a promoter that is active under most environmental and developmental conditions. An “inducible” promoter is a promoter that is active under certain environmental or developmental conditions.

A “weak promoter” refers to a promoter having about the same activity as a wild type herpes simplex virus (“HSV”) thymidine kinase (“tk”) promoter or a mutated HSV tk promoter, as described in Eisenberg & McKnight, Mol. Cell. Biol. 5; 1940-1947 (1985).

An “expression vector” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell, and optionally integration or replication of the expression vector in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment, of viral or non-viral origin. Typically, the expression vector includes an “expression cassette,” which comprises a nucleic acid to be transcribed operably linked to a promoter. The term expression vector also encompasses naked DNA operably linked to a promoter.

By “host cell” is meant a cell that contains an expression vector or nucleic acid, either of which optionally encodes a ZFP or a ZFP fusion protein. The host cell typically supports the replication or expression of the expression vector. Host cells can be prokaryotic cells such as, for example, E. coli, or eukaryotic cells such as yeast, fungal, protozoal, higher plant, insect, or amphibian cells, or mammalian cells such as CHO, HeLa, 293, CDS-I, and the like, e.g., cultured cells (in vitro), explants and primary cultures (in vitro and ex vivo), and cells in vivo.

The term “naturally occurring,” as applied to an object, means that the object can be found in nature, as distinct from being artificially produced by humans.

The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an analog or mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides can be modified, e.g., by the addition of carbohydrate residues to form glycoproteins. The terms “polypeptide,” “peptide” and “protein” include glycoproteins, as well as non-glycoproteins. The polypeptide sequences are displayed herein in the conventional N-terminal to C-terminal orientation.

A “subsequence” or “segment” when used in reference to a nucleic acid or polypeptide refers to a sequence of nucleotides or amino acids that comprise a part of a longer sequence of nucleotides or amino acids (e.g., a polypeptide), respectively.

The terms “treating” and “treatment” as used herein refer to reduction in severity and/or frequency of symptoms, elimination of symptoms and/or underlying cause, prevention of the occurrence of symptoms and/or their underlying cause, and improvement or remediation of damage.

By an “effective” amount (or “therapeutically effective” amount) of a pharmaceutical composition is meant a sufficient, but nontoxic amount of the agent to provide the desired effect. The term refers to an amount sufficient to treat a subject. Thus, the term therapeutic amount refers to an amount sufficient to remedy a disease state or symptoms, by preventing, hindering, retarding or reversing the progression of the disease or any other undesirable symptoms whatsoever. The term prophylactically effective amount refers to an amount given to a subject that does not yet have the disease, and thus is an amount effective to prevent, hinder or retard the onset of a disease.

A variety of compositions and methods are provided herein for modulating the expression of target genes that are over- or under-expressed in subjects with neuropathic pain. For example, zinc finger proteins that are capable of modulating expression of one or more target genes involved in nerve excitability are provided, thereby modulating chronic pain. Also described are methods for treating neuropathic pain by contacting a cell or population of cells such as in an organism, with one or more zinc finger proteins (ZFPs) that bind to specific sequences in target genes involved in, e.g., nerve excitability and pain. In certain methods, one ZFP is administered and is able to bind to a target site in a single target gene. Other methods involve administering a plurality of different ZFPs that bind to a multiple target sites within a single target gene or, alternatively, within multiple target genes.

Thus, also provided herein are a variety of zinc finger proteins that are engineered to specifically recognize and bind to particular nucleic acid segments (target sites) in genes involved in neuropathic pain, modulate expression of these genes and thereby treat pain. In one embodiment, the ZFPs are linked to regulatory domains to create chimeric transcription factors to activate or repress transcription of one or more genes involved in pain.

With such ZFPs, expression of the target gene(s) can be enhanced; with certain other ZFPs, expression can be repressed. The target site can be adjacent to, upstream of, and/or downstream of the transcription start site (defined as nucleotide+1). As indicated above, one or more ZFPs can be used to modulate expression of one or more target genes. Thus, depending upon the particular ZFP(s) utilized, one can tailor the level at which one or more genes are expressed.

