FreshPatents.com Logo FreshPatents.com icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents

3

views for this patent on FreshPatents.com
updated 05/17/13


Inventor Store

    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • COMPANY PATENTS
  • Patents sorted by company.

Novel recombinant and mutant adenoviruses   

pdficondownload pdfimage preview


Abstract: The present invention provides novel viral vectors. In one embodiment, the present invention provides mutant and recombinant bovine adenoviruses having a deletion and/or insertion of DNA in the early gene region 4 (E4). In another embodiment, the present invention provides mutant and recombinant bovine adenovirus 1 viruses having a deletion and/or insertion of DNA in the early gene region 3 (E3). The present invention also contemplates the use of the viral vectors for vaccination, gene therapy or other applications as suitable. ...


USPTO Applicaton #: #20090274724 - Class: 4241991 (USPTO) - 11/05/09 - Class 424 
Related Terms: Adenovirus   Bovine   Gene Therapy   Vaccination   
view organizer monitor keywords


The Patent Description & Claims data below is from USPTO Patent Application 20090274724, Novel recombinant and mutant adenoviruses.

pdficondownload pdf

The benefit of the Apr. 9, 1999 filing date of Provisional Application No. 60/128,766 is claimed.

FIELD OF THE INVENTION

The present invention relates to viral vectors for vaccination of animals. In particular, the present invention pertains to viral vectors having insertion sites for the introduction of foreign DNA.

BACKGROUND OF THE INVENTION

The adenoviruses cause enteric or respiratory infection in humans as well as in domestic and laboratory animals.

Inserting genes into adenoviruses has been accomplished. In the human adenovirus (HuAd) genome there are two important regions: E1 and E3 in which foreign genes can be inserted to generate recombinant adenoviruses.

This application of genetic engineering has resulted in several attempts to prepare adenovirus expression systems for obtaining vaccines. Examples of such research include the disclosure of U.S. Pat. No. 4,510,245 of an adenovirus major late promoter for expression in a yeast host; U.S. Pat. No. 4,920,209 of a live recombinant adenovirus type 7 with a gene coding for hepatitis-B surface antigen; European patent No. 389,286 of a non-defective human adenovirus 5 recombinant expression system in human cells; and published International application No. WO 91/11525 of live non-pathogenic immunogenic viable canine adenovirus in a cell.

However, because they are more suitable for entering a host cell, an indigenous adenovirus vector would be better suited for use as a live recombinant virus vaccine in different animal species compared to an adenovirus of human origin. For example, bovine adenovirus-based expression vectors have been reported for bovine adenovirus 3 (BAV-3) (see U.S. Pat. No. 5,820,868).

Bovine adenoviruses (BAVs) comprise at least nine serotypes divided into two subgroups. These subgroups have been characterized based on enzyme-linked immunoassays (ELISA), serologic studies with immunofluorescence assays, virus-neutralization tests, immunoelectron microscopy and by their host specificity and clinical syndromes. Subgroup 1 viruses include BAV 1, 2, 3 and 9 and grow relatively well in established bovine cells compared to subgroup 2 viruses which include BAV 4, 5, 6, 7 and 8.

BAV-3 was first isolated in 1965 and is the best characterized of the BAV genotypes and contains a genome of approximately 35 kilobases. The locations of hexon and proteinase genes in the BAV-3 genome have been identified and sequenced.

Genes of the bovine adenovirus 1 (BAV-1) genome have also been identified and sequenced. However, the location and sequences of other genes such as certain early gene regions in the BAV genome have not been reported.

The continued identification of suitable viruses and gene insertion sites are valuable for the development of new vaccines. The selection of (i) a suitable virus and (ii) the particular portion of the genome to use as an insertion site for creating a vector for foreign gene expression, however, pose a significant challenge. In particular, the insertion site must be non-essential for the viable replication of the virus, as well as its operation in tissue culture and in vivo. Moreover, the insertion site must be capable of accepting new genetic material, while ensuring that the virus continues to replicate.

What is needed is the identification of novel viruses and gene insertion sites for the creation of new viral vectors.

SUMMARY

OF THE INVENTION

In one embodiment, the present invention provides recombinant viruses. while not limited to a particular use, these recombinant viruses can be used to generate vaccines.

While not limited to a particular virus, in one embodiment the present invention provides a recombinant virus comprising a foreign DNA sequence inserted into the E4 gene region of a bovine adenovirus. In a preferred embodiment, the insertion is to a non-essential site. In another embodiment, the present invention provides a recombinant virus comprising a foreign DNA sequence inserted into the E3 gene region of a bovine adenovirus 1. In a preferred embodiment, the insertion is to a non-essential site.

