FreshPatents.com Logo FreshPatents.com icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents

7

views for this patent on FreshPatents.com
updated 05/17/13


Inventor Store

    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • COMPANY PATENTS
  • Patents sorted by company.

High affinity nucleic acid ligands of complement system proteins   

pdficondownload pdfimage preview


Abstract: Methods are described for the identification and preparation of high-affinity Nucleic Acid Ligands to Complement System Proteins. Methods are described for the identification and preparation of high affinity Nucleic Acid Ligands to Complement System Proteins C1q, C3 and C5. Included in the invention are specific RNA ligands to C1q, C3 and C5 identified by the SELEX method. ...

Agent: Gilead Sciences, Inc. - Foster City, CA, US
Inventors: Gregory Biesecker, Larry Gold
USPTO Applicaton #: #20110196021 - Class: 514 44 R (USPTO) - 08/11/11 - Class 514 
Related Terms: Complement   Complement System   Complement System Proteins   Nucleic Acid   Proteins   
view organizer monitor keywords


The Patent Description & Claims data below is from USPTO Patent Application 20110196021, High affinity nucleic acid ligands of complement system proteins.

pdficondownload pdf

RELATED APPLICATIONS

This application is a continuation of U.S. patent application Ser. No. 11/288,622, filed Nov. 28, 2005, entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” which is a continuation of U.S. patent application Ser. No. 10/435,750, filed May 8, 2003, entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” now abandoned, which is a continuation of U.S. patent application Ser. No. 10/037,282, filed Jan. 3, 2002, (now U.S. Pat. No. 6,566,343, issue May 20, 2003), entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” which is a continuation of U.S. patent application Ser. No. 09/163,025, filed Sep. 29, 1998, (now U.S. Pat. No. 6,395,888, issued May 29, 2002), entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” which is a continuation-in-part of U.S. patent application Ser. No. 09/023,228, filed Feb. 12, 1998, (now U.S. Pat. No. 6,140,490 issued Oct. 31, 2000), entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” which is a continuation-in-part of PCT/US97/01739, filed Jan. 30, 1997, now expired, entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” which is a continuation-in-part of U.S. patent application Ser. No. 08/595,335, filed Feb. 1, 1996, entitled “High Affinity Nucleic Acid Ligands of Complement System Proteins,” now abandoned, which are each incorporated herein in their entirety by reference.

FIELD OF THE INVENTION

Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to Complement System Proteins. The method utilized herein for identifying such Nucleic Acid Ligands is called SELEX™, an acronym for Systematic Evolution of Ligands by EXponential enrichment. Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to the Complement System Proteins C1q, C3 and C5. This invention includes high affinity Nucleic Acid Ligands of C1q, C3 and C5. Also disclosed are RNA ligands of C1q, C3 and C5. Also disclosed are Nucleic Acid Ligands that inhibit and/or activate the Complement System. The oligonucleotides of the present invention are useful as pharmaceuticals or diagnostic agents.

BACKGROUND OF THE INVENTION

The complement system comprises a set of at least 20 plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens (Janeway et al. (1994) Immunobiology: The Immune System in Health and Disease. Current Biology Ltd, San Francisco, pp. 8:35-8:55; Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). There are two distinct enzymatic activation cascades, the classical and alternative pathways, and a non-enzymatic pathway known as the membrane attack pathway.

The classical pathway is usually triggered by an antibody bound to a foreign particle. It comprises several components, C1, C4, C2, C3 and C5 (listed by order in the pathway). Initiation of the classical pathway of the Complement System occurs following binding and activation of the first complement component (C1) by both immune and non-immune activators (Cooper (1985) Adv. Immunol. 37:151). C1 comprises a calcium-dependent complex of components C1q, C1r and C1s, and is activated through binding of the C1q component. C1q contains six identical subunits and each subunit comprises three chains (the A, B and C chains). Each chain has a globular head region which is connected to a collagen-like tail. Binding and activation of C1q by antigen-antibody complexes occurs through the C1q head group region. Numerous non-antibody C1q activators, including proteins, lipids and nucleic acids (Reid et al. (1993) The Natural Immune System: Humoral Factors. E. Sim, ed. IRL Press, Oxford, p. 151) bind and activate through a distinct site on the collagen-like stalk region.

Non-antibody C1q protein activators include C-reactive protein (CRP) (Jiang et al. (1991) J. Immunol. 146:2324) and serum amyloid protein (SAP) (Bristow et al. (1986) Mol. Immunol. 23:1045); these will activate C1q when aggregated by binding to phospholipid or carbohydrate, respectively. Monomeric CRP or SAP do not activate C1q. C1q is also activated through binding to aggregated β-amyloid peptide (Schultz et al. (1994) Neurosci. Lett. 175:99; Snyder et al. (1994) Exp. Neurol. 128:136), a component of plaques seen in Alzheimer\'s disease (Jiang et al. (1994) J. Immunol. 152:5050; Eikelenboom and Stam (1982) Acta Neuropathol (Berl) 57:239; Eikelenboom et al. (1989) Virchows Arch. [B] 56:259; Rogers et al. (1992) Proc. Natl. Acad. Sci. USA 89:10016; Dietzschold et al. (1995) J. Neurol. Sci. 130:11). C1q activation might also exacerbate the tissue damage associated with Alzheimer\'s disease. These activators bind C1q on its collagen-like region, distant from the head-group region where immunoglobulin activators bind. Other proteins which bind the C1q collagen-like region include collagen (Menzel et al. (1981) Biochim. Biophys. Acta 670:265), fibronectin (Reid et al. (1984) Acta Pathol. Microbiol. Immunol. Scand. Sect. C 92 (Suppl. 284):11), laminin (Bohnsack et al. (1985) Proc. Natl. Acad. Sci. USA 82:3824), fibrinogen and fibrin (Entwistle et al. (1988) Biochem. 27:507), HIV rsgp41 (Stoiber et al. (1995) Mol. Immunol. 32:371), actin (Nishioka et al. (1982) Biochem. Biophys. Res. Commun. 108:1307) and tobacco glycoprotein (Koethe et al. (1995) J. Immunol. 155:826).

C1q also binds and can be activated by anionic carbohydrates (Hughes-Jones et al. (1978) Immunology 34:459) including mucopolysaccharides (Almeda et al. (1983) J. Biol. Chem. 258:785), fucans (Blondin et al. (1994) Mol. Immunol. 31:247), proteoglycans (Silvestri et al. (1981) J. Biol. Chem. 256:7383), and by lipids including lipopolysaccharide (LPS) (Zohair et al. (1989) Biochem. J. 257:865; Stoiber et al. (1994) Eur. J. Immunol. 24:294). Both DNA (Schravendijk and Dwek (1982) Mol. Immunol. 19:1179; Rosenberg et al. (1988) J. Rheumatol 15:1091; Uwatoko et al. (1990) J. Immunol. 144:3484) and RNA (Acton et al. (1993) J. Biol. Chem. 268:3530) can also bind and potentially activate C1q. Intracellular components which activate C1q include cellular and subcellular membranes (Linder (1981) J. Immunol. 126:648; Pinckard et al. (1973) J. Immunol. 110:1376; Storrs et al. (1981) J. Biol. Chem. 256:10924; Giclas et al. (1979) J. Immunol. 122:146; Storrs et al. (1983) J. Immunol. 131:416), intermediate filaments (Linder et al. (1979) Nature 278:176) and actin (Nishioka et al. (1982) Biochem. Biophys. Res. Commun. 108:1307). All of these interactions would recruit the classical pathway for protection against bacterial (or viral) infection, or as a response to tissue injury (Li et al. (1994) J. Immunol. 152:2995) in the absence of antibody.

A binding site for non-antibody activators including CRP (Jiang et al. (1991) J. Immunol. 146:2324), SAP (Ying et al. (1993) J. Immunol. 150:169), β-amyloid peptide (Newman (1994) Curr. Biol. 4:462) and DNA (Jiang et al. (1992) J. Biol. Chem. 267:25597) has been localized to the amino terminus of C1q A chain at residues 14-26. A synthetic peptide comprising this sequence effectively inhibits both binding and activation. The peptide 14-26 contains several basic residues and matches one of the heparin binding motifs (Yabkowitz et al. (1989) J. Biol. Chem. 264:10888; Cardin et al. (1989) Arteriosclerosis 9:21). The peptide is also highly homologous with peptide 145-156 in collagen-tailed acetylcholinesterase; this site is associated with heparin-sulfate basement membrane binding (Deprez et al. (1995) J. Biol. Chem. 270:11043). A second C1q A chain site at residues 76-92 also might be involved in weaker binding; this site is at the junction of the globular head region and the collagen-like tail.

