FreshPatents.com Logo
stats FreshPatents Stats
5 views for this patent on FreshPatents.com
2013: 2 views
2012: 3 views
Updated: July 25 2014
newTOP 200 Companies filing patents this week


    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • COMPANY DIRECTORY
  • Patents sorted by company.

Follow us on Twitter
twitter icon@FreshPatents

Compositions and methods for regulating cell osmolarity

last patentdownload pdfimage previewnext patent


Title: Compositions and methods for regulating cell osmolarity.
Abstract: The invention provides compositions and methods for regulating intracellular osmolarity in cells, e.g., in cultured cells, including in cultured cells in bioreactors. The invention provides nucleic acids comprising at least one osmo-responsive transcriptional regulatory element (OR-TRE), and cells, vectors, products of manufacture, artificial organs or implants and the like containing an osmo-responsive transcriptional regulatory element (OR-TRE). ...


Inventors: Laetitia Malphettes, Andrew Snowden, Inn H. Yuk
USPTO Applicaton #: #20110269233 - Class: 435440 (USPTO) - 11/03/11 - Class 435 
Chemistry: Molecular Biology And Microbiology > Process Of Mutation, Cell Fusion, Or Genetic Modification

view organizer monitor keywords


The Patent Description & Claims data below is from USPTO Patent Application 20110269233, Compositions and methods for regulating cell osmolarity.

last patentpdficondownload pdfimage previewnext patent

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of U.S. Provisional Application No. 61/097,149, filed Sep. 15, 2008, the content of which is herein incorporated by reference in its entirety.

TECHNICAL FIELD

This invention relates generally to molecular and cell biology, cell culture systems and bioreactors, and to the recombinant production of products such as polypeptides in cell culture. In particular, this invention provides compositions and methods for regulating intracellular osmolarity in cells, e.g., in cultured cells, including in cultured cells in bioreactors.

BACKGROUND OF THE RELATED ART

Bioreactors culturing mammalian cells are used to make recombinant protein drugs such as growth factors, thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors and various other cytokines, and antibodies. However, in bioreactors, the osmolality of the culture increases as a result of base addition to control pH as well as feedings of nutrients and supplements to supply necessary energy for the culture. Typically, throughout a fed-batch bioreactor run, osmolality increases from about 300 milliosmoles/kg (mOsm) to values sometimes as high as 600 mOsm. It has been shown that compared to 300 mOsm cell cultures, within a range of osmolality (above 340 mOsm and below a threshold comprised between 400 and 450 mOsm) specific productivity of mammalian cells increases while cells\' growth rate decreases and cells\' death rate is not impacted. For most cell lines there seems to exist an osmolality threshold above which cell death rate increases dramatically with osmolality (often times that thresholds seems to be comprised between 400 and 450 mOsm).

In bioreactors, increased osmolality is correlated with increased tonicity (increased NaCl). High NaCl activates the transcription factor tonicity-responsive enhancer-/osmotic response element-binding protein (TonEBP/OREBP, where TonE is also called “tonicity enhancer,” or “osmotic response element”), which activates TonE, resulting in increased transcription of several protective genes whose promoters are controlled by its cognate binding sites: the enhancer ORE/TonE.

Regulation of TonEBP/OREBP transcriptional activity is complex. Within 30 min of hypertonicity, TonEBP/OREBP becomes phosphorylated and translocates into the nucleus. Hours later, TonEBP/OREBP mRNA and protein abundance increase. Also, hypertonicity increases transactivating activity of TonEBP/OREBP, associated with phosphorylation of its transactivating domain. More slowly, hypertonicity increases TonEBP/OREBP abundance through induction of its mRNA and protein synthesis.