While not limited to its ability to replicate, in a preferred embodiment, the recombinant virus is replication competent. Likewise, while not limited to the foreign DNA to be inserted, in a preferred embodiment, the foreign DNA encodes a polypeptide and is from a virus or bacteria selected from the group consisting of bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus. In another preferred embodiment, the foreign DNA encodes a cytokine. In a further preferred embodiment, the polypeptide comprises more than ten amino acids and is antigenic. Finally, in a particularly preferred embodiment, the foreign DNA sequence is under the control of a promoter located upstream of the foreign DNA sequence.

The present invention also contemplates mutant viruses. While not limited to a particular mutant virus, in one embodiment, the mutant virus comprises a deletion of at least a portion of the E4 gene region of a bovine adenovirus. In a preferred embodiment, the deletion is of a non-essential site. In another embodiment, the virus comprises a deletion of at least a portion of the E3 gene region of a bovine adenovirus 1. In a preferred embodiment, the mutant virus is replication competent. In a further preferred embodiment, at least one open reading frame of the relevant gene region of the bovine adenovirus is completely deleted.

In yet another embodiment, the present invention provides a method for preparing a recombinant virus comprising inserting at least one foreign gene or gene fragment that encodes at least one antigen into the genome of a virus wherein said gene or gene fragment has been inserted into the early gene region 4 of a bovine adenovirus or inserted into the early gene region 3 of bovine adenovirus 1. In a preferred embodiment, the method includes the insertion of at least a part of the genome of a virus into a bacterial plasmid, transforming said bacteria with said plasmid, and incubating said bacteria at approximately 25° C.

In another embodiment, the present invention provides vaccines. While not limited to a particular vaccine, in one embodiment, the vaccines comprise the recombinant viruses described above.

The present invention also contemplates methods of vaccination, including, but not limited to, the introduction of the above-described vaccines to an animal.

Definitions

The term, “animal” refers to organisms in the animal kingdom. Thus, this term includes humans, as well as other organisms. Preferably, the term refers to vertebrates. More preferably, the term refers to bovine animals.

A “vector” is a replicon, such as a plasmid, phage, cosmid or virus, to which another DNA sequence may be attached so as to bring about the expression of the attached DNA sequence.

For purposes of this invention, a “host cell” is a cell used to propagate a vector and its insert. Infecting the cell can be accomplished by methods well known to those skilled in the art, for example, as set forth in Transfection of BAV-1 DNA below.

A DNA “coding sequence” is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, viral DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence can be located 3′ to the coding sequence.

A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase or an auxiliary protein and initiating transcription of a downstream (3′ direction) coding sequence. For purposes of defining the present invention, the promoter sequence is in close proximity to the 5′ terminus by the translation start codon (ATG) of a coding sequence and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to facilitate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eucaryotic promoters will often, but not always, contain “TATA” boxes and “CAAT” boxes, conserved sequences found in the promoter region of many eucaryotic organisms.

A coding sequence is “operably linked to” or “under the control of” promoter or control sequences in a cell when RNA polymerase will interact with the promoter sequence directly or indirectly and result in transcription of the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.

A “double-stranded DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes, for example, double-stranded DNA found in linear DNA molecules (e.g., restriction fragments of DNA from viruses, plasmids, and chromosomes), as well as circular and concatamerized forms of DNA.

A “foreign DNA sequence” is a segment of DNA that has been or will be attached to another DNA molecule using recombinant techniques wherein that particular DNA segment is not found in association with the other DNA molecule in nature. The source of such foreign DNA may or may not be from a separate organism than that into which it is placed. The foreign DNA may also be a synthetic sequence having codons different from the native gene. Examples of recombinant techniques include, but are not limited to, the use of restriction enzymes and ligases to splice DNA.

An “insertion site” is a restriction site in a DNA molecule into which foreign DNA can be inserted.

For purposes of this invention, a “homology vector” is a plasmid constructed to insert foreign DNA sequence in a specific site on the genome of an adenovirus.

The term “open reading frame” or “ORF” is defined as a genetic coding region for a particular gene that, when expressed, can produce a complete and specific polypeptide chain protein.

A cell has been “transformed” with exogenous DNA when such exogenous DNA has been introduced inside the cell membrane. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid. A stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. For mammalian cells, this stability is demonstrated by the ability of the cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.