The second enzymatically activated cascade, known as the alternative pathway, is a rapid, antibody-independent route for the Complement System activation and amplification. The alternative pathway comprises several components, C3, Factor B, and Factor D. Activation of the alternative pathway occurs when C3b, a proteolytic cleavage form of C3, is bound to an activating surface such as a bacterium. Factor B is then bound to C3b, and cleaved by Factor D to yield the active enzyme, Ba. The enzyme Ba then cleaves more C3 to C3b, producing extensive deposition of C3b-Ba complexes on the activating surface. When a second C3b is deposited, forming a C3b-C3b-Ba complex, the enzyme can then cleave C5 and trigger activation of the terminal pathway.

The non-enzymatic terminal pathway, also known as the membrane attack pathway, comprises the components C5, C6, C7, C8 and C9. Activation of this membrane attack pathway results when the C5 component is enzymatically cleaved by either the classical or alternative pathway to yield the small C5a polypeptide (9 kDa) and the large C5b fragment (200 kDa). The C5a polypeptide binds to a 7 transmembrane G-protein coupled receptor which was originally described on leukocytes and is now known to be expressed on a variety of tissues including hepatocytes (Haviland et al. (1995) J. Immunol. 154:1861) and neurons (Gasque et al. (1997) Am. J. Pathol. 150:31). The C5a molecule is the primary chemotactic component of the human Complement System and can trigger a variety of biological responses including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signal transduction pathways, neutrophil-endothelial adhesion (Mulligan et al. (1997) J. Immunol. 158:1857), cytokine and lipid mediator release and oxidant formation. The larger C5b fragment binds sequentially to later components to form the C5b-9 membrane attack complex (MAC). The C5b-9 MAC can directly lyse erythrocytes, and in greater quantities is lytic for leukocytes and is damaging to tissues such as muscle, epithelial and endothelial cells (Stahl et al. (1997) Circ. Res. 76:575). In sublytic amounts the MAC can stimulate upregulation of adhesion molecules, intracellular calcium increase and cytokine release (Ward (1996) Am. J. Pathol. 149:1079). In addition, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The non-lytic effects of C5a and the C5b-9 MAC are sometimes quite similar.

The Complement System has an important role in defense against bacterial and viral infection, and possibly in immune surveillance against tumors. This is demonstrated most clearly in humans who are deficient in complement components. Individuals deficient in early components (C1, C4, C2 or C3) suffer from recurrent infections, while individuals deficient in late components (C5 through C9) are susceptible to nisseria infection. Complement classical pathway is activated on bacteria by antibodies, by binding of CRP or SAP, or by direct activation through LPS. Complement alternative pathway is activated through binding of C3 to the cell coat. Complement can be activated by viruses through antibodies, and can also be activated on viral infected cells because these are recognized as foreign. In a similar way, transformed cells can be recognized as foreign and can be lysed by the Complement System or targeted for immune clearance.

Activation of the Complement System can and has been used for therapeutic purposes. Antibodies which were produced against tumor cells were then used to activate the Complement System and cause tumor rejection. Also, the Complement System is used together with polyclonal or monoclonal antibodies to eliminate unwanted lymphocytes. For example, anti-lymphocyte globulin or monoclonal anti-T-cell antibodies are used prior to organ transplantation to eliminate lymphocytes which would otherwise mediate rejection.

Although the Complement System has an important role in the maintenance of health, it has the potential to cause or contribute to disease. The Complement System has been implicated in numerous renal, rheumatological, neurological, dermatological, hematological, vascular/pulmonary, allergy, infectious, biocompatibility/shock and other diseases or conditions (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298; Matis and Rollins (1995) Nature Medicine 1(8):839-842). The Complement System is not necessarily the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis.

Several pharmaceuticals have been developed that inhibit the Complement System in vivo, however, many cause toxicity or are poor inhibitors (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). Heparins, K76COOH and nafamstat mesilate have been shown to be effective in animal studies (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). Recombinant forms of naturally occurring inhibitors of the Complement System have been developed or are under consideration, and these include the membrane regulatory proteins Complement Receptor 1 (CR1), Decay Accelerating Factor (DAF), Membrane Cofactor Protein (MCP) and CD59.

C5 is an attractive target for the development of a Complement System inhibitor, as both the classical and alternative pathways converge at component C5 (Matis and Rollins (1995) Nature Medicine 1(8):839-842). In addition, inhibition of C5 cleavage blocks both the C5a and the C5b effects on leukocytes and on tissue such as endothelial cells (Ward (1996) Am. J. Pathol. 149:1079); thus C5 inhibition can have therapeutic benefits in a variety of diseases and situations, including lung inflammation (Mulligan et al. (1998) J. Clin. Invest. 98:503), extracorporeal complement activation (Rinder et al. (1995) J. Clin. Invest. 96:1564) or antibody-mediated complement activation (Biesecker et al. (1989) J. Immunol. 142:2654). Matis and Rollins ((1995) Nature Medicine 1(8):839-842) have developed C5-specific monoclonal antibodies as an anti-inflammatory biopharmaceutical. Both C5a and the MAC have been implicated in acute and chronic inflammation associated with human disease, and their role in disease states has been confirmed in animal models. C5a is required for complement- and neutrophil-dependent lung vascular injury (Ward (1997) J. Lab. Clin. Med. 129:400; Mulligan et al. (1998) J. Clin. Invest. 98:503), and is associated with neutrophil and platelet activation in shock and in burn injury (Schmid et al. (1997) Shock 8:119). The MAC mediates muscle injury in acute autoimmune myasthenia gravis (Biesecker and Gomez (1989) J. Immunol. 142:2654), organ rejection in transplantation (Baldwin et al. (1995) Transplantation 59:797; Brauer et al. (1995) Transplantation 59:288; Takahashi et al. (1997) Immunol. Res. 16:273) and renal injury in autoimmune glomerulonephritis (Biesecker (1981) J. Exp. Med. 39:1779; Nangaku (1997) Kidney Int. 52:1570). Both C5a and the MAC are implicated in acute myocardial ischemia (Homeister and Lucchesi (1994) Annu Rev. Pharmacol. Toxicol. 34:17), acute (Bednar et al. (1997) J. Neurosurg. 86:139) and chronic CNS injury (Morgan (1997) Exp. Clin. Immunogenet. 14:19), leukocyte activation during extracorporeal circulation (Sun et al. (1995) Nucleic Acids Res. 23:2909; Spycher and Nydegger (1995) Infushionsther. Transfusionsmed. 22:36) and in tissue injury associated with autoimmune diseases including arthritis and lupus (Wang et al. (1996) Immunology 93:8563). Thus, inhibiting cleavage of C5 prevents generation of two potentially damaging activities of the Complement System. Inhibiting C5a release eliminates the major Complement System chemotactic and vasoactive activity, and inhibiting C5b formation blocks assembly of the cytolytic C5b-9 MAC. Furthermore, inhibition of C5 prevents injury by the Complement System while leaving intact important Complement System defense and clearance mechanisms, such as C3 and C1q phagocytic activity, clearance of immune complexes and the innate immune response (Carrol (1998) Ann. Rev. Immunol. 16:545).

C3 is an attractive target for the development of a Complement System inhibitor, as it is common to both pathways. Inhibition of C3 using recombinant versions of a natural inhibitors (Kalli et al. (1994) Springer Semin. Immunopathol. 15:417) can prevent cell-mediated tissue injury (Mulligan et al. (1992) J. Immunol. 148:1479) and this has been shown to have therapeutic benefit in diseases such as myocardial infarction (Weisman et al. (1990) Science 249:146) and liver ischemia/reperfusion (Chávez-Cartaya et al. (1995) Transplantation 59:1047). Controlling C3 limits most biological activities of the Complement System. Most natural inhibitors, including DAF, MCP, CR1 and Factor H target C3.

SELEX™

A method for the in vitro evolution of Nucleic Acid molecules with highly specific binding to target molecules has been developed. This method, Systematic Evolution of Ligands by EXponential enrichment, termed the SELEX process, is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also WO 91/19813), each of which is herein specifically incorporated by reference in its entirety. Each of these applications, collectively referred to herein as the SELEX patent applications, describes a fundamentally novel method for making a Nucleic Acid Ligand to any desired Target molecule.