SUMMARY

OF THE INVENTION

The invention provides isolated, synthetic or recombinant nucleic acid molecules comprising: (a) at least one osmo-responsive transcriptional regulatory element (ORTRE) comprising at least one TonEBP-responsive or NFATc-responsive transcriptional enhancer operatively linked to a transcriptional regulatory sequence; (b) the nucleic acid molecule of (a), wherein the transcriptional regulatory sequence is transcriptionally active in a eukaryotic cell, or the transcriptional regulatory sequence is derived from a eukaryotic cell; (c) the nucleic acid molecule of (a) or (b), wherein the transcriptional regulatory sequence is transcriptionally active in a vertebrate, a mammalian, a human, an insect, a plant, a yeast or a fungal cell, or a virus, or the transcriptional regulatory sequence is derived from a vertebrate, a mammalian, a human, an insect, a plant, a yeast or a fungal cell, or a virus, or the transcriptional regulatory sequence is a synthetic sequence; or, (d) the nucleic acid molecule of (a), wherein the transcriptional regulatory sequence comprises a promoter and/or an enhancer.

In alternative embodiments, the at least one TonEBP-responsive or NFATc responsive transcriptional enhancer molecule (sequence) is positioned 5′ to the promoter in a sense or antisense orientation; or, the at least one TonEBP-responsive or NFATc responsive transcriptional enhancer sequence is positioned 3′ to the promoter in a sense or antisense orientation; or, the at least one TonEBP-responsive or NFATc-responsive transcriptional enhancer sequence is positioned 5′ to the promoter in a sense or antisense orientation, and a second, third and/or additional TonEBP-responsive or NFATc responsive transcriptional enhancer sequence is positioned 3′ to the promoter in a sense or antisense orientation.

In alternative embodiments, the OR-TRE further comprises at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer operatively linked to the TonEBP responsive or NFATc-responsive transcriptional enhancer sequence. The Activator Protein-1 (AP-1)-responsive transcriptional enhancer can be positioned 5′ to the OR-TRE in a sense or antisense orientation; or, the Activator Protein-1 (AP-1)-responsive transcriptional enhancer can be positioned 3′ to the OR-TRE in a sense or antisense orientation; or, an Activator Protein-1 (AP-1)-responsive transcriptional enhancer can be positioned 5′ to the OR-TRE in a sense or antisense orientation, and a second, third and/or additional Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 3′ to the OR-TRE in a sense or antisense orientation.

In alternative aspects, the Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 5′ to the promoter, in a sense or antisense orientation; or, the Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 3′ to the promoter, in a sense or antisense orientation; or, an Activator Protein-1 (AP-1) responsive transcriptional enhancer is positioned 5′ to the promoter in a sense or antisense orientation, and a second Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 3′ to the promoter in a sense or antisense orientation.

In one embodiment, at least one TonEBP-responsive or NFATc-responsive transcriptional enhancer and/or at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer has (comprises), or further comprises, a eukaryotic (e.g., a vertebrate, a mammalian, a human, an insect, a yeast or fungal), a prokaryotic, a plant, viral and/or a synthetic nucleic acid molecule sequence.

In alternative embodiments, the at least one TonEBP-responsive transcriptional enhancer comprises the nucleic acid sequence of 5′-T/A/C)GGAA(A/T)NN(T/A/C)N(T/A/C)-3′ (SEQ ID NO:1), wherein N can be any nucleic acid residue; and/or the at least one NFATc-responsive transcriptional enhancer comprises the nucleic acid sequence of 5′-(T/A/C)GGAA(C/G)(A/G)-3′ (SEQ ID NO:2), or 5′-(T/A/C)GGAAANN(T/A/C)N(T/A/C)-3′ (SEQ ID NO:4), wherein N can be any nucleic acid residue; and/or the at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer comprises the nucleic acid sequence of 5′-TGA(C/G)TCA-3′ (SEQ ID NO:3).

In alternative embodiments, the at least one TonEBP-responsive transcriptional enhancer comprises the nucleotide sequence of 5′-(T/A/C)GGAAANN(T/A/C)N(T/A/C)-3′ (SEQ ID NO:4); and/or the at least one NFATc-responsive transcriptional enhancer comprises the nucleic acid sequence of 5′-TGGAAATTTGT-3′ (SEQ ID NO:5); and/or the at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer comprises the nucleotide sequence of 5′-TGACTCA-3′ (SEQ ID NO:6).