A “replication competent virus” is a virus whose genetic material contains all of the DNA or RNA sequences necessary for viral replication as are found in a wild-type of the organism. Thus, a replication competent virus does not require a second virus or a cell line to supply something defective in or missing from the virus in order to replicate. A “non-essential site in the adenovirus genome” means a region in the adenovirus genome, the polypeptide product or regulatory sequence of which is not necessary for viral infection or replication.

Two polypeptide sequences are “substantially homologous” when at least about 80% (preferably at least about 90%, and most preferably at least about 95%) of the amino acids match over a defined length of the molecule.

Two DNA sequences are “substantially homologous” when they are identical to or not differing in more that 40% of the nucleotides, more preferably about 20% of the nucleotides, and most preferably about 10% of the nucleotides.

A virus that has had a foreign DNA sequence inserted into its genome is a “recombinant virus,” while a virus that has had a portion of its genome removed by intentional deletion (e.g., by genetic engineering) is a “mutant virus.”

The term “polypeptide” is used in its broadest sense, i.e., any polymer of amino acids (dipeptide or greater) linked through peptide bonds. Thus, the term “polypeptide” includes proteins, oligopeptides, protein fragments, analogs, muteins, fusion proteins, etc.

“Antigenic” refers to the ability of a molecule containing one or more epitopes to stimulate an animal or human immune system to make a humoral and/or cellular antigens specific response. An “antigen” is an antigenic polypeptide.

An “immunological response” to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest. Usually, such a response consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.

The terms “immunogenic polypeptide” and “immunogenic amino acid sequence” refer to a polypeptide or amino acid sequence, respectively, which elicit antibodies that neutralize viral infectivity, and/or mediate antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host. An “immunogenic polypeptide” as used herein, includes the full length (or near full length) sequence of the desired protein or an immunogenic fragment thereof.

By “immunogenic fragment” is meant a fragment of a polypeptide which includes one or more epitopes and thus elicits antibodies that neutralize viral infectivity, and/or mediates antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host. Such fragments will usually be at least about 5 amino acids in length, and preferably at least about 10 to 15 amino acids in length. There is no critical upper limit to the length of the fragment, which could comprise nearly the fill length of the protein sequence, or even a fusion protein comprising fragments of two or more of the antigens.

By “infectious” is meant having the capacity to deliver the viral genome into cells.

A “substantially pure” protein will be free of other proteins, preferably at least 10% homogeneous, more preferably 60% homogeneous, and most preferably 95% homogeneous.

BRIEF DESCRIPTION OF THE DRAWING FIGURE

FIG. 1 is a diagram of BAV-1 genomic DNA showing the relative size of various regions in kilobase pairs. Fragments are lettered in order of decreasing size.

DETAILED DESCRIPTION

OF THE INVENTION

Throughout this disclosure, various publications, patents and patent applications are referenced. The disclosures of these publications, patents and patent applications are herein incorporated by reference.

The methods and compositions of the present invention involve modifying DNA sequences from various prokaryotic and eucaryotic sources and by gene insertions, gene deletions, single or multiple base changes, and subsequent insertions of these modified sequences into the genome of an adenovirus. One example includes inserting parts of an adenovirus DNA into plasmids in bacteria, reconstructing the virus DNA while in this state so that the DNA contains deletions of certain sequences, and/or furthermore adding foreign DNA sequences either in place of the deletions or at sites removed by the deletions.

Generally, the foreign gene construct is cloned into an adenovirus nucleotide sequence which represents only a part of the entire adenovirus genome, which may have one or more appropriate deletions. This chimeric DNA sequence is usually present in a plasmid which allows successful cloning to produce many copies of the sequence. The cloned foreign gene construct can then be included in the complete viral genome, for example, by in vivo recombination following a DNA-mediated cotransfection technique. Multiple copies of a coding sequence or more than one coding sequences can be inserted into the viral genome so that the recombinant virus can express more than one foreign protein or multiple copies of the same protein. The foreign gene can have additions, deletions or substitutions to enhance expression and/or immunological effects of the expressed protein.

In order for successful expression of the gene to occur, it can be inserted into an expression vector together with a suitable promoter including enhancer elements and polyadenylation sequences. A number of eucaryotic promoter and polyadenylation sequences which provide successful expression of foreign genes in mammalian cells and how to construct expression cassettes, are known in the art, for example in U.S. Pat. No. 5,151,267. The promoter is selected to give optimal expression of immunogenic protein which in turn satisfactorily leads to humoral, cell mediated and mucosal immune responses according to known criteria.