The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of Nucleic Acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the Target under conditions favorable for binding, partitioning unbound Nucleic Acids from those Nucleic Acids which have bound specifically to Target molecules, dissociating the Nucleic Acid-Target complexes, amplifying the Nucleic Acids dissociated from the Nucleic Acid-Target complexes to yield a ligand-enriched mixture of Nucleic Acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity Nucleic Acid Ligands to the Target molecule.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” now abandoned (see also U.S. Pat. No. 5,707,796), describes the use of the SELEX method in conjunction with gel electrophoresis to select Nucleic Acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned, (see also U.S. Pat. No. 5,763,177) describes a SELEX-based method for selecting Nucleic Acid Ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a Target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” now abandoned (see also U.S. Pat. No. 5,580,737), describes a method for identifying highly specific Nucleic Acid Ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” now abandoned, (see also U.S. Pat. No. 5,567,588) and U.S. patent application Ser. No. 08/792,075, filed Jan. 31, 1997, entitled “Flow Cell SELEX,” describe SELEX-based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a Target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” now U.S. Pat. No. 5,496,938, describes methods for obtaining improved Nucleic Acid Ligands after the SELEX process has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chemi-SELEX,” now U.S. Pat. No. 5,705,337, describes methods for covalently linking a ligand to its Target.

The SELEX method encompasses the identification of high-affinity Nucleic Acid Ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified Nucleic Acid Ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now abandoned, (see also U.S. Pat. No. 5,660,985) that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, now U.S. Pat. No. 5,580,737, supra, describes highly specific Nucleic Acid Ligands containing one or more nucleotides modified with 2′-amino (2′-NH2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, describes oligonucleotides containing various 2′-modified pyrimidines.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459 and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” now U.S. Pat. No. 5,683,867, respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.

BRIEF

SUMMARY

OF THE INVENTION

The present invention includes methods of identifying and producing Nucleic Acid Ligands to Complement System Proteins and homologous proteins and the Nucleic Acid Ligands so identified and produced. By homologous proteins it is meant a degree of amino acid sequence identity of 80% or more. Exemplified herein is a method of identifying and producing Nucleic Acid Ligands to C1q, C3 and C5, and the Nucleic Acid Ligands so produced. Nucleic Acid Ligand sequences are provided that are capable of binding specifically to C1q, C3 and C5. In particular, RNA sequences are provided that are capable of binding specifically the C1q, C3 and C5. Specifically included in the invention are the RNA ligand sequences shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5A-B (SEQ ID NOS: 5-155 and 160-196). Also included in the invention are Nucleic Acid Ligands that inhibit the function of proteins of the Complement System. Specifically included in the invention herein are RNA ligands that inhibit the function of C1q, C3 and C5. Also included are Nucleic Acid Ligands that inhibit and/or activate the Complement System.

Further included in this invention is a method of identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences to Complement System Proteins comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with a Complement System Protein, (c) partitioning between members of said Candidate Mixture on the basis of affinity to said Complement System Protein, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to said Complement System Protein.

Also included in this invention is a method of identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences to C1q, C3 and C5, comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with C1q, C3 or C5, (c) partitioning between members of said Candidate Mixture on the basis of affinity to C1q, C3 or C5, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to C1q, C3 or C5.

More specifically, the present invention includes the RNA ligands to C1q, C3 and C5 identified according to the above-described method, including RNA ligands to C1q, including those ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS: 84-155), RNA ligands to C3, including those sequences shown in Table 3 (SEQ ID NOS:21-46), and RNA ligands to C5, including those sequences shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193). Also included are RNA ligands to C1q, C3 and C5 that are substantially homologous to any of the given ligands and that have substantially the same ability to bind C1q, C3 or C5, and inhibit the function of C1q, C3 or C5. Further included in this invention are Nucleic Acid Ligands to C1q, C3 and C5 that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind C1q, C3 or C5 and inhibit the function of C1q, C3 or C5.

The present invention also includes modified nucleotide sequences based on the RNA ligands identified herein and mixtures of the same.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the results of an inhibition assay in which 2′-F RNA ligands C12 (SEQ ID NO:59), A6 (SEQ ID NO:48), K7 (SEQ ID NO:50), C9 (SEQ ID NO:58), E5c (SEQ ID NO:47) and F8 (SEQ ID NO:49) to human C5 were incubated with antibody-coated sheep erythrocytes and whole human serum. The results are presented as optical density (OD) versus concentration of ligand in nM.

FIG. 2 shows the % C5a generation as a function of concentration of clone C6 (SEQ ID NO:51).

FIG. 3A shows a sequencing gel of 5′-kinase-labeled clone C6 (SEQ ID NO:51) after alkaline hydrolysis or digestion with T1 nuclease. The 3′-sequence (5′-end labeled) is aligned with the alkaline hydrolysis ladder. On the left is the T1 ladder and on the right are RNA selected with 5× and 1× concentrations of C5. The boundary where removal of a base eliminates binding is shown by the arrow. The asterisk shows a G which is hypersensitive to T1.

FIG. 3B shows a sequencing gel of 3′-pCp-ligated clone C6 after alkaline hydrolysis or digestion with T1 nuclease. The 5′-sequence (3′-end-labled) is aligned with the alkaline hydrolysis ladder. The T1 and protein lanes, boundary and hypersensitive G nucleotides are as described for FIG. 3A.

FIG. 4 shows the results of the 2′-O-methyl interference assay. Positions where 2′-OH purines can be substituted with 2′-O-methyl were determined from binding interference. Plotted is the ratio of (the intensity of bands selected by protein)/(the band intensity for oligonucleotides not selected by protein) with a linear curve fit (open circles). The same ratio for mixed 2′-OH:2′-OMe nucleotides is also plotted (closed circles).

FIG. 5A shows the proposed structure of the 38mer truncate (SEQ ID NO:160) of clone C6 (SEQ ID NO:51) together with alternative bases.

FIG. 5B shows the 2′-O-methyl substitution pattern of a 38mer truncate (SEQ ID NO:193 of clone C6 (SEQ ID NO:51). Positions where 2′-OMe substitutions can be made are shown in bold. Positions which must be 2′-OH are underlined.

FIG. 6 shows the % hemolysis verses concentration of nucleic acid ligand (μm) for a 38mer truncate of clone YL-13 (SEQ ID NO:175) without 2′-OMe substitution (SEQ ID NO:194; open circles), with a 2′-OMe substitution at position 20 (SEQ ID NO:195; closed triangles) and with 2′-OMe substitutions at positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26, 27, 28, 36 and 38 (SEQ ID NO:196; closed circles).

DETAILED DESCRIPTION

OF THE INVENTION

This application describes Nucleic Acid Ligands to Complement System Proteins identified generally according to the method known as SELEX. As stated earlier, the SELEX technology is described in detail in the SELEX patent applications which are incorporated herein by reference in their entirety. Certain terms used to described the invention herein are defined as follows:

“Nucleic Acid Ligand” as used herein is a non-naturally occurring Nucleic Acid having a desirable action on a Target. A desirable action includes, but is not limited to, binding of the Target, catalytically changing the Target, reacting with the Target in a way which modifies/alters the Target or the functional activity of the Target, covalently attaching to the Target as in a suicide inhibitor, and facilitating the reaction between the Target and another molecule. In the preferred embodiment, the desirable action is specific binding to a Target molecule, such Target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the Nucleic Acid Ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the Nucleic Acid Ligand is not a Nucleic Acid having the known physiological function of being bound by the Target molecule. Nucleic Acid Ligands include Nucleic Acids that are identified from a Candidate Mixture of Nucleic Acids, said Nucleic Acid Ligand being a ligand of a given Target by the method comprising: a) contacting the Candidate Mixture with the Target, wherein Nucleic Acids having an increased affinity to the Target relative to the Candidate Mixture may be partitioned from the remainder of the Candidate Mixture; b) partitioning the increased affinity Nucleic Acids from the remainder of the Candidate Mixture; and c) amplifying the increased affinity Nucleic Acids to yield a ligand-enriched mixture of Nucleic Acids.

“Candidate Mixture” is a mixture of Nucleic Acids of differing sequence from which to select a desired ligand. The source of a Candidate Mixture can be from naturally-occurring Nucleic Acids or fragments thereof, chemically synthesized Nucleic Acids, enzymatically synthesized Nucleic Acids or Nucleic Acids made by a combination of the foregoing techniques. In a preferred embodiment, each Nucleic Acid has fixed sequences surrounding a randomized region to facilitate the amplification process.

“Nucleic Acid” means either DNA, RNA, single-stranded or double-stranded and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.

“SELEX™” methodology involves the combination of selection of Nucleic Acid Ligands which interact with a Target in a desirable manner, for example binding to a protein, with amplification of those selected Nucleic Acids. Iterative cycling of the selection/amplification steps allows selection of one or a small number of Nucleic Acids which interact most strongly with the Target from a pool which contains a very large number of Nucleic Acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. In the present invention, the SELEX methodology is employed to obtain Nucleic Acid Ligands to C1q, C3 and C5. The SELEX methodology is described in the SELEX patent applications.