In one embodiment, the OR-TRE comprises the nucleotide sequence of 5′-TTGGAAAATCACCAGAATGGGATTTAGAGAGGTGGGGTTCCTGACTCATT-3′ (SEQ ID NO:7), or, residues 2 to 12 of (SEQ ID NO:7) (which corresponds to 5′-TGGAAAATCAC-3′) (SEQ ID NO:9), or 5′-TTGACTAGTTGGAAAATCACCAGAATGGGATTTAGAGAGGTGGGGTTC CTGACTCATTGCTAGCTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGG GAG-3′ (SEQ ID NO:8) where TonE and AP1 binding sites in (SEQ ID NO:7) and (SEQ ID NO:8) are in bold.

In one embodiment, a TonEBP-responsive transcriptional enhancer element (sequence) used in an osmo-responsive construct of the invention comprises a nucleic acid that specifically binds to a protein comprising the amino acid residue motif RAHYETEG (SEQ ID NO:9).

In one embodiment, the at least one TonEBP-responsive transcriptional enhancer is positioned 5′ to at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer, or, at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer sequence is positioned 5′ to at least one TonEBP-responsive transcriptional enhancer.

In alternative embodiments, at least one TonEBP-responsive transcriptional enhancer sequence is positioned within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 200, 250, 300, 350, 400 or 500 or more nucleotide residues of at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer.

In alternative embodiments, at least one TonEBP-responsive transcriptional enhancer is positioned within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 200, 250, 300, 350, 400 or 500 or more nucleotide residues of the promoter.

In alternative embodiments, at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer sequence is positioned within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 200, 250, 300, 350, 400 or 500 or more nucleotides of the promoter.

In alternative embodiments, the promoter is a constitutive promoter, an inducible promoter, a synthetic promoter, a mammalian promoter, a bacterial promoter, a plant promoter, a yeast promoter, a fungal promoter, a viral promoter, or a cytomegalovirus (CMV) promoter.

In alternative embodiments, the OR-TRE comprises one to ten (1 to 10) or more TonEBP-responsive transcriptional enhancers, and/or the OR-TRE comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more Activator Protein-1 (AP-1)-responsive transcriptional enhancers.

In alternative embodiments, the nucleic acid molecule further comprises one or more additional nucleic acid molecules (sequences) operatively linked to the promoter transcriptionally active in a cell, e.g., a eukaryotic cell. The additional nucleic acid molecule or molecules (sequences) can comprise one or more protein-coding nucleic acid molecules, or one or more regulatory nucleic acids (a nucleic acid having an inhibitory, stabilizing or upregulating function or effect). For example, a regulatory nucleic acid can be one or more sense or antisense nucleic acid molecules (sequences). In alternative embodiments, the additional nucleic acid molecule comprises: (a) a protein-coding nucleic acid molecule; (b) a regulatory nucleic acid molecule; or (c) the nucleic acid molecule of (b), wherein the regulatory nucleic acid molecule is an inhibitory, stabilizing or up-regulating nucleic acid molecule, or a sense or an antisense sequence.

In alternative embodiments, the additional nucleic acid molecule comprises a nucleic acid molecule (sequence) encoding an osmo-protective protein or peptide; or, the additional nucleic acid molecule comprises a nucleic acid molecule (sequence) encoding: an anti-apoptotic protein; a protein that confers resistance to oxidative stress to a cell; a chaperone protein involved in facilitating protein folding; a protein involved in extracellular secretion of proteins; a glycolytic enzyme; a cell cycle regulation protein; a glycosylation enzyme, or any combination thereof.

In alternative embodiments, the regulatory nucleic acid, e.g., inhibitory, nucleic acid molecule comprises a sense sequence, an antisense sequence, a ribozyme, a short interfering RNA (siRNA), or a microRNA (miRNA). The additional nucleic acid molecule can comprise a nucleic acid molecule encoding a NFATc or a TonEBP polypeptide.