The polypeptide encoded by the foreign DNA sequence is produced by expression in vivo in a recombinant virus-infected cell. The polypeptide may be immunogenic. More than one foreign gene can be inserted into the viral-genome to obtain successful production of more than one effective protein.

Therefore, one utility of the use of a mutant adenovirus or the addition of a foreign DNA sequence into the genome of an adenovirus is to vaccinate an animal. For example, a mutant virus could be introduced into an animal to elicit an immune response to the mutant virus.

Alternatively, a recombinant adenovirus having a foreign DNA sequence inserted into its genome that encodes a polypeptide may also serve to elicit an immune response in an animal to the foreign DNA sequence, the polypeptide encoded by the foreign DNA sequence and/or the adenovirus itself. Such a virus may also be used to introduce foreign DNA and its products into the host animal to alleviate a defective genomic condition in the host animal or to enhance the genomic condition of the host animal.

While the present invention is not limited to the use of particular viral vectors, in preferred embodiments the present invention utilizes bovine adenovirus expression vector systems. In particularly preferred embodiments, the present invention comprises a bovine adenovirus in which part or all of the E4 gene region is deleted and/or into which foreign DNA is introduced. Alternatively, the system comprises a bovine adenovirus 1 (BAV-1) in which part or all of the E3 and/or E4 gene regions are deleted and/or into which foreign DNA is introduced.

The present invention is not limited by the foreign genes or coding sequences (viral, prokaryotic, and eukaryotic) that are inserted into a bovine adenovirus nucleotide sequence in accordance with the present invention. Typically the foreign DNA sequence of interest will be derived from pathogens that in bovine cause diseases that have an economic impact on the cattle or dairy industry. The genes may be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology, the adenovirus derived vaccines will be superior. Also, the gene of interest may be derived from pathogens for which there is currently no vaccine but where there is a requirement for control of the disease. Typically, the gene of interest encodes immunogenic polypeptides of the pathogen and may represent surface proteins, secreted proteins and structural proteins.

The present invention is not limited by the particular organisms from which a foreign DNA sequence is obtained for gene insertion into a bovine adenovirus genome. In preferred embodiments, the foreign DNA is from bovine rotavirus, bovine coronavirus, bovine herpes virus type 1, bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophitus somnus. In another preferred embodiment, the foreign DNA encodes a cytokine.

The present invention is also not limited to the use of a particular DNA sequence from such an organism. Often selection of the foreign DNA sequence to be inserted into an adenovirus genome is based upon the protein it encodes. Preferably, the foreign DNA sequence encodes an immunogenic polypeptide.

The preferred immunogenic polypeptide to be expressed by the virus systems of the present invention contain full-length (or near full-length) sequences encoding antigens. Alternatively, shorter sequences that are immunogenic (i.e., encode one or more epitopes) can be used. The shorter sequence can encode a neutralizing epitope, which is defined as an epitope capable of eliciting antibodies that neutralize virus infectivity in an in vitro assay. Preferably the peptide should encode a protective epitope that is capable of raising in the host an protective immune response; i.e., an antibody-mediated and/or a cell-mediated immune response that protects an immunized host from infection. In some cases the gene for a particular antigen can contain a large number of introns or can be from an RNA virus. In these cases a complementary DNA copy (cDNA) can be used.

It is also possible to use fragments of nucleotide sequences of genes rather than the complete sequence as found in the wild-type organism. where available, synthetic genes or fragments thereof can also be used. However, the present invention can be used with a wide variety of genes and/or fragment and is not limited to those set out herein.

Thus, the antigens encoded by the foreign DNA sequences used in the present invention can be either native or recombinant immunogenic polypeptides or fragments. They can be partial sequences, full-length sequences, or even fusions (e.g., having appropriate leader sequences for the recombinant host and/or with an additional antigen sequence for another pathogen).

The present invention is also not limited by the ability of the resulting recombinant and mutant viruses to replicate. In a preferred embodiment, the mutant and recombinant viruses of the present invention are replication competent. In this manner, a complimenting cell line is not necessary to produce adequate supplies of virus.

As stated above, the present invention contemplates the administration of the recombinant and mutant viruses of the present invention to vaccinate an animal. The present invention is not limited by the nature of administration to an animal. For example, the antigens used in the present invention, particularly when comprised of short oligopeptides, can be conjugated to a vaccine carrier. Vaccine carriers are well known in the art: for example, bovine serum albumin (BSA), human serum albumin (HSA) and keyhole limpet hemocyanin (KLH). A preferred carrier protein, rotavirus VP6, is disclosed in EPO Pub. No. 0259149.