Exemplary target genes include the VR1, TrkA and NaV1.8 genes. The Capsaicin and Vanilloid Receptor (VR1) is located exclusively on small nerve fibers of the dorsal root ganglia (DRG). It is activated by noxious heat, lipid, and the low pH that is often associated with tissue damage. It has been found to be closely associated with other nociceptors (its activity is heightened by nerve growth factor (NGF) and bradykinin) and is therefore regarded as an integrator of the various pain-inducing stimuli. VR−/− mice are viable, normally sentient, and largely indistinguishable from littermates, except for impaired nociception.

The tyrosine Kinase Receptor A (TrkA) is the receptor for NGF, which is a key regulator of nociceptive thresholds. TrkA expression is restricted to the neuronal subpopulation that is principally concerned with nociception. It functions at primary sensory nerve terminals in the DRG to promote thermal hypersensitivity. TrkA both. facilitates VR1 function, and requires VR1 for its own function. Adult mice deficient in TrkA exhibit impaired nociception.

The tetrodotoxin-resistant sodium channel (NaV 1.8, also known as PN3, SNS, and SCN10a) is restricted to the peripheral small diameter sensory neurons in DRGs and is believed to play a unique role in transmission of nociceptive information to the spinal cord. Its expression is also influenced by NGF and TrkA. NaV 1.8−/− mice are apparently normal but show deficits in thermoreception and the development of inflammatory pain, and their behavioral responses to noxious mechanical stimulation appear to be completely abolished.

By virtue of the ability of the ZFPs to bind to target sites and influence expression of genes involved in nerve excitability, the ZFPs provided herein can be used to treat a wide range of neuropathic pain. For example, repression of VR1, TRKA and/or Nav1.8 expression can be achieved using the ZFPs described herein, thereby ameliorating or eliminating neuropathic pain. Thus, in certain applications, the ZFPs can be used to repress expression of genes overexpressed in subjects with neuropathic pain, both in vitro and in vivo. Such repression can be utilized, for example, as treatment for chronic pain.

Additional genes whose repression results in reduction of chronic pain include, for example, Dynorphin, NT3, and CCK-b. Conversely, activation of expression of the BDNF, NGF and GDNF genes can also be used for pain reduction. Sah et al. (2003) Nat. Rev. Drug Disc. 2: 460-472. Activation and repression of gene expression can be achieved by any method known in the art (e.g., antisense, siRNA). Preferred methods for modulation of gene expression involve the use of engineered zinc finger proteins comprising a transcriptional regulatory domain.

The zinc finger proteins (ZFPs) disclosed herein are proteins that can bind to DNA in a sequence-specific manner. As indicated above, these ZFPs can be used to modulate expression of a target gene (e.g., a gene involved in nerve excitability) in vivo or in vitro and by so doing treat chronic pain. An exemplary motif characterizing one class of these proteins, the C2H2 class, is -Cys-(X)2-4-Cys-(X)12-His-(X)3-5-His (where X is any amino acid) (SEQ. ID. NO:1). Several structural studies have demonstrated that the finger domain contains an alpha helix containing the two invariant histidine residues and two invariant cysteine residues in a beta turn coordinated through zinc. However, the ZFPs provided herein are not limited to this particular class. Additional classes of zinc finger proteins are known and can also be used in the methods and compositions disclosed herein (see, e.g., Rhodes, et al. (1993) Scientific American 268:56-65 and US Patent Application Publication No. 2003/0108880). In certain ZFPs, a single finger domain is about 30 amino acids in length. Zinc finger domains are involved not only in DNA-recognition, but also in RNA binding and in protein-protein binding.

The x-ray crystal structure of Zif268, a three-finger domain from a murine transcription factor, has been solved in complex with a cognate DNA-sequence and shows that each finger can be superimposed on the next by a periodic rotation. The structure suggests that each finger interacts independently with DNA over 3 base-pair intervals, with side-chains at positions −1, 2, 3 and 6 on each recognition helix making contacts with their respective DNA triplet subsites. The amino terminus of Zif268 is situated at the 3′ end of the DNA strand with which it makes most contacts. Some zinc fingers can bind to a fourth base in a target segment. If the strand with which a zinc finger protein makes most contacts is designated the target strand, some zinc finger proteins bind to a three base triplet in the target strand and a fourth base on the non-target strand. The fourth base is complementary to the base immediately 3′ of the three base subsite.