The invention provides isolated, synthetic or recombinant osmo-responsive nucleic acid molecules comprising: (a) at least one OR-TRE of the invention operatively linked to a nucleic acid, wherein the OR-TRE regulates or drives the transcription of the nucleic acid; (b) the nucleic acid molecule of (a), wherein the transcribed nucleic acid encodes (comprises) a polypeptide-encoding nucleic acid molecule; (c) the nucleic acid molecule of (b), wherein the transcribed nucleic acid encodes: (i) an osmo-protective protein or peptide, or a protein that protects a cell in an environment of increasing osmolality, or protects a cell under conditions of hyperosmolality or increasing hyperosmolality; (ii) an anti-apoptotic protein; (iii) a protein that confers resistance to oxidative stress to a cell; (iv) a chaperone protein involved in facilitating protein folding; (v) a protein involved in extracellular secretion of proteins; (vi) a glycolytic enzyme; (vii) a cell cycle regulation protein; (viii) a glycosylation enzyme; or (ix) any combination of (i) to (viii); (d) the nucleic acid molecule of (a), wherein the transcribed nucleic acid comprises a regulatory nucleic acid, e.g., an inhibitory, stabilizing or a up-regulating nucleic acid molecule, or a nucleic acid molecule comprising sense or an antisense sequence; (e) the nucleic acid molecule of (d), wherein the regulatory nucleic acid, e.g., an inhibitory, stabilizing or a up-regulating nucleic acid molecule, comprises a sense, an antisense sequence, a ribozyme, a short interfering RNA (siRNA), or a microRNA (miRNA); (f) the polypeptide-encoding nucleic acid molecule of (b), wherein the transcribed nucleic acid encodes a NFATc polypeptide, an AP-1 polypeptide, a TonEBP polypeptide, a calcineurin polypeptide, or a combination thereof.

In alternative embodiments, the osmo-protective osmo-protective protein or peptide is a proline or a glycine-betaine, a taurine transporter, a glycine betaine-y-aminobutyric acid transporter, a sodium-myo-inositol cotransporter, a heat shock protein, an aquaporin, or an aldose reductase. The anti-apoptotic protein can be a Bc1-2, Bc1-xL, Mc1-1, BHRF1, X-IAP, IAP1, IAP2 IEX-1L, Bf1-1 or Bc1-w. The protein that confers resistance to oxidative stress to a cell can be a superoxide dismutase, a catalase, a glutathione peroxidase, a peroxiredoxin, a sulfiredoxin, thioredoxin, thioredoxin reductase, thioredoxin peroxidase, thioltransferase, glutaredoxin or a glutathione reductase.

In alternative embodiments, the chaperone protein involved in facilitating protein folding is a binding immunoglobulin protein (BiP), calnexin, calreticulin, ERp57 or a protein disulfide isomerase (PDI).

The glycolytic enzyme can be a pyruvate carboxylase or a pyruvate kinase. The cell cycle regulation protein can be a cyclin or a cyclin-dependent kinase, or an inhibitor of a cyclin or a cyclin-dependent kinase.

The invention provides isolated, synthetic or recombinant nucleic acid molecules comprising at least one osmo-responsive transcriptional regulatory element operatively linked to at least one nucleic acid molecule comprising a targeting nucleic acid molecule. The targeting nucleic acid molecule can comprise a nucleic acid molecule for targeting a lactogenic gene or a lactogenic message or a lactogenic protein to decrease expression of a lactogenic gene or a lactogenic message or a lactogenic protein. The lactogenic gene can be a lactate dehydrogenase. The nucleic acid comprising a nucleic acid molecule targeting a lactogenic gene or lactogenic gene message can comprise a short interfering RNA (siRNA), a microRNA (miRNA), an antisense RNA and/or an RNA with ribozyme activity. In one embodiment, the at least one osmo-responsive transcriptional regulatory element comprises an osmo-responsive transcriptional regulatory element (OR-TRE) of the invention.

In one aspect, the osmo-responsive nucleic acid molecule further comprises a nucleic acid molecule coding for a transcript (message) comprising a 5′ untranslated region, a 3′ untranslated region or both a 5′ untranslated region and a 3′ untranslated region. In one aspect, the osmo-responsive nucleic acid molecule further comprises at least one transcriptional or translational regulatory sequence which, in one embodiment, can be positioned within the 5′ untranslated region, or positioned within the 3′ untranslated region, or both.

The invention provides vectors comprising (a) the nucleic acid molecule of the invention, (b) the nucleic acid of the invention; and/or (c) the osmo-responsive nucleic acid of the invention. In alternative embodiments, the vector is an expression cassette, a recombinant virus, a plasmid, a phage, a phagemid, an artificial chromosome or a cloning vehicle; or, the vector is a bacteriophage P1-derived vector, a bacterial artificial chromosome, a yeast artificial chromosome, or a mammalian artificial chromosome; or the vector is an extra-chromosomal episome. In one aspect, the vector is an integrating vector.

The invention provides cells comprising: (a) the nucleic acid of the invention, (b) the nucleic acid of the invention; and/or (c) the osmo-responsive nucleic acid of the invention; or (b) a vector of the invention. In alternative embodiments, the cell is a mammalian cell, a human cell, a mouse cell, an insect cell, a fungal cell, a bacterial cell, a plant cell, an immortal cell or a Chinese hamster ovary (CHO) cell. The vector in the cell can be an extra-chromosomal episome, or, the vector can be stably integrated into the cell\'s genome. A nucleic acid of this invention can be an episomal, transient expression construct, or a genomically integrated expression construct, which alternatively can be a stable genomic insert.

The invention provides bioreactors, culture dishes, petri dishes, test tubes, roller bottles and the like, comprising a cell of the invention.

The invention provides methods for protecting a cell in an environment of increasing osmolality, or under conditions of hyperosmolality or increasing hyperosmolality, or maintaining osmolality or osmolarity in a cell, comprising expressing an osmo-protective protein or peptide or an osmo-protective regulatory nucleic acid molecule, wherein the method comprises: (a) introducing a polynucleotide into the cell, wherein said polynucleotide comprises: a nucleic acid molecule of the invention and/or an osmo-responsive nucleic acid molecule of the invention, or the vector of the invention; wherein the polynucleotide encodes an osmo-protective protein or peptide, or is itself an osmo-protective nucleic acid molecule; and (b) culturing the cell such that the osmo-protective protein or peptide, or the osmo-protective regulatory nucleic acid, is expressed, thereby protecting the cell in an environment of increasing osmolality, or under conditions of hyperosmolality or increasing hyperosmolality.

In alternative aspects of these methods, the osmo-protective protein or peptide comprises: (i) a protein that protects a cell in an environment of increasing osmolality (e.g., protects a cell under conditions of hyperosmolality or increasing hyperosmolality); (ii) an anti-apoptotic protein; (iii) a protein that confers resistance to oxidative stress to a cell; (iv) a chaperone protein involved in facilitating protein folding; (v) a protein involved in extracellular secretion of proteins; (vi) a glycolytic enzyme; (vii) a cell cycle regulation protein; (viii) a glycosylation enzyme; or (ix) any combination of (i) to (viii).

The invention provides methods for increasing production or regulating production of a recombinant protein in a cell (including cultured cells, e.g., as cells in a bioreactor), or increasing the production of correctly folded proteins or correctly glycosylated proteins under conditions of hyperosmolality in a cell (including cultured cells, e.g., as cells in a bioreactor), comprising: (a) providing a heterologous or recombinant nucleic acid molecule encoding the recombinant protein; and (b) stably or transiently inserting into the cell a polynucleotide comprising: a nucleic acid of the invention and/or the osmo-responsive nucleic acid of the invention, wherein the nucleic acid molecule encodes an osmo-protective protein or peptide, or an osmo-protective regulatory nucleic acid; and (c) culturing the cell under conditions wherein the osmo-protective protein or peptide or osmo-protective regulatory nucleic acid of (b) and the recombinant protein of (a) are expressed, thereby increasing production or regulating production of the recombinant protein in the cell, or increasing the production or regulating production of correctly folded proteins or correctly glycosylated proteins under conditions of hyperosmolality in the cell.

The invention provides methods for increasing production or regulating production of a recombinant protein, or increasing the production or regulating production of correctly folded proteins or correctly glycosylated proteins under conditions of hyperosmolality in a cell, in a bioreactor, an implant or an artificial organ, comprising: (a) providing a bioreactor, an implant or an artificial organ comprising a cell of the invention, wherein the cell comprises a nucleic acid of the invention and/or the osmo responsive nucleic acid molecule of the invention, or the vector of the invention; and the nucleic acid molecule or vector encodes an osmo-protective protein or peptide; and (b) culturing the cell under conditions wherein the osmo-protective protein or peptide or the osmo-protective regulatory nucleic acid, and the recombinant protein are expressed, or placing the bioreactor, implant or artificial organ in conditions permissive for expression of the osmo-protective protein or peptide or the osmo-protective regulatory nucleic acid, and the recombinant protein by the cell.

The invention provides methods for adding or enhancing a cell\'s adaptability or resistance to osmotic stress or osmotic shock comprising introducing to a cell a polynucleotide comprising: a nucleic acid of the invention and/or the osmo-responsive nucleic acid molecule of the invention, or the vector of the invention; wherein the nucleic acid molecule or vector encodes an osmo-protective protein or peptide or an osmoprotective regulatory nucleic acid. In alternative aspects, as used herein osmotic stress is different from osmotic shock in that osmotic stress encompasses a gradual change in osmolality (stress) of a culture system, a cell, etc., versus osmotic shock, which encompasses acute change (shock) osmolality (stress) of a culture system, a cell, etc.

In alternative aspects of these methods, the method adds or enhances the cell\'s adaptability or resistance to hypertonic osmotic stress or hypertonic osmotic shock, or, the method adds or enhances the cell\'s adaptability or resistance to hypotonic osmotic stress or hypotonic osmotic shock.

The invention provides methods for increasing production or regulating production of a recombinant protein in a cell, or increasing the production of correctly folded proteins or correctly glycosylated proteins under conditions of hyperosmolality in a cell, comprising: (a) providing a heterologous or recombinant nucleic acid molecule encoding the recombinant protein; and (b) stably or transiently inserting into a cell a polynucleotide comprising: a nucleic acid of the invention and/or the osmo-responsive nucleic acid molecule of the invention, or the vector of the invention; wherein the nucleic acid molecule or vector encodes an osmo-protective protein or peptide; and (c) culturing the cell under conditions wherein the osmo-protective protein or peptide or nucleic acid of (b), and the recombinant protein of (a), are expressed.

The invention provides methods for increasing production or regulating production of a recombinant protein in an implant or an artificial organ, or increasing the production of correctly folded proteins or correctly glycosylated proteins under conditions of hyperosmolality in an implant or an artificial organ, comprising: (a) providing a cell comprising a heterologous or recombinant nucleic acid molecule encoding the recombinant protein; and (b) stably or transiently inserting into the cell a polynucleotide comprising: a nucleic acid of the invention and/or the osmo-responsive nucleic acid molecule of the invention, or the vector of the invention, wherein the nucleic acid molecule encodes an osmo-protective protein or peptide or an osmo-protective nucleic acid molecule; and (c) inserting the cell in the implant or artificial organ and maintaining the implant or artificial organ in conditions allowing expression of the osmo-protective protein or peptide or the osmo-protective nucleic acid molecule, and the recombinant protein in the cell, thereby increasing production or regulating production of the recombinant protein in the implant or the artificial organ.

The invention provides methods for the efficient production of biomolecules in dense or late-stage cell production systems, or allowing higher yields of total biomolecules or higher yields of post-translationally processed proteins in dense or late stage cell production systems, comprising: (a) stably or transiently inserting into a cell capable of generating the biomolecule a polynucleotide comprising: a nucleic acid of the invention and/or the osmo-responsive nucleic acid molecule of the invention, or the vector of the invention, wherein the nucleic acid molecule encodes an osmo-protective protein or peptide or an osmo-protective nucleic acid molecule; (b) the method of (a), wherein the biomolecule is a small molecule, a polypeptide and/or nucleic acid; or (c) the method of (a) or (b), wherein the method results in higher yields of properly folded or preferably folded (e.g., a wild type folding, wild type-pattern folding) or glycosylated polypeptides.

The invention provides artificial organs or implants comprising a cell of the invention, a vector of the invention, and/or an osmo-responsive nucleic acid molecule of the invention. The invention provides methods products of manufacture comprising a cell of the invention, a vector of the invention, and/or an osmo-responsive nucleic acid molecule of the invention. The invention provides kits comprising a cell of the invention, a nucleic acid molecule of the invention, a vector of the invention, and/or an osmoresponsive nucleic acid molecule of the invention. In one aspect, the kit further comprises instructions for practicing a method of the invention.

Thus, in certain embodiments, the invention provides an isolated nucleic acid molecule comprising at least one osmo-responsive transcriptional regulatory element (OR-TRE) comprising at least one TonEBP-responsive transcriptional enhancer or NFATc-responsive transcriptional enhancer operatively linked to a transcriptional regulator and at least one Activator Protein (AP-1)-responsive transcriptional enhancer operatively linked to said TonEBP-responsive transcriptional enhancer or NFATc-responsive transcriptional enhancer. The transcriptional regulator may be, for example, a promoter, an enhancer or a combination thereof. In some embodiments a first TonEBP-responsive transcriptional enhancer or NFATc-responsive transcriptional enhancer positioned 5′ to a promoter, and a second TonEBP-responsive transcriptional enhancer or NFAT-responsive transcriptional enhancer positioned 3′ to the promoter. In some embodiments, a first Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 5′ of the OR-TRE and a second Activator Protein-1 (AP-1)-responsive transcriptional enhancer positioned 3′ of the OR-TRE. In some embodiments, the Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 5′ of the transcriptional regulator and the transcriptional regulator is a promoter. In other embodiments, the Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 3′ of the transcriptional regulator which is a promoter. In still other embodiments, a first Activator Protein-1 (AP-1)-responsive transcriptional enhancer is positioned 5′ to the transcriptional regulator and a second Activator Protein-1 (AP-1) responsive transcriptional enhancer is positioned 3′ to the transcriptional regulator, wherein the first transcriptional regulator and the second transcriptional regulator are both promoters. In some embodiments, the nucleic acid molecule contains (a) at least one TonEBP-responsive transcriptional enhancer comprising the nucleic acid sequence of SEQ ID NO:1; or (b) at least one NFATc-responsive transcriptional enhancer comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:4; or (c) at least one Activator Protein-1 (AP-1)-responsive transcriptional enhancer comprising the nucleic acid sequence of SEQ ID NO:3 (wherein N can be any nucleotide).

In certain embodiments, the OR-TRE of the invention comprises the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9.

The nucleic acid molecule of the invention may further comprise an additional nucleic acid molecule operatively linked to the transcriptional regulator, wherein the transcriptional regulator is a promoter that is transcriptionally active in a eukaryotic cell. The additional nucleic acid molecule may be a protein-encoding nucleic acid molecule (e.g., encoding a protein of interest) or regulatory nucleic molecule (e.g., an inhibitory molecule, a stabilizing molecule, an up-regulating nucleic acid molecule, or one that produces an antisense molecule). In some embodiments, the inhibitory nucleic acid molecule comprises an antisense sequence, a ribozyme, a short interfering RNA (siRNA), or a microRNA (miRNA). In some embodiments, the additional nucleic acid molecule encodes an osmo-protective protein or peptide such as, for example, a proline or a glycine-betaine, a taurine transporter, a glycine betaine-y-aminobutyric acid transporter, a sodium-myo-inositol cotransporter, a heat shock protein, an aquaporin, an aldose reductase, or a neuropathy target esterase (NTE). In other embodiments, the additional nucleic acid molecule encodes a protein or peptide that confers a beneficial property to proteins expressed in cells. A protein that confers a benefit may be, for example, an anti-apoptotic protein (e.g., Bc1-2, Bc1-xL, Mc1-1, BHRF1, X-IAP, IAP1, IAP2 IEX-1L, Bf1-1 or Bc1-w); a protein that confers resistance to oxidative stress to a cell (e.g., superoxide dismutase, a catalase, a glutathione peroxidase, a peroxiredoxin, a sulfiredoxin, thioredoxin, thioredoxin reductase, thioredoxin peroxidase, thioltransferase, glutaredoxin or a glutathione reductase); a chaperone protein involved in facilitating protein folding (e.g., binding immunoglobulin protein (BiP), calnexin, calreticulin, ERp57 or a protein disulfide isomerase (PDI)); a protein involved in extracellular secretion of proteins; a glycolytic enzyme (e.g., pyruvate carboxylase or a pyruvate kinase); a cell cycle regulation protein (e.g., cyclin or a cyclin-dependent kinase, or an inhibitor of a cyclin or a cyclin-dependent kinase); a glycosylation enzyme, or any combination thereof. In other embodiments, the additional nucleic acid molecule encodes an NFATc or a TonEBP polypeptide.