“Target” means any compound or molecule of interest for which a ligand is desired. A Target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation. In this application, the Target is a Complement System Protein, preferably C1q, C3 and C5.

“Complement System Protein” means any protein or component of the Complement System including, but not limited to, C1, C1q, C1r, C1s, C2, C3, C3a, C3b, C4, C4a, C5, C5a, C5b, C6, C7, C8, C9, Factor B (B), Factor D (D), Factor H(H) and receptors thereof, and other soluble and membrane inhibitors/control proteins.

“Complement System” is a set of plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens or infected or transformed cells, and in clearance of immune reactants or cellular debris. The Complement System can be activated spontaneously on certain pathogens or by antibody binding to the pathogen. The pathogen becomes coated with Complement System Proteins (opsonized) for uptake and destruction. The pathogen can also be directly lysed and killed. Similar mechanisms target infected, transformed or damaged cells. The Complement System also participates in clearance of immune and cellular debris.

The SELEX process is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by EXponential Enrichment,” now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also WO 91/19813). These applications, each specifically incorporated herein by reference, are collectively called the SELEX patent applications.

In its most basic form, the SELEX process may be defined by the following series of steps: 1) A Candidate Mixture of Nucleic Acids of differing sequence is prepared. The Candidate Mixture generally includes regions of fixed sequences (i.e., each of the members of the Candidate Mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the Target, or (c) to enhance the concentration of a given structural arrangement of the Nucleic Acids in the Candidate Mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent). 2) The Candidate Mixture is contacted with the selected Target under conditions favorable for binding between the Target and members of the Candidate Mixture. Under these circumstances, the interaction between the Target and the Nucleic Acids of the Candidate Mixture can be considered as forming Nucleic Acid-Target pairs between the Target and those Nucleic Acids having the strongest affinity for the Target. 3) The Nucleic Acids with the highest affinity for the Target are partitioned from those Nucleic Acids with lesser affinity to the Target. Because only an extremely small number of sequences (and possibly only one molecule of Nucleic Acid) corresponding to the highest affinity Nucleic Acids exist in the Candidate Mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the Nucleic Acids in the Candidate Mixture (approximately 5-50%) are retained during partitioning. 4) Those Nucleic Acids selected during partitioning as having the relatively higher affinity to the Target are then amplified to create a new Candidate Mixture that is enriched in Nucleic Acids having a relatively higher affinity for the Target. 5) By repeating the partitioning and amplifying steps above, the newly formed Candidate Mixture contains fewer and fewer weakly binding sequences, and the average degree of affinity of the Nucleic Acids to the Target will generally increase. Taken to its extreme, the SELEX process will yield a Candidate Mixture containing one or a small number of unique Nucleic Acids representing those Nucleic Acids from the original Candidate Mixture having the highest affinity to the Target molecule.

The SELEX patent applications describe and elaborate on this process in great detail. Included are Targets that can be used in the process; methods for partitioning Nucleic Acids within a Candidate Mixture; and methods for amplifying partitioned Nucleic Acids to generate enriched Candidate Mixture. The SELEX patent applications also describe ligands obtained to a number of target species, including both protein Targets where the protein is and is not a Nucleic Acid binding protein.

The SELEX method further encompasses combining selected Nucleic Acid Ligands with lipophilic or Non-Immunogenic, High Molecular Weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes.” VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as diacyl glycerol or dialkyl glycerol, in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/739,109, filed Oct. 25, 1996, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as a glycerol lipid, or a Non-Immunogenic, High Molecular Weight Compound, such as polyalkylene glycol, are further described in U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” VEGF Nucleic Acid Ligands that are associated with a Non-Immunogenic, High Molecular Weight compound or a lipophilic compound are also further described in PCT/US97/18944, filed Oct. 17, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.

Certain embodiments of the present invention provide a complex comprising one or more Nucleic Acid Ligands to a Complement System Protein covalently linked with a Non-Immunogenic, High Molecular Weight compound or lipophilic compound. A complex as used herein describes the molecular entity formed by the covalent linking of the Nucleic Acid Ligand of a Complement System Protein to a Non-Immunogenic, High Molecular Weight compound. A Non-Immunogenic, High Molecular Weight compound is a compound between approximately 100 Da to 1,000,000 Da, more preferably approximately 1000 Da to 500,000 Da, and most preferably approximately 1000 Da to 200,000 Da, that typically does not generate an immunogenic response. For the purposes of this invention, an immunogenic response is one that causes the organism to make antibody proteins. In one preferred embodiment of the invention, the Non-Immunogenic, High Molecular Weight compound is a polyalkylene glycol. In the most preferred embodiment, the polyalkylene glycol is polyethylene glycol (PEG). More preferably, the PEG has a molecular weight of about 10-80K. Most preferably, the PEG has a molecular weight of about 20-45K. In certain embodiments of the invention, the Non-Immunogenic, High Molecular Weight compound can also be a Nucleic Acid Ligand.

Another embodiment of the invention is directed to complexes comprised of a Nucleic Acid Ligand to a Complement System Protein and a lipophilic compound. Lipophilic compounds are compounds that have the propensity to associate with or partition into lipid and/or other materials or phases with low dielectric constants, including structures that are comprised substantially of lipophilic components. Lipophilic compounds include lipids as well as non-lipid containing compounds that have the propensity to associate with lipids (and/or other materials or phases with low dielectric constants). Cholesterol, phospholipid, and glycerol lipids, such as dialkyl glycerol, diacyl glycerol, and glycerol amide lipids are further examples of lipophilic compounds. In a preferred embodiment, the lipophilic compound is a glycerol lipid.

The Non-Immunogenic, High Molecular Weight compound or lipophilic compound may be covalently bound to a variety of positions on the Nucleic Acid Ligand to a Complement System Protein, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the Nucleic Acid Ligand to a Complement System Protein. In embodiments where the lipophilic compound is a glycerol lipid, or the Non-Immunogenic, High Molecular Weight compound is polyalkylene glycol or polyethylene glycol, preferably the Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ or 3′ hydroxyl of the phosphate group thereof. In the most preferred embodiment, the lipophilic compound or Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ hydroxyl of the phosphate group of the Nucleic Acid Ligand. Attachment of the Non-Immunogenic, High Molecular Weight compound or lipophilic compound to the Nucleic Acid Ligand of the Complement System Protein can be done directly or with the utilization of linkers or spacers.

A linker is a molecular entity that connects two or more molecular entities through covalent bonds or non-covalent interactions, and can allow spatial separation of the molecular entities in a manner that preserves the functional properties of one or more of the molecular entities. A linker can also be referred to as a spacer.

The complex comprising a Nucleic Acid Ligand to a Complement System Protein and a Non-Immunogenic, High Molecular Weight compound or lipophilic compound can be further associated with a lipid construct. Lipid constructs are structures containing lipids, phospholipids, or derivatives thereof comprising a variety of different structural arrangements which lipids are known to adopt in aqueous suspension. These structures include, but are not limited to, lipid bilayer vesicles, micelles, liposomes, emulsions, lipid ribbons or sheets, and may be complexed with a variety of drugs and components which are known to be pharmaceutically acceptable. In a preferred embodiment, the lipid construct is a liposome. The preferred liposome is unilamellar and has a relative size less than 200 nm. Common additional components in lipid constructs include cholesterol and alpha-tocopherol, among others. The lipid constructs may be used alone or in any combination which one skilled in the art would appreciate to provide the characteristics desired for a particular application. In addition, the technical aspects of lipid constructs and liposome formation are well known in the art and any of the methods commonly practiced in the field may be used for the present invention.

The methods described herein and the Nucleic Acid Ligands identified by such methods are useful for both therapeutic and diagnostic purposes. Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients, specifically diseases or conditions caused by activation of the Complement System. The Complement System does not have to be the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis. Such diseases or conditions include, but are not limited to, renal diseases, such as lupus nephritis and membranoproliferative glomerulonephritis (MPGN), membranous nephritis, IgA nephropathy; rheumatological diseases, such as rheumatoid arthritis, systemic lupus erythematosus (SLE), Behcet\'s syndrome, juvenile rheumatoid arthritis, Sjögren\'s syndrome and systemic sclerosis; neurological diseases, such as myasthenia gravis, multiple sclerosis, cerebral lupus, Guillain-Barré syndrome and Alzheimer\'s disease; dermatological diseases, such as Pemphigus/pemphigoid, phototoxic reactions, vasculitis and thermal burns; hematological diseases, such as paroxysmal nocturnal hemoglobinuria (PNH), hereditary erythroblastic multinuclearity with positive acidified serum lysis test (HEMPAS) and idiopathic thrombocytopenic purpura (ITP); biocompatibility/shock diseases, such as post-bypass syndrome, adult respiratory distress syndrome (ARDS), catheter reactions, anaphylaxis, transplant rejection, pre-eclampsia, hemodialysis and platelet storage; vascular/pulmonary diseases, such as atherosclerosis, myocardial infarction, stroke and reperfusion injury; allergies, such as anaphylaxis, asthma and skin reactions; infection, such as septic shock, viral infection and bacterial infection; and other conditions, such as atheroma, bowel inflammation, thyroiditis, infertility, paroxysmal nocturnal hemoglobinuria (PNH) and hemolytic anemia.