ZFPs that bind to particular target sites in genes involved in neuropathic pain are disclosed herein. The target sites can be located upstream or downstream of the transcriptional start site (defined as nucleotide+1). Target sites can include, for example, 9 nucleotides, 12 nucleotides or 18 nucleotides.

The target sites can be located adjacent the transcription initiation site or be located significantly upstream or downstream of the transcription start site. In certain embodiments, a single target site is recognized by the ZFP(s). In other instances, -multiple ZFPs can be used, each recognizing different targets in a single gene (e.g., VR1, TRKA or NAV1.8) or in multiple genes.

The ZFPs that bind to these target sites typically include at least one zinc finger but can include a plurality of zinc fingers (e.g., 2, 3, 4, 5, 6 or more fingers). Usually, the ZFPs include at least three fingers. Certain of the ZFPs include four or six fingers. The ZFPs that include three fingers typically recognize a target site that includes 9 or 10 nucleotides; four-finger ZFPs recognize a 12-14-nucleotide target site, and ZFPs having six fingers can recognize target sites that include 18 to 21 nucleotides. The ZFPs can also be fusion proteins that include one or more regulatory domains, which domains can be transcriptional activation or repression domains.

Exemplary zinc finger proteins that bind to a target site in a VR1, TRK-A or NAV1.8 gene are described in detail in the Examples and Tables 1, 2, 3 and 4.

Table 1 shows the nucleotide sequence of the target site for each zinc finger protein and the location of the target site relative to the transcription start site (SEQ ID NOS:15-36). Negative numbers refer to by upstream of the transcription start site and positive numbers refer to by downstream of the transcription start site, where the transcription start site is defined as nucleotide+1. Nucleotides shown in lower case represent nucleotides that are not contacted by a zinc finger. In these cases, the zinc finger protein is designed with a long, non-canonical linker between fingers that bind DNA to either side of the skipped nucleotide. See, for example, U.S. Pat. No. 6,479,626 and WO 01/53480. The genes examined for target sites include rat VR1 (see GenBank accession number NW—047336), rat TRK-A (GenBank No. NW—047626), human TrkA (GenBank No. NT—079484) and humanNAV1.8 (GenBank No. NT—022517).

TABLE 1 ZFP GenBank Name Target site (5′-3′) Accession # Location of Target Site 6144 TGGGGGTGGGCATTGGCTG NW_047336  −225 (rat VR1) 6149 GATTGGGATCAGCTCAAG NW_047336 −1093 (rat VR1) 6150 GTTAAGTGTGCAGTAATGG NW_047336   186 (rat VR1) 6332 CTCAAGGACGAGGCAAAG NW_047336  1105 (ratVR1) 6337 GATTGGGATCAGCTCAAG NW_047336  1093 (rat VR1) 6338 CGGAAGACCCAGAACAAG NW_047336   381 (ratVR1) 6182 GGCCGCGGGGCTAGGCGGTCTG NW_047626   106 (rat TRK-A) 6297 CATGAGGAAGGCGAGCTGG NW_047626  −130 (rat TRK-A) 6584 TCCCTGCTCCAAGGCACAG NT_022517  −962 (humanNAV1.8) 6585 GATGGACAACAAGGTTGAG NT_022517   931 (humanNAV1.8) 6586 GTGAGGGGACAAGCCAAGG NT_022517  −934 (humanNAV1.8) 6587 TTTCAGTGGAAGAAGGGG NT_022517  −459 (humanNAV1.8) 6590 TAATAGAGGAGGAAACTG NT_022517  −788 (humanNAV1.8)

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Methods and compositions for treating neuropathic pain patent application.
###


Other recent patent applications listed under the agent Sangamo Biosciences, Inc.: