freshpatentsnav7small (2K)

3

views for this patent on FreshPatents.com
updated 06/14/13

    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • COMPANY PATENTS
  • Patents sorted by company.

Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal   

pdficondownload pdfimage preview


Abstract: The invention relates to a process for identification, amplification and differentiation of cardiac stem cells by utilizing an ILK based protocol. The invention further relates to a process for post myocardial infarction (IVII) remodeling by way of the integrin linked kinase (ILK) signaling pathway. Still further, the invention relates to a process for affecting an ability to control and/or manipulate stem cell frequency, cellular fate, self-renewal, multilineage differentiation, and potential for oncogenesis in cardiac tissue derived from embryonic stem cells, fetal tissue or adult tissue comprising modulation of ILK signaling amplification whereby stem cell renewal and expansion results. ...

Agent: - Toronto, CA
Inventors: John G. COLES, Gregory Hannigan, Huanzhang Lu
USPTO Applicaton #: #20110059479 - Class: 435 29 (USPTO) - 03/10/11 - Class 435 
Related Terms: Cell Proliferation   Infarction   Integrin   Myocardial Infarction   Yoca   
view organizer monitor keywords


The Patent Description & Claims data below is from USPTO Patent Application 20110059479, Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal.

pdficondownload pdf

FIELD OF THE INVENTION

This invention relates generally to the benefits of elevated expression of Integrin Linked Kinase (ILK), particularly to the cardioprotective effect evidenced as a result of upregulation of ILK post myocardial infarction, and most particularly to ILK mediated reduction of infarct size and beneficial increase in left ventricular mass post MI and to use of ILK as a means for cardiac stem cell proliferation and self-renewal.

BACKGROUND OF THE INVENTION

The major barrier to the use of stem cell therapy in regenerative medicine is the inability to regulate the dichotomous capacity for stem cell self-renewal versus the process of cell lineage commitment. The solution to this problem will require an improved understanding of the inductive signals and the cognate signal transduction pathways which determine cellular fate, and which specifically govern the competitive outcomes of self-renewal with maintenance of pluripotency, versus differentiation into a specialized tissue phenotypei.

The evolutionarily conserved canonical Wnt pathway has been implicated in both human and mouse embryonic stem (ES) cell self-renewal competenceii. Inactivation of glycogen synthase kinase-3β (GSK-3β) leads to nuclear accumulation of β-catenin, which, in turn, leads to the activation of Wnt target genes implicated in the proliferation of endothelial precursor cellsiii, and in self-renewal of HESCsiv.

ILK is a protein Ser/Thr kinase that binds to the cytoplasmic domains of β1, β2 and β3-integrin subunitsv. ILK is regulated in a phosphoinositide 3′-kinase (PI3K)-dependent manner following distinct signal inputs from integrins and growth factor receptor tyrosine kinasesvi,vii. Conditional knockdown and RNA interference experiments indicate that ILK is required for phosphorylation of PKB/Akt Ser473 and GSK-3β Ser9viii. Since inhibitory phosphorylation of GSK-3β is sufficient for maintenance of an undifferentiated phenotype in mouse and human ESCs, ILK is a candidate kinase activator of a critical stem cell signaling cascade.

We have shown that cardiac-restricted ILK over-expression in a mouse model causes a compensatory (beneficial) form of cardiac hypertrophy. Molecular analysis revealed that ILK mediated hypertrophy is dependent upon a novel pathway involving activation of the small G-protein, Rac1. Gene expression profiling of ILK transgenic mice subjected to LAD ligation-induced myocardial infarction revealed up-regulation of transcripts linked to IL-6 and Janus-associated tyrosine kinase/signal transducer of activated transcription (JAK/STAT3) signaling. These studies establish ILK as an important new cardiovascular target. The activation of these signaling cascades in this myocardial injury model should be stimulative to stem cell recruitment based on their established role in cell renewal in mouse ESCs.

We anticipate that fetal sources of tissue will be enriched for stem cells, given that stem cell activation recapitulates fetal programming. We have developed and characterized an in vitro model of human fetal cardiac myocytes (HFCM)ix, and characterized the genomic response to ischemic stress during human heart surgery in vivox. We have shown that cardiac stem-like cells can be identified by c-kit staining in HFCM with a frequency approximately one order of magnitude higher than that described for adult heartxi. Further, we have shown that ILK gain-of-function increases the frequency of c-kit- and CD133-positive cardiac progenitor cells isolated from human myocardium, highlighting this as a rational approach to augment stem cell-based cellular therapy.

Ventricular hypertrophy is an extremely common clinical condition that appears as a consequence of any variety of volume and or pressure overload stresses on the human heart. An increase in ventricular mass occurring in response to increased cardiac loading is generally viewed as a compensatory response, which serves to normalize ventricular wall tension and improve pump function. Conversely, a sustained or excessive hypertrophic response is typically considered maladaptive, based on the progression to dilated cardiac failure sometimes observed clinically, and the statistical association of ventricular hypertrophy with increased cardiac mortality. Whereas mouse models of cardiac hypertrophy have been generated by genetically-induced alterations in the activation state of various kinases in the heart, limited information is available regarding the role of specific signaling pathways activated during human ventricular hypertrophy.

The identification of the kinase pathways implicated in human hypertrophy has important therapeutic implications, since it will allow testing of the hypothesis that enforced hypertrophy induction represents a beneficial remodeling response, and a useful strategy to preserve cardiac function and arrest the transition to a dilated phenotype.

DESCRIPTION OF THE PRIOR ART

U.S. Pat. Nos. 6,013,782 and 6,699,983 are directed toward methods for isolating ILK genes. The patents suggest that modulation of the gene activity in vivo might be useful for prophylactic and therapeutic purposes, but fails to teach or suggest any perceived benefit relative to over or under expression of ILK with respect to cardiac hypertrophy or post MI cardiac remodeling.

SUMMARY

OF THE INVENTION

An increase in hemodynamic wall stress (also termed afterload) due to impedance to outflow of blood from either the right or left ventricle can result in concentric cardiac hypertrophy of the affected ventricle. Diseases affecting intrinsic cardiac function, such as coronary artery disease or various forms of cardiomyopathy, may indirectly increase afterload, and lead to a hypertrophic response involving the residual, non-diseased myocardium.

Integrins have been implicated as a component of the molecular apparatus which serves to transduce biomechanical stress into a compensatory growth program within the cardiomyocyte, based on their role in linking the extracellular matrix (ECM) with intracellular signaling pathways affecting growth and survival. Melusin is a muscle protein that binds to the integrin β1 cytoplasmic domain and has been identified as a candidate mechano sensor molecule in the heart. Experimental aortic constriction in melusin-null mice results in an impaired hypertrophic response through a mechanism involving reduced phosphorylation of glycogen synthase kinase-3β (GSK3β), which inhibits a key nodal regulator of cardiac hypertrophic signaling. The role of melusin or other potential molecules participating in the endogenous hypertrophic response to disease-induced cardiac hypertrophy in humans, however, remains unknown.

Integrin-linked kinase (ILK) is a protein Ser/Thr kinase that binds to the cytoplasmic domains of β1, β2 and β3-integrin subunits. ILK serves as a molecular scaffold at sites of integrin-mediated adhesion, anchoring cytoskeletal actin and nucleating a supramolecular complex comprised minimally of ILK, PINCH and β-parvin. In addition to its structural role, ILK is a signaling kinase coordinating cues from the ECM in a phosphoinositide 3′-kinase (PI3K)-dependent manner following distinct signal inputs from integrins and growth factor receptor tyrosine kinases. ILK lies upstream of kinases shown in experimental models to modulate hypertrophy, and is required for phosphorylation of protein kinase B (Akt/PKB) at Ser473 and GSK3β at Ser9. Rho-family guanine triphosphatases (GTPases, or G-proteins), including RhoA, Cdc42, and Rac1, modulate signal transduction pathways regulating actin cytoskeletal dynamics in response to matrix interaction with integrin and other cell surface receptors. Both RhoA and Rac1 have been shown to modulate cardiac hypertrophy. ECM adhesion stimulates the increased association of activated, GTP-bound Rac1 with the plasma membrane, suggesting a role for ILK in promoting membrane targeting of activated Rac1. ILK may also activate Rac1 through regulated interaction of the Rac1/Cdc42 specific guanine-nucleotide exchange factor (GEF), ARHGEF6/-PIX, with β-parvin, an ILK-binding adaptor, as occurs during cell spreading on fibronectin. ILK is thus positioned to functionally link integrins with the force-generating actin cytoskeleton, and is a candidate molecule in the transduction of mechanical signals initiated by altered loading conditions affecting the heart.

The instant invention demonstrates that ILK protein expression is increased in the hypertrophic human ventricle, and further demonstrates that ILK expression levels correlate with increased GTP loading, or activation, of the small G-protein, Rac1. Transgenic mice with cardiac-specific activation of ILK signaling are shown to exhibit compensated LV hypertrophy. In agreement with the findings in the human hypertrophic heart, ventricular lysates derived from ILK over-expressing mice lines exhibit higher levels of activated Rac1 and Cdc42, in association with activation of p38 mitogen-activated protein (p38MAPK) and ERK1/2 kinase cascades.

Additionally, increased ILK expression is shown to enhance post-infarct remodeling in mice through an increased hypertrophic response in myocardium remote from the lesion. The transgenic models indicate that ILK induces a program of pro-hypertrophic kinase activation, and suggest that ILK represents a critical node linking increased hemodynamic loading to a cardioprotective, hypertrophic signaling hierarchy. Moreover, the ILK transgenic mouse is shown to provide a new model of cardiac hypertrophy that is highly, relevant to human cardiac disease.

Protein kinases are increasingly understood to be important regulators of cardiac hypertrophy, however the critical question arises of whether kinases known to induce experimental hypertrophy are, in fact, up-regulated or activated as a feature of human cardiac hypertrophy. The instant invention unequivocally demonstrates increased expression and activity of a candidate mechano-sensor/transducer, namely ILK, in human cardiac hypertrophy.

Moreover, it is shown that moderate up-regulation of ILK in the myocardium of transgenic mice causes a compensated form of cardiac hypertrophy, as evidenced by unimpaired survival, preserved systolic and diastolic function, and the absence of histopathological fibrosis. Among a number of hypertrophy-inducing protein kinases that were examined, only two, ILK and PKB, demonstrated elevated protein levels in association with hypertrophy. Of these, ILK was consistently elevated in both congenital and acquired hypertrophies. Importantly, in consequence of ILK expression, transgenic myocardium exhibited a strikingly similar profile of protein kinase activation, to that seen in human cardiac hypertrophy. The fact that ILK up-regulation is associated with mechanical load-induced hypertrophy (secondary to congenital and acquired forms of outflow tract obstruction), in which global cardiac function was preserved, provides compelling evidence that ILK activation is associated with a provokable, compensatory form of hypertrophy in the human heart. At the molecular level, the human and mouse data included herein suggest that ILK is a proximal mechanotransducer, acting to coordinate a program of “downstream” hypertrophic signal transduction in response to pressure overload in the myocardium.

The lack of Akt/PKB and GSK3β phosphorylation in ILK over-expressing mice was unexpected, given that ILK is regulated in a PI3K-dependent manner, and has been shown to directly phosphorylate both target kinases in non-cardiomyocytes 10, 12, 13, 14, and contrasts with findings from genetic models of cardiac-specific PI3K and Akt/PKB activation, which feature increased phosphorylation of both Akt/PKB and GSK3β in proportion to the degree of hypertrophy. We note, however, that levels of PKB Ser473 and GSK-3β Ser9 phosphorylation are quite high in both murine and human control hearts, consistent with the requirement for a threshold basal level of activation of theses kinases, which may be permissive to the induction of ILK-mediated hypertrophic signaling. Our results are thus consistent with operation of a p110/ILK/Rac1 pathway, but suggest that the ILK-specific hypertrophy is not critically dependent upon increased phosphorylation of PKB/Akt or GSK3β. The relative de-activation of Akt/PKB during ILK transgenesis is consistent with the finding that activation of Akt/PKB and inhibitory phosphorylation of GSK3β occur in advanced failure, but not during compensated hypertrophy, in human hearts. Thus, the lack of highly activated Akt/PKB in murine and human hearts exhibiting elevated ILK expression may be a signature of compensated hypertrophy.

Our results in transgenic mice with ILK over-expression, as well as in human hypertrophy, reveal the selective activation of ERK1/2 and p38 signaling pathways, despite evidence for the relative deactivation of PI3K-dependent signaling through Akt/PKB and GSK3β. Genetic stimulation of the ERK1/2 branch of the MAPK signaling pathway has been shown previously to be associated with a physiological hypertrophic response and augmented cardiac function. S6 kinases promote protein translation by phosphorylating the S6 protein of small ribosomal subunits, and are required for mammalian target of rapamycin (mTOR)-dependent muscle cell growth. Activation of p70 ribosomal protein S6 kinase (p70S6K) provides a potential pathway mediating ILK-triggered myocyte hypertrophy which is independent of the Akt/PKB pathway. Indeed, ILK is sufficient to regulate the integrin-associated activation of Rac1 and p70S6K, leading to actin filament rearrangement and increased cellular migration. Considered together, our results indicate conservation of downstream signaling specificity resulting from ILK activation in both murine and human hypertrophy. Full elucidation of the unique network of effectors induced during ILK gain-of-function is accomplished by application of high-throughput functional proteomic approaches to genetic models, as well as to stage-specific human diseases characterized by hypertrophic remodeling.

The reciprocal pattern of activation of Rac1 and de-activation of Rho is well-precedented and reflects opposing effects of these monomeric GTPases on the cytoskeleton at the leading edge of migrating cells. Similarly, our results show reciprocal effects both in vitro and in vivo on the activation of Rac1/Cdc42 and Rho in response to ILK upregulation. These data are thus consistent with the observation that transgenic mice over-expressing RhoA develop a predominantly dilated cardiomyopathic phenotype which is antithetical to that observed with ILK activation.

Our data indicates that hemodynamic loading secondary to infarct induction in ILKS343D Tg mice provoked a stress response, which resulted in a larger increase in LV mass and smaller infarct size relative to control. The mechanism(s) accounting for the post-infarction cardioprotective effects of ILK activation require further study, but our result is consistent with the report that thymosin β4 improves early cardiomyocyte survival and function following LAD ligation through a pathway shown to be dependent upon increased ILK protein expression. One putative explanation for the cardioprotective effect of ILK activation in this model is the reduction in wall stress secondary to the observed ILK-potentiated hypertrophic response. The importance of reactive hypertrophy of remote myocardium in limiting wall stress and adverse remodeling after MI has been shown both in patients, and in mice with loss-of-function mutations in pro-hypertrophic, calcineurin-dependent signaling pathways. Further, ILK/Rac1 activation in cardiac myofibroblasts may plausibly promote more efficient scar contraction through mechanisms related to effects on the actin cytoskeleton, which favor a more contractile, motile and invasive cellular phenotype.

In summary, our results identify a novel role for ILK-regulated signaling in mediating a broadly adaptive form of cardiac hypertrophy. The effects of small molecule inhibitors of ILK demonstrated experimentally suggest that this pathway is therapeutically tractable, and together with our results, that modulation of the ILK pathway warrants evaluation as a novel approach to enhance the remodeling process relevant to a wide range of cardiac diseases.

Accordingly, it is a primary objective of the instant invention to teach a process for instigating beneficial human hypertrophy as a result of overexpression of ILK.

It is a further objective of the instant invention to teach a beneficial protective process for post MI remodeling as a result of ILK overexpression.

It is yet another objective of the instant invention to teach a control for instigating ILK overexpression. The objective is to evaluate the capacity of ILK gain-of-function to promote stem cell self-renewal. This objective can be evaluated in a range of cell types derived from ESCs, fetal and adult tissue, available in our Lab and the NRC. Of interest will be the effect of modulation of ILK signaling amplification on stem cell frequency, and oh cellular fate, focusing on self-renewal, multilineage differentiation, and the potential for oncogenesis. A major objective of the project is the development of novel methods for the identification, amplification and differentiation of cardiac stem cells. These studies will take into account the effect of instructive (extra-cellular) environmental cues on intra-cellular signal transduction events. The generic pro-survival effect of ILK up-regulation is predicted to enhance cellular transplantation survival, and this important effect can be evaluated in therapeutically relevant in vivo and in vitro models. ILK-based protocols will be investigated both as standalone strategies, and in conjunction with anti-oxidant strategies developed at the NRC.

Other objects and advantages of this invention will become apparent from the following description taken in conjunction with any accompanying drawings wherein are set forth, by way of illustration and example, certain embodiments of this invention. Any drawings contained herein constitute a part of this specification and include exemplary embodiments of the present invention and illustrate various objects and features thereof.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: ILK expression in normal and hypertrophied human ventricles: a, Ventricular lysates from patients with congenital outflow tract obstruction (H1, H2), exhibiting severe hypertrophic valvular heart disease, and from (non-hypertrophic) normal human fetal (19 weeks old) ventricle (N1, N2), were immunoblotted for levels of ILK protein, with GAPDH as loading control. Ratios indicate ILK protein levels normalized to GAPDH. b, Ventricular lysates from hypertrophic (HOCM) and normal (non-hypertrophied) human hearts were analyzed by western blotting for levels of ILK and ParvB. GAPDH was the loading control.

FIG. 2 Rac, Rho and Cdc42 expression in human heart tissue: a, Normal and hypertrophic (HOCM) human ventricular lysates (FIG. 1) were assayed for activation of Rho family GTPases, as indicated. b, Ventricular lysates from the congenital samples (H1, H2) and normal human fetal hearts (19 weeks, FIG. 1) were assayed for Rho family activation. Ratios represent densitometric values of activated/total GTPase signals for Rho, Rac1 and Cdc42.

FIG. 3: Phosphorylation of GSK3β, PKB, and MAP kinase in human heart tissue: a, Ventricular lysates labeled N1, N2, H1 and H2 were as in FIGS. 1 and 2, above. b and c, Ventricular lysates from normal and hypertrophic human adult hearts, were as in FIGS. 1 and 2. Lysates were resolved by SDS-PAGE and analyzed by western blotting for levels of the indicated total and phosphorylated proteins.

FIG. 4: Characterization of ILKs343 transgenic mice: a, Genomic DNA from ILKS343D Tg and NTg littermates was analyzed by Southern blotting using a human ILK cDNA probe. b, ILK-specific RT-PCR of total RNA isolated from heart tissue with (upper panel) or without (control, middle panel) reverse transcriptase, and on skeletal muscle (bottom panel) with reverse transcriptase. This yields the expected product 1.46 kb in length, expressed in the hearts of Tg mice, but not in the hearts of NTg littermates or skeletal muscle of the Tg mice. The lane marked ‘P’ is the PCR product obtained using α-MHC/ILK plasmid as template. This product is larger than 1.46 kb because the PCR primers encompass exons 1 and 2 of the α-MHC promoter. c, Western immunoblot analysis of ILK protein levels in ILK Tg and control (NTg) hearts. Signal densities normalized to that of GAPDH were 3-fold higher in ILK Tg hearts. d, ILK immune complex kinase assays of heart lysates from ILKS343D Tg and NTg littermates. Purified myosin light chain II, 20 kDa regulatory subunit was added as exogenous substrate.

FIG. 5: Increased cardiomyocyte size in ILKS343D Tg mice: a, Gross morphology of hearts from ILKS343D Tg mice and NTg littermates. Enlarged hearts of ILKS343D mice exhibited concentric hypertrophy evident by an approximate 25% increase in heart weight to body weight ratios relative to that in NTg controls (controls for all comparisons are age- and sex-matched littermates, see Table 2B). Histological studies using Masson\'s trichrome and picrosirius red staining (not shown) indicated no conspicuous increase in collagen in the ILKS343D Tg hearts. b, Mean values of cardiomyocyte areas based on approximately 500 cells per mouse with centrally positional nuclei. This analysis indicated a 20-25% increase in cardiomyocyte area, thereby accounting for the observed increase in LV mass. c, Representative echocardiograms showing details of dimensional measurements. At 15 months, ILKS343D Tg mice exhibited significant increases in LV mass as well as LV cavitary dimensions at end-systole and end-diastole (p<0.05), and preserved LV function based on echocardiography (% fractional shortening, Table 1, Supplemental) and invasive hemodynamic measurements (Tables 2 and 3, Supplemental).

FIG. 6: Selective activation of hypertrophic signaling in ILKWT, but not ILKR211A transgenic hearts: Ventricular lysates from a) ILKWT and b) ILKR211A Tg mice were assayed for activation of Rac1, Cdc42 and RhoA, using specific immunoaffinity assays as described in Materials and Methods. In each panel, parallel assays of ventricular lysates from littermate NTg controls are shown. Ventricular lysates from c) ILKWT and d) ILKR211A Tg mice were resolved by SDS-PAGE and analyzed by western blotting for levels of the indicated total and phosphorylated proteins. GAPDH was analyzed in parallel as loading control. Controls were NTg littermates. e. Ventricular lysates form ILKWT and ILKR211A mice were analyzed by western blotting for total ILK, HA tag, and the ILK-associated adaptor, ParvB, as indicated.

FIG. 7: Selective activation of Rho family GTPases by ILKWT, but not ILKR211A in primary human cardiomyocytes: a. Primary human fetal cardiomyocytes were infected with adenoviruses, with or without (EV) ILKWT or ILKR211A cDNA. At 48 hr post-infection, cells sere harvested and lysates assayed for activation of Rho family GTPases. As indicated, cultures were infected in the presence of the small molecule ILK inhibitor, KP-392.

FIG. 8: Cardiac expression of ILKS343D improves post-infarct remodeling: LV infarction was created in 6 month ILKS343D (ILK Tg) and littermate control (NTg) mice by LAD ligation. The ILK TG genotype exhibited a significantly greater LV mass (p=0.01) and a reduction in scar area indexed to LV mass (p=0.047), as determined by planimetry at 7 days post-infarction. Upper panels, pre LAD ligation; lower panels, post LAD ligation.

FIG. 9: Activation of hypertrophic signaling in ILKS343D Tg mice: Hearts from two Tg ILKS343D and two NTg littermate controls were extracted and proteins resolved on 10% SDS-PAGE. Western blotting using antibodies against total and phosphorylated forms of the indicated protein kinases was performed to assess the relative activation levels of these pathways. For PKB and GSK3β determinations the ratio of densitometric signals of phosphorylated/total protein were determined for each sample, and are displayed under the panels. GAPDH was used as a loading control.

FIG. 10: Selective activation of Rac1 and Cdc42 in ILKS343D Tg mice: Affinity-based precipitation assays were conducted (see Methods) to determine the ratio of GTP-bound (activated) to total: a) Rac1, b) Cdc42 and c) RhoA GTPases in cardiac lysates of ILKS343D Tg and non-Tg littermate mice. Histograms summarize data from 4 hearts of each genotype.

FIG. 11: Adenovirus encoding either the human wild-type human gene linked to GFP (AD.ILK) or empty virus (Ad.C) was used to infect human fetal cardiomyocytes cultured in IMDM supplemented with 10% fetal bovine serum. a Effective gene transfer was confirmed by more than 80% GFP positivity. b ILK infection increased ILK protein expression ˜3-fold; the western blots shown are representative of 5 independent experiments. c Cardiac cell cultures labeled with c-Kit (green) and cardiac myosin MF20 (red). Nuclei were stained with DAPI (blue). Scale bar-10 mm. d Cultures infected with ILK yielded a significant ˜(*p=0.001)˜5-fold increase in both the absolute number and the frequency of c-KitPOS cells, which reached ˜one cell in 250. Analysis is based on 5 independent experiments. Error bars indicate standard error of the mean.

FIG. 12: Primary cardiospheres (CS) were generated from human fetal cardiomyocytes grown in serum-free media supplemented with bFGF and EGF (Methods) and imaged using natural light phase microscopy. Dissociated primary CS comprised of homogeneous phase-bright cells placed in wells containing same media gave rise to secondary CS in approximately 60% of wells.

FIG. 13: Cardiospheres were comprised of cells expressing the c-KitPOS surface receptor. Occasional cells at the periphery of the spheres stain for the cardiac marker α-actinin (arrow), suggesting a radial gradient in the differentiation of constituent cells.

FIG. 14: a Cardiospheres were observed in human fetal cardiac cell cultures. Cardiac cells were infected with adenoviral ILK (Ad.ILK) or empty viral vector (Ad.C) (at 10 pfu/ml), or left untreated (Control). ILK infection resulted in significant (*p<0.01) increases in the absolute number and frequency of CS at all plating densities tested. b The number of primary sphere initiating cells ratio was significantly higher in ILK-infected cells (*p=0.002). Whereas 0.41±0.073% of ILK-infected cells generated spheres, only 0.037±0.014% of control cells and 0.035±0.006% of virus-only cells generated spheres. Analysis is based on 6 independent experiments. Error bars represent standard error of the mean.

FIG. 15: a Secondary cardiospheres (CS), derived from cells isolated from a dissociated primaryCS, shown in upper left panel, contains ILK-infected GFPpos cells. CS were placed in differentiating medium (IMDM+10% FBS) containing the 5-methyltransferase inhibitor, 5-Aza-deoxycytodine (10 μM) for 14 days. b Arrows indicate CS containing cells marked by DAPI staining, which are also positive for the cardiomyocyte-specific marker, α-cardiac actinin. Lower panel (left) shows a higher power view of cells migrating outward from CS, 45-50% of which are cardiomyocytes. Lower panel (right) shows that ˜10% of CS-derived cells stain positively (green) for von Willebrands Factor (vWF), indicative of endothelial cell lineage. 35-40% of cells stained positively for α-smooth muscle actin (not shown). c The differentiation profiles were similar among ILK-infected (Ad.ILK), empty virus (AD.C), and control CS. This result indicates the feasibility of manipulating the phenotypic outcome of cardiac progenitor cells, even among ILK-transformed cells.

DETAILED DESCRIPTION

OF THE INVENTION Methods Generation of α-MHC-ILK Transgenic Mice

All protocols were in accordance with institutional guidelines for animal care. All procedures and analyses were performed in a fashion blinded for genotype, and statistical comparisons were made between ILK transgenic mice and sex-matched littermate non-transgenic mice. A 1.8 kb EcoRI fragment comprising the full length ILK cDNA was excised from a pBSK plasmid, and filled-in for blunt end ligation into a SalI site downstream of the murine a-myosin heavy chain promoter. Site directed mutagenesis (QuickChange Kit, Stratagene) was performed to generate constitutively active ILK (S343D), and kinase-inactive ILK (R211A) mutants using the wild type a-MHC/ILK plasmid as template. DNA sequencing confirmed the point mutations. Pronuclear microinjection of the linearized a-MHC/ILK plasmids into 0.5 day fertilized embryos was performed at the Core Transgenic Facility of the Hospital for Sick Children Research Institute. Transgene expression in C57BL/6 founder and F1 progeny mice was confirmed by Southern analysis and RT-PCR as described, using primers specific for the exogenous ILK transgene. The forward primer: 5′GTCCACATTCTTCAGGATTCT3′, specific for exon 2 of -MHC promoter, and the ILK-specific reverse primer: ‘ACACAAGGGGAAATACC GT3’, were used for the reaction. These primers amplify a 1460 bp across the α-MHC-ILK fusion junction. F1 progeny derived from one of several independent founder lines were selected for detailed phenotypic analysis based on readily discernible increases in ILK expression (FIG. 4). All transgenic mouse procedures were performed in conformance with the policies for humane animal care governing the Core Transgenic Facility of the Hospital for Sick Children Research Institute and the Animal Research Act of Ontario.

Cardiac Hemodynamic Measurements

All surgical procedures were performed in accordance with institutional guidelines. Mice were anesthetized in the supine position using ketamine-HCl (100 mg/kg ip) and xylazine-HCl (10 mg/kg ip), and maintained at 37° C. The right common carotid artery was isolated after midline neck incision and cannulated using a Millar Micro-tip pressure transducer (1.4 F sensor, 2 F catheter; Millar Instruments, Houston, Tex.). Heart rate (beats per minute), systolic and diastolic LV pressures (mm Hg) were recorded, and peak positive and negative first derivatives (maximum/minimum+/−dp/dt; mmHg/second) were obtained from LV pressure curves using Origin 6.0 (Microcal Software, Inc., Northampton, Mass.).