The Complement System can be inhibited at several points in the activation cascade by targeting different components. Inhibition of C1q would block the initiation by either antibody or non-antibody mechanisms. Antibodies activate C1q in many diseases including SLE, myasthenia gravis and arthritis. Non-antibody Complement System activation occurs in many diseases including Alzheimer\'s disease, myocardial infarction and septic shock. Blocking C1q could prevent the complement-mediated tissue injury in these diseases.

The Complement can also be activated in the absence of antibodies directly at the C3 stage. Activating surfaces including bacteria, virus particles or damaged cells can trigger Complement System activation that does not require C1q. An inhibitor of C3 could prevent Complement System activation and damage in these situations.

In other instances the inhibition of C5 is most useful. Activation of the Complement System by either C1q or C3 mechanisms both lead to activation of C5, so that inhibition of C5 could prevent Complement System-mediated damage by either pathway. However, both C1q and C3 are important in normal defense against microorganisms and in clearance of immune components and damaged tissue, while C5 is mostly dispensable for this function. Therefore, C5 can be inhibited either for a short term or a long term and the protective role of Complement System would not be compromised, whereas long term inhibition of C1q or C3 is not desirable. Finally, the C5 fragments C5a and C5b directly cause the majority of tissue injury and disease associated with unwanted Complement System activation. Therefore, inhibition of C5 is the most direct way of producing therapeutic benefit.

In other instances, the activation of the Complement System is desirable in the treatment or prevention of diseases or medical conditions in human patients. For example, the activation of the Complement System is desirable in treating bacterial or viral infections and malignancies. In addition, the activation of the Complement System on T-cells prior to transplantation could prevent rejection of an organ or tissue by eliminating the T-cells that mediate the rejection.

Furthermore, Nucleic Acid Ligands that bind to cell surface Targets could be made more efficient by giving them the ability to activate the Complement System. Nucleic Acid binding would then both inhibit a Target function and also eliminate the cell, for example, by membrane attack complex lysis and cell clearance through opsonization. Nucleic Acid Ligands could activate the Complement System through either the classical or the alternative pathways. C1q Nucleic Acid Ligands can be conjugated to other structures that target a cell surface component. For example, C1q Nucleic Acid Ligands can be conjugated to antibodies to cell targets, cytokines, growth factors or a ligand to a cell receptor. This would allow the C1q Nucleic Acid Ligands to multimerize on the targeted cell surface and activate the Complement System, thereby killing the cell.

The prototype classical pathway activators are immune aggregates, which activate the Complement System through binding to globular head groups on the C1q component. Generally, binding of two or more Fc domains to C1q is required; pentameric IgM is an especially efficient activator. In contrast, Nucleic Acid Ligands can activate through binding at a separate site on the C1q collagen-like tail region. This site also binds to a variety of other non-antibody activators including C-reactive protein, serum amyloid protein, endotoxin, β-amyloid peptide 1-40 and mitochondrial membranes. As with immunoglobulin, these non-antibody activators need to be multimerized to activate.

Nucleic Acid Ligands that bind to sites on the collagen-like region of C1q may also become activators when aggregated. Such a Complement System-activating aggregate may be lytic if formed on a cell surface, such as binding to a tumor-specific antigen (TSA) or to a leukocyte antigen. The extent of Nucleic Acid Ligand-mediated activation increases with the extent of Nucleic Acid Ligand aggregation (i.e., multiplicity of Nucleic Acid Ligand-C1q interaction). The Complement System-mediated killing is especially specific if the Nucleic Acid Ligands circulate as monomers which do not activate, but become activators when they are multimerized on the targeted cell surface.

As with any Complement System activation, the extent and specificity is determined by the amount of C3 deposited onto the targeted cell. Deposited C3 forms an enzyme convertase that cleaves C5 and initiates membrane attack complex formation. C3 is also the classical serum opsonin for targeting phagocytic ingestion. The prototype alternative pathway activators are repeating carbohydrate units including bacterial and yeast cell walls, fucoidin and Sepharose, or glycolipids such as endotoxin or the glycocalyx. Nucleic Acid Ligands could activate the alternative pathway by aggregating the C3 component on the cell surface. Depositing C3 on a cell promotes Factor B binding and alternative pathway C3 convertase formation. Binding of a Nucleic Acid Ligand to C3 blocks binding of the inhibitor Factor H and prevents C3b decay. This would also increase C3 convertase formation and alternative path activation. Nucleic Acid Ligands to C3 may have this activity since heparin binds activated C3 and can promote alternative pathway activation. Binding of Nucleic Acid Ligands to C3 blocks binding to C3 of the membrane-associated inhibitors CR1, CR2, MCP and DAF, preventing C3b convertase decay and stimulating alternative pathway activation. This alternative pathway mechanism can be as efficient as C1q-dependent activation in cell killing and lysis.

Nucleic Acid Ligand-mediated Complement System cell killing could be employed in several ways, for example, by: a) direct killing of tumor cells; b) lysis of targeted microorganisms or infected cells; and c) elimination of lymphocytes or lymphocyte subsets. Nucleic Acid Ligands could replace antibodies currently used for these purposes.

Diagnostic utilization may include both in vivo or in vitro diagnostic applications. The SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. The SELEX method identifies Nucleic Acid Ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand.

The Nucleic Acid Ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any Nucleic Acid Ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures. The Nucleic Acid Ligands to C1q, C3 and C5 described herein may specifically be used for identification of the C1q, C3 or C5 protein.

The SELEX process provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of Nucleic Acids research. The present invention applies the SELEX procedure to the specific target C1q, which is part of the first component (C1) of the classical pathway of Complement System activation, to the specific target C3, which is part of both the classical and alternative pathway, and to the specific target C5, which is part of the terminal pathway. In the Example section below, the experimental parameters used to isolate and identify the Nucleic Acid Ligands to C1q, C3 and C5 are described.

In order to produce Nucleic Acids desirable for use as a pharmaceutical, it is preferred that the Nucleic Acid Ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the Nucleic Acid Ligand have the highest possible affinity to the Target.

Pharmaceutical agents, which include, but are not limited to, small molecules, antisense oligonucleotides, nucleosides, and polypeptides can activate the Complement System in an undesirable manner. Nucleic Acid Ligands to Complement System Proteins could be used as a prophylactic by transiently inhibiting the Complement System, so that a pharmaceutical agent could be administered and achieve a therapeutically effective amount without eliciting the undesirable side effect of activating the Complement System.

In co-pending and commonly assigned U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, now U.S. Pat. No. 5,496,938, (the \'938 patent), methods are described for obtaining improved Nucleic Acid Ligands after SELEX has been performed. The \'938 patent, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” is specifically incorporated herein by reference in its entirety.

In the present invention, SELEX experiments were performed in order to identify RNA with specific high affinity for C1q, C3 and C5 from a degenerate library containing 30 or 50 random positions (30N or 50N). This invention includes the specific RNA ligands to C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), identified by the method described in Examples 2 and 6, the specific RNA ligands to C3 shown in Table 3 (SEQ ID NOS:21-46), identified by method described in Example 3, and the specific RNA ligands to C5 shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193) identified by methods described in Examples 4, 9, 10 and 11. This invention further includes RNA ligands to C1q, C3 and C5 which inhibit the function of C1q, C3 and C5. The scope of the ligands covered by this invention extends to all Nucleic Acid Ligands of C1q, C3 and C5, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes Nucleic Acid sequences that are substantially homologous to the ligands shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5A-B (SEQ ID NOS:5-155 and 160-196). By substantially homologous, it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%, and even more preferably in excess of 90%, 95% or 99%. The percentage of homology as described herein is calculated as the percentage of nucleotides found in the smaller of the two sequences which align with identical nucleotide residues in the sequence being compared when 1 gap in a length of 10 nucleotides may be introduced to assist in that alignment. A review of the sequence homologies of the ligands of C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155) shows that sequences with little or no primary homology may have substantially the same ability to bind C1q. Similarly, a review of the sequence homologies of the ligands of C3 shown in Table 3 (SEQ ID NOS:21-46) shows that sequences with little or no primary homology may have substantially the same ability to bind C3. Similarly, a review of the sequence homologies of the ligands of C5 shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193) shows that sequences with little or no primary homology may have substantially the same ability to bind C5. For these reasons, this invention also includes Nucleic Acid Ligands that have substantially the same structure and ability to bind C1q as the Nucleic Acid Ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), Nucleic Acid Ligands that have substantially the same structure and ability to bind C3 as the Nucleic Acid Ligands shown in Table 3 (SEQ ID NOS:21-46) and Nucleic Acid Ligands that have substantially the same structure and ability to bind C5 as the Nucleic Acid Ligands shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193). Substantially the same ability to bind C1q, C3 or C5 means that the affinity is within one or two orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind C1q, C3 or C5.