The vaccines of the present invention carrying foreign genes or fragments can also be orally administered in a suitable oral carrier, such as in an enteric-coated dosage form. Oral formulations include such normally-employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin cellulose, magnesium carbonate, etc. Oral vaccine compositions may be taken in the form of solutions (e.g., water), suspensions, tablets, pills, capsules, sustained release formulations, or powders, containing from about 10% to about 95% of the active ingredient, preferably about 25% to about 70%. An oral vaccine may be preferable to raise mucosal immunity in combination with systemic immunity, which plays an important role in protection against pathogens infecting the gastrointestinal tract.

In addition, the vaccine can be formulated into a suppository For suppositories, the vaccine composition will include traditional binders and carriers, such as polyalkaline glycols or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about 1% to about 2%.

Protocols for administering the vaccine composition(s) of the present invention to animals are within the skill of the art in view of the present disclosure. Those skilled in the art will select a concentration of the vaccine composition in a dose effective to elicit an antibody and/or T-cell mediated immune response to the antigenic fragment.

The timing of administration may also be important. For example, a primary inoculation preferably may be followed by subsequent booster inoculations if needed. It may also be preferred, although optional, to administer a second, booster immunization to the animal several weeks to several months after the initial immunization. To insure sustained high levels of protection against disease, it may be helpful to readminister a booster immunization to the animals at regular intervals, for example once every several years. Alternatively, an initial dose may be administered orally followed by later inoculations, or vice versa. Preferred vaccination protocols can be established through routine vaccination protocol experiments.

The dosage for all routes of administration of an in vivo recombinant virus vaccine depends on various factors, including the size of the patient, the nature of the infection against which protection is needed, the type of carrier and other factors, which can readily be determined by those of skill in the art. By way of non-limiting example, a dosage of between 103 plaque forming units (pfu) and 108 pfu can be used.

The present invention also includes a method for providing gene therapy to a mammal in need thereof to control a gene deficiency. In one embodiment, the methods comprises administering to said mammal a live recombinant bovine adenovirus containing a foreign nucleotide sequence encoding a non-defective form of a gene. The foreign nucleotide sequence is either incorporated into the mammalian genome or is maintained independently to provide expression of the required gene in the target organ or tissue. These kinds of techniques have recently been used by those of skill in the art to replace a defective gene or portion thereof For example, U.S. Pat. No. 5,399,346 to Anderson et al. describes techniques for gene therapy. Moreover, examples of foreign genes nucleotide sequences or portions thereof that can be incorporated for use in a conventional gene therapy include, but are not limited to, cystic fibrosis transmembrane conductance regulator gene, human minidystrophin gene, alpha 1-antitrypsin gene and others.

Methods for constructing, selecting and purifying recombinant adenovirus are detailed below in the materials, methods and examples below. The following serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Preparation of Bovine Adenovirus (BAV-1) Stock

Bovine adenovirus stocks were prepared by infecting tissue culture cells, Madin-Darby bovine kidney cells (MDBK), at a multiplicity of infection of 0.01 PFU/cell in Dulbecco\'s Modified Eagle Medium (DMEM) containing 2 mM glutamine, 100 units/ml penicillin, 100 units/ml streptomycin (these components are obtained from Sigma (St. Louis, Mo.) or an equivalent supplier, and hereafter are referred to as complete DME medium) plus 1% fetal bovine serum. After cytopathic effect was complete, the medium and cells were harvested. After one or two cycles of freezing (−70° C.) and thawing (37° C.), the infected cells were aliquot as 1 ml stock and stored frozen at −70″C.

Preparation of Bovine Adenovirus (BAV-1) DNA

All manipulations of bovine adenovirus were made using strain 10 (ATCC VR-313). For the preparation of BAV-1 viral DNA from the cytoplasm of infected cells, MDBK cells were infected at a multiplicity of infection (MOI) sufficient to cause extensive cytopathic effect before the cells overgrew. All incubations were carried out at 37° C. in a humidified incubator with 5% CO2 in air.

The best DNA yields were obtained by harvesting monolayers which were maximally infected, but showing incomplete cell lysis (typically 5-7 days). Infected cells were harvested by scraping the cells into the medium using a cell scraper (Costar brand). The cell suspension was centrifuged at 3000 rpm for 10 minutes at 5° C. in a GS-3 rotor (Sorvall Instruments, Newtown, Conn.). The resultant pellet was resuspended in cold PBS (20 ml/Roller Bottle) and subjected to another centrifugation for 10 minutes at 3000 rpm in the cold.