Two-Dimensional Echocardiography

Serial two-dimensional echocardiography (2-D echo) was performed in male ILK transgenic and non-transgenic littermate mice at 10-12 weeks, at 5, and 15 months of age. An ultrasound biomicroscope (UBM) (VS40, VisualSonics Inc., Toronto) with transducer frequency of 30 MHz was used to make M-mode recordings of the LV. Mice were lightly anesthetized with isoflurane in oxygen (1.5%) by face mask, and warmed using a heated pad and heat lamp. Heart rate and rectal temperature were monitored (THM100, Indus Instruments, Houston, Tex.) and heating adjusted to maintain rectal temperature between 36 and 38° C. Once anesthetized, the mouse precordial region was shaved and further cleaned with a chemical hair-remover to minimize ultrasound attenuation. With the guidance of the two-dimensional imaging of the UBM, M-mode recording of left ventricular wall motion was obtained from the longitudinal and short axis views of the LV at the level with the largest ventricular chamber dimension. Anterior and posterior LV free wall thickness, and ventricular chamber dimensions were measured at end-systole and end-diastole; the contractility indices, velocity of circumferential fiber shortening (Vcf) and % fractional shortening, and LV ventricular mass, were calculated as described. Determination of significant, genotype-specific differences in 2-D echo and cardiac catheterization data relied on a paired t-test or ANOVA in the case of serial measurements.

ILK Immune Complex Kinase Assay

Cells were lysed in NP40 buffer, supplemented with 1 mM sodium orthovanadate and 5 mM sodium fluoride as phosphatase inhibitors. Equal amounts of protein from these cell lysates were immunoprecipitated with -ILK polyclonal antibody as previously described 10, and immune complexes were incubated at 30 C for 30 min with myosin light chain II regulatory subunit (MLC20) (2.5 g/reaction) and [32P] ATP (5 Ci/reaction). The reactions were stopped by addition of 4× concentrated SDS-PAGE sample buffer. Phosphorylated proteins were separated on 15% SDS-PAGE gels. [32P]MLC20 was visualized by autoradiography with X-Omat film.

Rho Family GTPase Activation Assays

Measurement of activated RhoA was performed using a pull-down assay based on specific binding of Rho-GTP to Rho-binding domain (RBD) of the Rho effector molecule, rhoketin43. Cdc42 and Rac1 activation were measured using a pull-down assay, based on the ability of the p21-binding domain of p21 associated kinase (PAK) to affinity precipitate Rac1-GTP and Cdc42-GTP, as described. RBD expressed as a GST fusion protein bound to the active Rho-GTP form of Rho was isolated using glutathione affinity beads according the manufacturer\'s protocol (Cytoskeleton). The amount of activated Rho was determined by Western blot using a Rho-specific antibody (Santa Cruz) and normalized as a ratio to the total amount of anti-Rho antibody detected in a 1/20 fraction of clarified lysate. Activated Rac and Cdc42 were measured by the same protocol using the p21-binding domain of PAK to affinity precipitate Rac-GTP, which was quantitated using an anti-Rac antibody (Cytoskeleton, Inc.) or anti-Cdc42 (Santa Cruz). Blots were developed with SuperSignal West Femto substrate (Pierce) for the GST-PAK/RBD pull-down assays.

Histopathology

The hearts were weighed, paraffin-embedded, sectioned at 1 mm intervals, and stained with hematoxylin and eosin and Sirius Red using standard methods. Micrographs were taken using both low magnification (×2.5) and higher magnification (×40) using fluorescent microscopy and genotype-specific cardiomyocyte areas determined based on digital measurements of >500 cells per animal and 5 animals per genotype using Image J software (http://rsb.info.nih.gov/ij/). Scanning electron microscopy was performed on ventricular samples placed in 1% Universal fixative for several hours at 4° C. and post-fixed in OsO4, using the JSM 6700FE SEM microscope.

Infarct Induction

LV infarction was created in 6 month ILK TgS343D and littermate control mice by LAD ligation as described. Planimetric scar dimensions measured in six levels of hematoxylin and eosin-stained cross-sections of the LV at 7 days post-infarction.

Antibodies, and Immunoblot Analyses for Total and Phospho-Protein Levels

Total and phospho-specific protein expression was measured in lysates derived from human fetal cardiomyocytes in culture and from transgenic and control mouse ventricular tissue as described previously. Immunoblotting was performed with the following commercially available antibodies. Polyclonal rabbit antibodies against ILK, p38MAPK, p70S6K, p44/42 MAPK (ERK1/2), and ATF-2 were purchased from Cell Signaling Technologies. Phospho-specific antibodies of pp38MAPK (Thr180/Tyr182), pp70S6K (Thr421/Scr424), pPKB (Ser473), pGSK3β (Ser9), pp44/42 MAPK (Thr202/Tyr204), and pATF-2 (Thr69/71) were purchased from Cell Signaling. Mouse monoclonal antibodies recognizing PKB, GSK3β, and RhoA were purchased from Transduction Labs. Rabbit polyclonal hemaglutinin (HA), and monoclonal Cdc42 antibodies were obtained from Santa Cruz Biotechnology. Rabbit polyclonal Rac1 antibody was purchased from Cytoskeleton, Inc. We generated a β-parvin (ParvB) rabbit polyclonal serum and affinity-purified these antibodies over an immobilized GST-ParvB column. Mouse monoclonal GAPDH was purchased from Ambion, Inc. Proteins were visualized with an enhanced chemiluminescence (ECL) detection reagent (Amersham Pharmacia Biotech) and quantified by densitometry.

Adenovirus-Mediated Expression of ILK Variants in Primary Cardiomyocytes

Human fetal cardiomyocytes (HFCM) (gestational age 15-20 weeks) were obtained under an Institutional Review Board-approved protocol and cultured to approximately 50% confluency (day 3-4 post-plating) in preparation for adenovirally-mediated infection of ILK constructs, as previously described. Replication-deficient serotype 5 adenovirus encoding either the human wild-type ILK gene (Ad-ILKWT), kinase inactive (Ad-ILKR211A) or empty virus constructs previously shown to modulate ILK expression and activity in L6 myoblasts, were used for infection of HFCM. HFCM were infected at 37° C. at multiplicity of infection of 2. KP392 is a small molecule inhibitor of ILK which was used to probe the effects of ILK on the profile of Rho family GTPase activation.

Human Ventricular Samples

Human right ventricular samples were derived from two patients with congenital outflow tract obstruction undergoing surgical repair, and left ventricular myocardial samples from five patients with hypertrophic obstructive cardiomyopathy (HOCM) presenting with discrete subaortic muscular obstruction. Control human ventricular tissue was acquired from structurally normal hearts (n=5) which were not used for cardiac transplantation. All human tissue samples were snap-frozen in liquid nitrogen at the time of procurement. All human tissue was acquired following protocol review and approval by the appropriate Research Ethics Board, and the protocols were conducted in accordance with the Tri Council Policy Statement for Research Involving Humans.

ILK protein levels are elevated in cases of human cardiac hypertrophy. In order to test for the participation of ILK in hypertrophic heart disease in vivo, we examined ILK expression in human ventricular tissue samples from patients with and without clinically evident hypertrophy. Ventricular samples were acquired from two patients in the first year of life with ventricular hypertrophy secondary to congenital outflow tract obstruction; control ventricular tissue was derived from structurally normal 19 week human fetal hearts (n=2), and examined in parallel for levels of ILK expression. Ventricular tissue from these hearts exhibited a 5-6 fold increases in ILK protein levels over control levels (FIG. 1a).

We then investigated whether ILK protein expression was elevated in hypertrophy caused by left ventricular outflow tract obstruction (LVOT), since clinical hypertrophic heart disease more commonly affects the LV. Surgical specimens were acquired from the LVOT in adult patients (n=4) with hypertrophic obstructive cardiomyopathy (HOCM) exhibiting resting LVOT gradients>50 mmHg Control ventricular tissue was obtained from structurally normal hearts (n=5) at the time of multi-organ transplantation procurement. Myocardial samples from HOCM patients exhibited a ˜2 fold increase in ILK protein levels relative to control hearts (FIG. 1b). Thus, the cases of clinical hypertrophy all demonstrate elevation of ILK protein, suggesting this is a critical molecular response to increased cardiac loading and the development of hypertrophy.

ILK has been shown to activate Rho family GTPases, which have also been causally implicated in experimental hypertrophy. We therefore assayed the ventricular tissues directly for activation of RhoA, Cdc42 and Rac1 GTPases, using specific affinity binding assays that distinguish the GDP-bound (inactive) and GTP-bound (active) states of each. Strikingly, there was a ˜2-fold and 10-fold increase in Rac1 GTP loading in the hypertrophic ventricular samples from patients with acquired and congenital and outflow tract obstruction, respectively (FIG. 2ab). Cdc42 activation of ˜2-fold was also evident in both acquired and congenital hypertrophic lesions. Conversely, the levels of GTP-bound RhoA were unchanged between the control and hypertrophied ventricles. These results indicate selective activation of Rac1, and to a lesser extent, Cdc42, coincident with increased ILK protein levels, in human ventricular hypertrophy induced in both left and right ventricles by obstructive hemodynamic loading.

As the pro-hypertrophic kinases, Akt/PKB, GSK3β, and ERK1/2, are known targets of ILK, we ascertained whether these proteins were also elevated in the cases of human hypertrophy. Western blotting for total protein indicated equivalent levels of GSK3β and ERK1/2 in the hypertrophied hearts, and an increase in PKB (FIG. 3). We tested the hypertrophic hearts for concordant increases in the phosphorylation state of known kinase targets of ILK that have also been implicated in the promotion of cardiac hypertrophy. Surprisingly, the phosphorylation state of the classical hypertrophic signaling targets, Akt/PKB and GSK3β, was not increased above control levels in any of the samples from the human hypertrophic ventricles (FIG. 3ab), despite the increased ILK protein levels in these samples. This result suggests that a putative ILK-Rac1 hypertrophic pathway is separable from ILK signaling through PKB/Akt and GSK3β. ERK1/2 p38MAPK8, and p70S6K, are kinases downstream of ILK which have also been implicated in promotion of experimental cardiac hypertrophy in vivo. In contrast to Akt/PKB and GSK3β, ERK1/2 and p70S6K were strongly phosphorylated in ventricular lysates in the setting of LVOT obstruction (FIG. 3c), indicative of an activation profile of ILK kinase targets induced during human hypertrophy which appears to exhibit a degree of selectivity.

Cardiac-specific expression of activated ILK in transgenic mice induces hypertrophy. The selective elevation of ILK levels in clinical cases of cardiac hypertrophy prompted us to ask whether increased ILK expression is causative of cardiac hypertrophy. To directly test hypertrophic responses to ILK in vivo, we derived independent lines of transgenic mice harboring different ILK transgenes, expressed under control of the cardiac specific -MHC promoter. As discussed above, ILK is a multifunctional protein24, thus our strategy was to generate lines expressing ILK variants that would allow us to differentiate kinase-dependent and -independent ILK functions in the heart. Toward this end, lines expressing: 1) constitutively activated, ILKS343D, 2) wildtype, ILK TgWT, and 3) kinase-inactive ILK, ILKR211A, were derived. Southern blot analyses of genomic DNA identified mice carrying the ILKS343D transgene (FIG. 4a), and RT-PCR analysis indicated cardiac-specific expression of ILKS343D (FIG. 4b). Densitometric analysis of western blots indicated that transgenic ILKS343D protein levels were approximately 3-fold higher in transgenic animals, relative to non-transgenic littermates (FIG. 4c), and comparable to the increased levels seen in the clinical hypertrophic samples. Importantly, immune complex kinase assays confirmed that ILK activity in transgenic heart tissue measured in the ILKS343D genotype was elevated relative to non-transgenic controls, in parallel with ILK protein levels (FIG. 4d). Similar analyses confirmed generation of ILKWT and ILKR211A transgenic lines (not shown).