The invention also includes Nucleic Acid Ligands that have substantially the same postulated structure or structural motifs. Substantially the same structure or structural motifs can be postulated by sequence alignment using the Zukerfold program (see Zucker (1989) Science 244:48-52). As would be known in the art, other computer programs can be used for predicting secondary structure and structural motifs. Substantially the same structure or structural motif of Nucleic Acid Ligands in solution or as a bound structure can also be postulated using NMR or other techniques as would be known in the art.

One potential problem encountered in the therapeutic, prophylactic and in vivo diagnostic use of Nucleic Acids is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Certain chemical modifications of the Nucleic Acid Ligand can be made to increase the in vivo stability of the Nucleic Acid Ligand or to enhance or to mediate the delivery of the Nucleic Acid Ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now abandoned (see also U.S. Pat. No. 5,660,985) and U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” which are specifically incorporated herein by reference in their entirety. Modifications of the Nucleic Acid Ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.

Where the Nucleic Acid Ligands are derived by the SELEX method, the modifications can be pre- or post-SELEX modifications. Pre-SELEX modifications yield Nucleic Acid Ligands with both specificity for their SELEX Target and improved in vivo stability. Post-SELEX modifications made to 2′-OH Nucleic Acid Ligands can result in improved in vivo stability without adversely affecting the binding capacity of the Nucleic Acid Ligand. The preferred modifications of the Nucleic Acid Ligands of the subject invention are 5′ and 3′ phosphorothioate capping and/or 3′-3′ inverted phosphodiester linkage at the 3′ end. In one preferred embodiment, the preferred modification of the Nucleic Acid Ligand is a 3′-3′ inverted phosphodiester linkage at the 3′ end. Additional 2′-fluoro (2′-F) and/or 2′-amino (2′-NH2) and/or 2′-O-methyl (2′-OMe) modification of some or all of the nucleotides is preferred. Described herein are Nucleic Acid Ligands that were 2′-NH2 modified or 2′-F modified and incorporated into the SELEX process. Further described herein are 2′-F modified Nucleic Acid Ligands derived from the SELEX process which were modified to comprise 2′-OMe purines in post-SELEX modifications.

Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX (modification of previously identified unmodified ligands) or by incorporation into the SELEX process.

As described above, because of their ability to selectively bind C1q, C3 and C5, the Nucleic Acid Ligands to C1q, C3 and C5 described herein are useful as pharmaceuticals. This invention, therefore, also includes a method for treating Complement System-mediated diseases by administration of a Nucleic Acid Ligand capable of binding to a Complement System Protein or homologous proteins. Certain diseases or conditions such as Alzheimer\'s disease or myocardial infarction activate C1q through the collagen-like region. In Alzheimer\'s disease, β-amyloid activates C1q. Structures in heart muscle that are exposed during myocardial infarction such as intermediate filaments, mitochondrial membranes or actin activate C1q. Nucleic Acid Ligands to C3 or to C5 could also inhibit Complement System activation in Alzheimer\'s disease or myocardial infarction, whether the Complement System is activated through C1q by antibody or non-antibody mechanisms, or independent of C1q through the alternative pathway. Thus, the Nucleic Acid Ligands of the present invention may be useful in treating Alzheimer\'s disease or myocardial infarction.

Therapeutic compositions of the Nucleic Acid Ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories are also envisioned. One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used. In one preferred embodiment, it is envisioned that the carrier and the Nucleic Acid Ligand constitute a physiologically-compatible, slow release formulation. The primary solvent in such a carrier may be either aqueous or non-aqueous in nature. In addition, the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release or absorption of the ligand. Such excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form.

Once the therapeutic composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration. The manner of administering formulations containing Nucleic Acid Ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository.

The following Examples are provided to explain and illustrate the present invention and are not intended to be limiting of the invention. These Examples describe the use of SELEX methodology to identify high affinity RNA ligands to C1q, C3 and C5. Example 1 describes the various materials and experimental procedures used in Examples 2, 3, 4 and 6. Example 2 describes the generation of 2′-NH2 RNA ligands to C1q. Example 3 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C3. Example 4 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C5. Example 5 describes the activation of the Complement System through C1q ligands. Example 6 describes the generation of 2′-F RNA ligands to C1q. Example 7 describes an assay for hemolytic inhibition for 2′-F RNA ligands to C5. Example 8 describes an assay for inhibition of C5a release by a Nucleic Acid Ligand (clone C6) to Human C5. Example 9 describes boundary experiments performed to determine the minimum binding sequence for Nucleic Acid Ligands to Human C5. Example 10 describes a Biased SELEX experiment performed to improve Nucleic Acid Ligand affinity, using a 42mer truncated sequence of clone C6 as the random sequence in the template. Example 11 describes the results of 2′-OMe purine substitutions in a Human C5 Nucleic Acid Ligand in an interference assay. Example 12 describes the structure of a 38mer truncate of a Nucleic Acid Ligand to human C5. Example 13 describes a hemolytic assay of 2′-OMe purine substituted Nucleic Acid Ligands to human C5.

Example 1 Experimental Procedures

This example provides general procedures followed and incorporated in Examples 2, 3, 4 and 6 for the identification of 2′-NH2 and 2′-F RNA ligands to C1q, and 2′-F ligands to C3 and C5.

A. Biochemicals

C1q, C3, C5 and C4-deficient guinea pig sera were obtained from Quidel (San Diego, Calif.). Bovine serum albumin (BSA), rabbit anti-BSA, CRP, SAP and β-amyloid peptides 1-40 and 1-42 were obtained from Sigma (St. Louis, Mo.). Nucleotides GTP, ATP and deoxynucleotides were obtained from Pharmacia (Uppsala, Sweden). Taq polymerase was obtained from Perkin-Elmer (Norwalk, Conn.). Modified nucleotides 2′-NH2-CTP and 2′-NH2-UTP, and 2′-F-CTP and 2′-F-UTP, were prepared as described in Jellinek et al. (1995) Biochem. 34:11363. Avian reverse transcriptase was obtained from Life Sciences (St. Petersburg, Fla.) and T7 RNA polymerase from USB (Cleveland, Ohio). Nitrocellulose filters were obtained from Millipore (Bedford, Mass.). All chemicals were the highest grade available.

B. RNA SELEX Procedures

The SELEX procedure has been described in detail in the SELEX patent applications (see also Jellinek et al. (1995) Biochem. 34:11363; Jellinek et al. (1994) Biochem. 33:10450). Briefly, a DNA template was synthesized with a 5′ fixed region containing the T7 promoter, followed by a 30N or a 50N stretch of random sequence, and then with a 3′-fixed region (Table 1; SEQ ID NOS:1 and 156). For the initial round of the SELEX process, 1 nmole (−1014 unique sequences) of RNA (Table 1; SEQ ID NOS:2 and 157) was in vitro transcribed by T7 polymerase (Milligan et al. (1987) Nucleic Acids Res. 12:785) using mixed GTP/ATP and 2′-NH2—CTP/UTP or 2′-F-CTP/UTP nucleotides, and with the addition of α-[32P]-ATP. For this and subsequent rounds of the SELEX process, the RNA was purified by electrophoresis on 8% acrylamide gels with 7 M urea, 10 mM Tris-Borate, 2 mM EDTA, pH 8.3 running buffer. After autoradiography, the band containing labeled, modified RNA transcript was excised and frozen at −70° C., then 400 μL of 100 mM NaCl, 2 mM EDTA was added, the gel was mashed, and the slurry was spun through 2 cm of glass-wool (Rnase-free—Alltech Associates, Deerfield, Ill.) and two nitrocellulose filters. The RNA was precipitated by addition of ⅕ vol of 6.6 M NH4OAc, pH 7.7, plus 2 vol of ethanol. The pellet was washed twice with 80% ethanol, and taken to dryness. The dry RNA pellet was dissolved in phosphate buffered saline (Sambrook et al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) containing 1 mM MgCl2 (MgPBS).