In some embodiments, the OR-TRE is operatively linked to at least one targeting nucleic acid molecule, such as, for example, a nucleic acid molecule for targeting a lactogenic gene, a lactogenic message, or a lactogenic protein to decrease expression of said lactogenic gene (e.g., lactate dehydrogenase), lactogenic message, or a lactogenic protein. In some embodiments, these nucleic acid molecules targeting a lactogenic gene or lactogenic message comprises a short interfering RNA (siRNA), a microRNA (miRNA), an antisense RNA and/or an RNA with ribozyme activity.

The invention includes vectors comprising the nucleic acids of the invention and host cells containing such vectors.

In certain embodiments, the nucleic acid molecule of the invention further comprises (i) additional nucleic acid molecule encoding a polypeptide that confers a beneficial property to proteins expressed in cells operatively linked to the transcriptional regulator, wherein said transcriptional regulator is a promoter that is transcriptionally active in a eukaryotic cell and (ii) a nucleic acid molecule encoding a protein of interest to be expressed in cells wherein the expression of the nucleic acid molecule of (i) imparts said beneficial property to the polypeptide encoded by the nucleic acid molecule of (ii). In such embodiments, the molecule of (i) encodes a polypeptide selected from the group consisting of an anti-apoptotic protein; a protein that confers resistance to oxidative stress to a cell; a chaperone protein involved in facilitating protein folding; a protein involved in extracellular secretion of proteins; a glycolytic enzyme; a cell cycle regulation protein; a glycosylation enzyme, or any combination thereof.

The invention also provides a method for protecting a cell under conditions of hyperosmolality comprising:

(a) introducing a polynucleotide into a cell wherein said polynucleotide comprises:

Download full PDF for full patent description/claims.

Advertise on FreshPatents.com - Rates & Info


You can also Monitor Keywords and Search for tracking patents relating to this Compositions and methods for regulating cell osmolarity patent application.
###
monitor keywords



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Compositions and methods for regulating cell osmolarity or other areas of interest.
###


Previous Patent Application:
Method for culturing animal hepatocyte
Next Patent Application:
Methods and compositions for increasing nuclease activity
Industry Class:
Chemistry: molecular biology and microbiology
Thank you for viewing the Compositions and methods for regulating cell osmolarity patent info.
- - - Apple patents, Boeing patents, Google patents, IBM patents, Jabil patents, Coca Cola patents, Motorola patents

Results in 0.76657 seconds


Other interesting Freshpatents.com categories:
Medical: Surgery Surgery(2) Surgery(3) Drug Drug(2) Prosthesis Dentistry  

###

All patent applications have been filed with the United States Patent Office (USPTO) and are published as made available for research, educational and public information purposes. FreshPatents is not affiliated with the USPTO, assignee companies, inventors, law firms or other assignees. Patent applications, documents and images may contain trademarks of the respective companies/authors. FreshPatents is not affiliated with the authors/assignees, and is not responsible for the accuracy, validity or otherwise contents of these public document patent application filings. When possible a complete PDF is provided, however, in some cases the presented document/images is an abstract or sampling of the full patent application. FreshPatents.com Terms/Support
-g2-0.2414
     SHARE
  
           

FreshNews promo


stats Patent Info
Application #
US 20110269233 A1
Publish Date
11/03/2011
Document #
13063912
File Date
09/15/2009
USPTO Class
435440
Other USPTO Classes
4353201, 43525231, 43525233, 43525235, 43525234, 4352523, 4352543, 43525421, 43525423, 4352542, 435348, 435358, 435365, 435366, 435354
International Class
/
Drawings
8


Acids
Intracellular
Nucleic Acids
Osmolarity


Follow us on Twitter
twitter icon@FreshPatents