Hearts from ILKS343D Tg mice exhibited concentric hypertrophy, evidenced by gross enlargement and increased heart weight:body weight ratio (FIG. 5a; Supplementary Table 1), and echocardiographic measurements showing significant LV wall thickening, compared to NTg mice (Supplementary Table 2). We observed an approximately 29% increase (p<0.001) in cardiomyocyte area in ILKS343D Tg animals, as assessed in laminin-stained sections of LV (FIG. 5b), which is sufficient to account for the observed cardiac enlargement in ILKS343D Tg mice, suggesting ILK activity regulates cardiomyocyte size, rather than proliferation. There was no conspicuous increase in collagen deposition in the ILKS343D Tg hearts, as assessed histologically using Masson\'s trichrome (FIG. 5b) or picrosirius red staining. The ILKS343D Tg mice appeared healthy, with no evidence of peripheral edema or cardiac failure, as there were no ILK-induced differences in absolute or body weight-indexed lung and liver weights (Supplementary Table 1). These data indicate that expression of activated ILK in the heart induces hypertrophy without the development of cardiac failure.

SUPPLEMENTAL TABLE 1 Heart, lung, liver weights of ILKS343D transgenic mice Transgenic Non-Transgenic % Increase p-value  7 weeks No. of mice n = 7 n = 7 Body weight (g)  21 ± 4.5  22 ± 2.7 −4.5 NS Heart weight (mg) 144 ± 7.8  126 ± 7.9  14 <0.05 Lung weight (mg) 173 ± 22  183 ± 16  −5.5 NS Liver weight (mg) 1267 ± 319  1275 ± 160  −0.6 NS Heart/Body weight (mg/g) 6.9 ± 1.3 5.7 ± 0.7 21 <0.05 Lung/Body weight (mg/g) 8.2 ± 1.6 8.3 ± 0.9 0.0 NS Liver/Body weight (mg/g)  60 ± 5.6 58 ± 23 3.0 NS 15 months No. of mice n = 7 n = 6 Body weight (g)  45 ± 3.5  41 ± 4.3 9.8 NS Heart weight (mg) 233 ± 22  167 ± 19  40 <0.001 Lung weight (mg) 203 ± 25  197 ± 34  3.0 NS Liver weight (mg) 1602 ± 410  1510 ± 324  6.0 NS Heart/Body weight (mg/g) 5.2 ± 0.5 4.1 ± 0.5 27 <0.05 Lung/Body weight (mg/g) 4.5 ± 0.8  4.8 ± 0.97 −4.0 NS Liver/Body weight (mg/g)  36 ± 6.8  37 ± 6.4 −2.7 NS

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal patent application.

Patent Applications in related categories:

20130149731 - Apparatus for culturing cell and analyzing cell reaction, and method of analyzing cell reaction using the same - Provided is an apparatus for culturing a cell and analyzing a cell reaction. The apparatus may include a plurality of cell culturing rooms, cell injection ports connected to the cell culturing rooms through cell injection channels, respectively, and used for injecting different cells from each other into the cell culturing ...

20130149733 - Establishment of rhesus monkey model of autoimmunity type 1 diabetes - Use of low dose streptozocin in the preparation of an animal model for screening drugs for treatment of antoimmune type 1 diabetes is disclosed, in which streptozocin is administrated intravenously at a dose of 15-30 mg/kg per time for 5 days and administrated again on the 7th day and 14th ...

20130149732 - Method of labeling sulfenic acid-containing proteins and peptides - A method of labeling a sulfenic acid (—SOH) group of a cysteine residue in a protein; or peptide, comprises contacting said protein or peptide with a beta-ketoester to covalently couple said beta-ketoester to said cysteine residue and form a beta-ketoester-labeled cysteine residue in said protein or peptide. ...

20130149736 - Methods for sorting particles - A multi-channel apparatus for classifying particles according to one or more particle characteristics. The apparatus comprises a plurality of flow cytometry units, each of which is operable to classify particles in a mixture of particles by interrogating a stream of fluid containing the particles with a beam of electromagnetic radiation. ...

20130149735 - Microfluidic assay in idealized microvascular network for characterization of leukocyte adhesion cascade - Methods of assaying the leukocyte adhesion cascade (LAC) and monitoring leukocyte rolling, adhesion, and/or migration can be implemented with an apparatus that includes an idealized microvascular network (IMN) of one or more interconnected idealized flow channels in fluid communication through a porous wall with a tissue space (e.g., idealized tissue ...

20130149734 - Multi-photon tissue imaging - A multimodal method for imaging tissue comprising: aligning an excitation light source with at least a portion of the tissue; selecting at least two modalities of image acquisition; imaging the tissue portion with each of the modalities of image acquisition; and constructing a dual mode image using images from each ...


###
monitor keywords

Other recent patent applications listed under the agent :



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal or other areas of interest.
###


Previous Patent Application:
Method and apparatus for determining red blood cell indices of a blood sample utilizing the intrinsic pigmentation of hemoglobin contained within the red blood cells
Next Patent Application:
Orphan nuclear receptor
Industry Class:
Chemistry: molecular biology and microbiology

###

FreshPatents.com Support - Terms & Conditions
Thank you for viewing the Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal patent info.
- - - AAPL - Apple, BA - Boeing, GOOG - Google, IBM, JBL - Jabil, KO - Coca Cola, MOT - Motorla

Results in 1.20822 seconds


Other interesting Freshpatents.com categories:
Medical: Surgery Surgery(2) Surgery(3) Drug Drug(2) Prosthesis Dentistry   g2