For each round of the SELEX process, the RNA was incubated with C1q, C3 or C5 in MgPBS for 10 minutes at 37° C. Then the sample was filtered through a 43 mm nitrocellulose filter, and the filter was washed with 10 mL of MgPBS. For some rounds, the diluted RNA was pre-soaked with nitrocellulose filters overnight to reduce background. Four samples were run in parallel for most rounds with lesser amounts (chosen to be in suitable range to measure binding) of both RNA and C1q, C3 or C5 to measure binding Kd for each sample. In addition, at each round, a sample of RNA was filtered without protein to determine background.

Filters were air-dried, sliced into strips, counted, and then extracted for 60 minutes at 37° C. with 400 μL of 1% SDS, 0.5 mg/mL Proteinase K (Boehringer Mannheim, Indianapolis, Ind.), 1.5 mM DTT, 10 mM EDTA, 0.1 M Tris, pH 7.5, with addition of 40 μg tRNA carrier. The aqueous RNA was extracted with phenol, phenol/chloroform (1:1), and chloroform and then precipitated following addition of NH4OAc/EtOH as above. The RNA was reverse transcribed in a volume of 50 μL for between 1 hour and overnight. The DNA was PCR amplified with specific primers (Table 1; SEQ ID NOS:3-4) in a volume of 500 μL for 12-14 cycles, and then phenol/chloroform extracted and NaOAc/EtOH precipitated. The DNA pellet was taken up in H2O, and an aliquot was T7 transcribed for the next round of the SELEX process.

C. Cloning

DNA from the 12th or the 14th round was PCR amplified with primers which also contained a ligation site to facilitate cloning. The DNA was cloned into a pUC9 vector, and colonies were picked for overnight growth and plasmid mini-preps (PERFECTprep, 5′-3′, Boulder, Colo.). The purified plasmids were PCR amplified with original 3′ and 5′ primers (as above), and products were analyzed by agarose gel electrophoresis (Sambrook et al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). DNA was T7 transcribed with α-[32P]-ATP to prepare radiolabeled RNA for binding analysis and without radiolabel to prepare RNA for inhibition studies.

D. Sequencing

Plasmids purified using the PERFECTprep kit were sequenced with ABI dRhodamine Terminator cycling kit (Perkin-Elmer). Samples were sequenced on the ABI Prism 377 DNA Sequencer.

E. Binding Assays

Individual cloned DNA was T7 transcribed with α-[32P]-ATP and the full length [32P]-2′-NH2-RNA or 2′-F-RNA was gel-purified (as above). RNA was suspended at approximately 5,000 cpm per 30 μL sample (<10 μM), and aliquots were incubated with various concentrations of C1q, C3 or C5 in MgPBS for 10 minutes at 37° C. Samples were then filtered through nitrocellulose, the filters washed with buffer and dried under an infrared lamp, and counted with addition of scintillation fluid (Ecoscint A, National Diagnostics, Atlanta, Ga.). A background sample of RNA alone was run in parallel. To measure inhibition of ligand binding to C1q, the RNA Nucleic Acid Ligand plus C1q plus inhibitor (e.g., the A-chain residue 14-26 site, SAP, β-amyloid peptide, CRP) were incubated for 10 minutes at 37° C., and then filtered. Filters were washed and counted.

RNA ligand binding to C1q was also measured in the presence of immune-complexes, which would block the binding of ligands to C1q head-groups. Immune complexes (IC) were formed by mixing 620 μg BSA at equivalence with 1 mL of rabbit anti-BSA (Sigma, St. Louis, Mo.) plus PEG 8000 added to 1% final concentration, and then the samples were incubated overnight at 4° C. The IC were pelleted by microfugation at 12,000 rpm for 10 minutes, washed five times with PBS, and suspended in 1 mL of MgPBS. For measurement of C1q RNA clone binding to C1q-immune complexes (C1q-IC), 20 μL of the purified [32P]-RNA plus 20 μL of the IC were mixed with 20 μL of C1q at various concentrations at between 10−11 and 10−7 M in MgPBS plus 1% Triton. Samples were incubated for 30 minutes at room temperature, microfuged, and the pellets and supernatants counted.

F. Hemolytic Assays

Complement System consumption was measured by C4 hemolytic assay as described (Gaither et al. (1974) J. Immunol. 113:574). All samples were diluted and the assay run in veronal-buffered saline containing calcium, magnesium and 1% gelatin (GVB++-complement buffer). For measurement of C4 consumption by β-amyloid peptide consumption, the peptide was added at 250 μg/mL to a ⅛ dilution of whole human serum and then incubated for 60 minutes at 37° C. The sample was then diluted for assay of C4 hemolytic activity. For assay of inhibition of β-amyloid peptide mediated complement consumption by C1q 2′-NH2-RNA clones, the C1q RNA Nucleic Acid Ligand was included in the initial β-amyloid peptide-whole human serum incubation mixture, and then C4 amounts assayed as above.

Complement System inhibition by C5 Nucleic Acid Ligands was measured using human serum and antibody-coated sheep red blood cells. The red blood cells were incubated with a 1:40 dilution of fresh human serum and with serial dilutions of C5 ligand for 30 minutes at 37° C. Dilutions of serum and ligand were made in complement buffer (see previous paragraph). After incubation the samples were then diluted with 4° C. buffer containing EDTA to stop the reaction, and the hemoglobin release was quantitated from the optical density at 412 nm.

Example 2 2′-NH2 RNA Ligands to C1q

A. RNA SELEX

The pool of random 50N7-2′-NH2 RNA bound to C1q by nitrocellulose filter assay with a Kd of 2.3 μM. For round 1 of the SELEX process, the C1q concentration was between 0.156-1.25 μM and the RNA concentration was 15 μM. Throughout the SELEX process, the RNA concentrations were maintained at approximately 10-fold greater than the concentration of C1q, which was reduced at each round with a final round 14 C1q concentration of 136 pM. Background binding of RNA to nitrocellulose filters remained low throughout the SELEX procedure, in part because RNA was pre-adsorbed with nitrocellulose filters. The binding of pool RNA to C1q improved at each round. The evolved round 14 pool 2′-NH2 RNA bound C1q with a Kd=670 pM, yielding an overall improvement in binding Kd of 3400-fold.

Bulk RNA was then cloned for sequence determination and evaluation of binding. Through comparison of binding at 0.1 and 0.5 nM C1q, individual clones were ranked, and clones with C1q binding above background were sequenced and are shown in Table 2 (SEQ ID NOS:5-20). Family 1 contained 12 of the 19 total sequences. Family 2 contained three sequences. Both Family 3 and Family 4 contained two sequences. Both Family 1 and Family 2 sequences contain G-rich regions and both have the repeated sequence motifs GGAG and GGUG. The identity and homology of Family 1 members is greatest in the 5′ half, which is G-rich. The C-rich 3′ half has only short stretches of sequence homology, and these are shown only with inclusion of large gap regions. Sequences from all families can be folded to give stem-loop structures with extensive Watson-Crick base-pairing. Full binding curves for the highest affinity ligands yielded a Kd range from 290 pM to 3.9 nM; the high affinity ligands were found in all four sequence families. All of the binding curves were monophasic. The binding maximum is not 100% because of variable amounts of nucleic acid alterations taking place during purification. This is known because usually ligands can be bound to protein, extracted, and then re-bound, and give maximum binding approaching 100% (data not shown).

B. Competition

2′-NH2 RNA ligands from different families interact with the same or overlapping sites on C1q, as shown by cross-competition. This site is on the collagen-like region, at or near the A-chain 14-26 residue site (Jiang et al. (1994) J. Immunol. 152:5050) as shown by two lines of evidence. First, C1q when bound to IC still binds the ligand #50 (SEQ ID NO:12); binding to immunoglobulin Fc would block the head region, but leave the collagen-like tail available, suggesting that nucleic acid ligands derived by the SELEX process are bound to the tail. Second, and more direct, ligand #50 is competed by proteins which are known to bind the A-chain residue 14-26 site, including SAP, β-amyloid peptide and CRP. Finally, ligand #50 is competed by a peptide that has the same amino acid sequence as residues 14-26 on the A-chain. This result is further supported by results for hemolytic inhibition as described below.

C. Consumption

Binding of a nucleic acid ligand derived by the SELEX process to the A-chain 14-26 amino acid site could activate C1q or alternatively, SELEX-derived nucleic acid ligands could inhibit the binding of other molecules and prevent C1q activation. This was tested by measuring C4 consumption in serum after incubation with a 2′-NH2 SELEX-derived nucleic acid ligands, or after incubation with a known C1q activator together with a 2′-NH2 nucleic acid ligand. The SELEX-derived nucleic acid ligands when incubated in serum do not consume C4, and thus are not C1q activators. Nor do these ligands at this concentration inhibit serum lysis of antibody-coated sheep erythrocytes, which would occur if ligands bound near the C1q head groups (data not shown). The ligands do inhibit C4 consumption by another C1q activator, the β-amyloid 1-40 peptide. This peptide is known to activate C1q through binding at the A-chain 14-26 residue site; therefore, this inhibition confirms that SELEX-derived nucleic acid ligands bind at this A-chain site. Control ligands from the SELEX process that did not bind C1q by nitrocellulose assay were also ineffective in blocking the β-amyloid 1-40 peptide C1q activation.

Example 3 2′-Fluoro Nucleic Acid Ligands of Complement System Protein C3

In order to generate ligands to complement protein C3, a library of about 1014 RNA was generated that contained 30 nucleotides of contiguous random sequence flanked by defined sequences. In this experiment, 30N random nucleotides of the initial Candidate Mixture were comprised of 2′-F pyrimidine bases. The rounds of selection and amplification were carried out as described in Example 1 using art-known techniques. In round 1 the 30N7-2′-F-RNA and C3 were both incubated at 3 μM. There was barely detectable binding at this round. Both the RNA and C3 concentrations were decreased during the SELEX procedure. Sequences derived from the SELEX procedure are shown in Table 3 (SEQ ID NOS:21-46).

Example 4 2′-Fluoro Nucleic Acid Ligands of Complement System Protein C5

In order to generate ligands to human complement protein C5, a library of about 1014 RNA was generated that contained 30 nucleotides of contiguous random sequence flanked by defined sequences. In this experiment, the 30N random nucleotides of the initial Candidate Mixture were comprised of 2′-F pyrimidine bases. Briefly, a DNA template was synthesized with a 5′-fixed region containing the T7 promoter, followed by a 30N stretch of random sequence, and then with a 3′-fixed region (Table 1; SEQ ID NO:1). The rounds of selection and amplification were carried out as described in Example 1 using art-known techniques. The initial rounds of the SELEX experiment were set up with high concentrations of 2′-F RNA (7.5 μM) and protein (3 μM), as the binding of C5 to unselected RNA was quite low. The SELEX experiment was designed to promote binding of RNA at the C5a-05b cleavage site. RNA and C5 were incubated together with small amounts of trypsin, with the reasoning that limited trypsin treatment of C5 produces a single site cleavage and generates C5a-like activity (Wetsel and Kolb (1983) J. Exp. Med. 157:2029). This cleavage led to a slight increase in random RNA binding. Enhanced RNA binding associated structurally with exposure of the C5a-like domain could evolve Nucleic Acid Ligands that bind near the C5 convertase site and could interfere with or inhibit C5 cleavage. The SELEX experiment was performed simultaneously to both the native and to the mildly-trypsinized protein, so that Nucleic Acid Ligand evolution would pick the highest affinity winner. With this procedure the highest affinity winner against the multiple protein species would be evolved, and multiple aptamers and specific aptamers might be obtained out of a single SELEX experiment.

For each round of the SELEX process, the procedure was performed in parallel in separate tubes with approximately 5-fold excess of RNA either in buffer alone or with addition of trypsin at between 0.3 and 0.0001 mg/mL. Samples were incubated in MgPBS for 45 minutes at 37° C., and then filtered through nitrocellulose. The filters were washed, dried and counted, extracted, reverse-transcribed, then PCR amplified and finally T7 transcribed in vitro into RNA using mixed GTP/ATP and 2′-F-CTP/UTP nucleotides and α-[32P]-ATP. RNA was purified by electrophoresis in 8% acrylamide gels with 7M urea and Tris-Borate EDTA buffer (TBE). RNA was isolated and precipitated with NH4OAc/ethanol, and then dissolved in phosphate-buffered saline containing 1 nM MgCl2 (MgPBS). Filters with the highest binding were carried forward. At the end of each round, all of the RNA that bound to the protein (either with or without trypsin) was pooled. The protein and RNA concentrations at each round were reduced, with final concentrations of 2.5 nM and 10 nM respectively. Trypsin was added at concentrations between 0.3 and 0.0001 μg/mL. Background binding was monitored at each round, and starting at round four the transcribed RNA was presoaked overnight with nitrocellulose filters prior to the SELEX rounds to reduce background.

Based on binding of RNA to native C5 by nitrocellulose assay, round twelve DNA was cloned and sequences were obtained as shown in Table 4 (SEQ ID NOS:47-74). Sequences were grouped according to homology and function. Group I sequences are highly homologous and might have arisen by PCR mutation from a single original sequence. Binding affinities of the Group I Nucleic Acid Ligands are very similar and are shown in Table 7. Group II Nucleic Acid Ligands generally bound with similar affinity to Group I Nucleic Acid Ligands, although some weak binders were also present. Group II sequences and length are more diverse than Group I Nucleic Acid Ligands. The C5 Nucleic Acid Ligands do not bind other complement components including C1q, C3, or factors B, H, or D.

Nucleic Acid Ligands from each family were also assayed for inhibition of rat Complement System activity (Table 5; SEQ ID NOS:76-83). Nucleic Acid Ligands from Family I and Family III inhibited rat complement, whereas a Nucleic Acid Ligand from Family II did not. An inhibitory Nucleic Acid Ligand can be used to inhibit Complement System activity in various rat disease models including, but not limited to, myasthenia gravis, myocardial infarction, glomerulonephritis, ARDS, arthritis and transplantation.

Example 5 Activation of the Complement System through C1q Nucleic Acid Ligands

Oligonucleotides can activate both classical and alternative pathways. Particularly, poly-G oligonucleotides which can form G-quartet structures and can interact with the C1q collagen-like region are able to form high molecular weight aggregates, which both bind and activate C1q. Phosphorothioate oligonucleotides, which have increased non-specific binding as compared with phosphodiester oligonucleotides, are also efficient Complement System activators, particularly poly-G containing phosphorothioate oligonucleotides. Results for oligonucleotide activation of solution phase Complement are shown below where classical pathway activation is measure by the release of C4d fragment by ELISA (Quidel, San Diego, Calif.), and alternative pathway activation is measure by Bb ELISA (Quidel, San Diego, Calif.). Although these pathways are separate, there is evidence to suggest that oligonucleotide activation of both pathways is C1q dependent.

[C4d] μg [Bb] μg Sample (Class.) (Altern.) Poly-AG Random Co-Polymer 8.1 18.9 Poly-G Random Co-Polymer 1.2 29.3 Poly-I Random Co-Polymer 0 14.7 Poly-A Random Co-Polymer 0 0 Poly-U Random Co-Polymer 0 1.8 Poly-C Random Co-Polymer 0 2.5 Phosphorothioate Oligonucleotides GGCGGGGCTACGTACCGGGGCTTTGTAAAACCCCGCC −7.1 32.4 SEQ ID NO: 197 CTCTCGCACCCATCTCTCTCCTTCT

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this High affinity nucleic acid ligands of complement system proteins patent application.

Patent Applications in related categories:

20130116311 - Catecholamine enzyme fusions - Provided is a construct comprising (i) a nucleotide sequence which encodes tyrosine hydroxylase (TH), (ii) a nucleotide sequence which encodes GTP-cyclohydrolase I (CH1) and (iii) a nucleotide sequence which encodes Aromatic Amino Acid Dopa Decarboxylase (AADC) wherein the nucleotide sequence encoding TH is linked to the nucleotide sequence encoding CH1 ...


###
monitor keywords

Other recent patent applications listed under the agent Gilead Sciences, Inc.:

20090324543 - Pyrido(3,2-d)pyrimidines useful for treating viral infections
20090317361 - Carba-nucleoside analogs for antiviral treatment
20090318396 - Corticosteroid linked beta-agonist compounds for use in therapy
20090312318 - Therapeutic compounds and methods
20090306054 - Integrase inhibitors
20090306112 - Antiviral protease inhibitors



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like High affinity nucleic acid ligands of complement system proteins or other areas of interest.
###


Previous Patent Application:
Treatment of cancer by inhibition of igfbps and clusterin
Next Patent Application:
In vivo and ex vivo gene transfer into renal tissue using gutless adenovirus vectors
Industry Class:
Drug, bio-affecting and body treating compositions

###

FreshPatents.com Support - Terms & Conditions
Thank you for viewing the High affinity nucleic acid ligands of complement system proteins patent info.
- - - AAPL - Apple, BA - Boeing, GOOG - Google, IBM, JBL - Jabil, KO - Coca Cola, MOT - Motorla

Results in 1.2633 seconds


Other interesting Freshpatents.com categories:
Electronics: Semiconductor Audio Illumination Connectors Crypto ,  g2