After decanting the PBS, the cellular pellet was resuspended in 5 ml/roller bottle of TE buffer (10 mM Tris pH 7.5 and 1 mM EDTA) and swell on ice for 15 minutes. NP40 Nonidet P40.™.; Sigma, St. Louis, Mo.) was added to the sample to a final concentration of 0.5% and keep on ice for another 15 minutes. The sample was centrifuged for 10 minutes at 3000 rpm in the cold to pellet the nuclei and remove cellular debris.

The supernatant fluid was carefully transferred to a 30 ml Corex centrifuge tube. SDS (sodium dodecyl sulfate; stock 20%) were added to the sample to final concentrations of 1%. 200 μl of proteinase-K at 10 mg/ml (Boelringer Mannheim, Indianapolis, Ind.) was added per roller bottle of sample, mixed, and incubated at 45° C. for 1-2 hours.

After this period, an equal volume of water-saturated phenol was added to the sample and mixed by vortex. The sample was spun in a clinical centrifuge for 5 minutes at 3000 rpm to separate the phases. NaAc was added to the aqueous phase to a final concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic acid precipitated at −70° C. for 30 minutes after the addition of 2.5 volumes of cold absolute ethanol. DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 4° C.

The supernatant was carefully removed and the DNA pellet washed once with 25 ml of 80% ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 2 ml/roller bottle of infected cells of TE buffer (20 mM Tris pH 7.5, 1 mM EDTA). 10 μl of RNaseA at 10 mg/ml (Sigma, St. Louis, Mo.) was added and incubate at 37° C. for one hour. 0.5 ml of 5N NaCl and 0.75 ml of 30% PEG was added and precipitated at 4° C. overnight.

DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 4° c. Resuspend pellet in 2 ml TE buffer (20 mM Tris pH7.5, 1 mM EDTA and 0.2% SDS) and extracted with an equal volume of water-saturated phenol. The sample was spun in a clinical centrifuge for 5 minutes at 3000 rpm to separate the phases. NaAc was added to the aqueous phase to a final concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic acid precipitated at −70° C. for 30 minutes after the addition of 2.5 volumes of cold absolute ethanol.

DNA in the sample was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4 rotor at 5° C. The supernatant was carefully removed and the DNA pellet washed once with 25 ml of 80% ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 200 μl/roller bottle of infected cells of TE buffer (10 mM Tris pH 7.5, 1 mM EDTA). All viral DNA was stored at approximately 4° C.

Molecular Biological Techniques

Techniques for the manipulation of bacteria and DNA, including such procedures as digestion with restriction endonucleases, gel electrophoresis, extraction of DNA from gels, ligation, phosphorylation with kinase, treatment with phosphatase, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al. (T. Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y. (1982)) and Sambrook et al. (J. Sambrook, et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)). The polymerase chain reaction (PCR) was used to introduce restriction sites convenient for the manipulation of various DNAs. The procedures used are described by Innis et al (M. A. Innis, et al., PCR Protocols: A Guide To Methods And Applications, pp. 84-91, Academic Press, Inc., San Diego, Calif. (1990)).

In general, amplified fragments were less than 2000 base pairs in size and critical regions of amplified fragments were confirmed by DNA sequencing. Except as noted, these techniques were used with minor variations.

DNA Sequencing

DNA sequencing was performed on the Applied Biosystems Automated Sequencer Model 373A (with XL upgrade) per instructions of the manufacturer. Subclones were made to facilitate sequencing. Internal primers were synthesized on an ABI 392 DNA synthesizer or obtained commercially (Genosys Biotechnologies, Inc., The Woodlands, Tex.) larger DNA sequences were built utilizing consecutive overlapping primers. Sequence across the junctions of large genomic subclones was determined directly using a full length genomic clone as template. Assembly, manipulation and comparison of sequences was performed with DNAstar programs. Comparisons with GenBank were performed using NCBI BLAST programs (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402.).

Construction of Recombinant BAV-1 Genomes in E. coli

Recombinant BAV-1 genomes are constructed by homologous recombination according to the method of C. Chartier et al (1996) J. of Virology 70:805-4810.

A small, easily manipulated plasmid was constructed containing approximately 1000 base pairs each of the Left and Right ends of the BAV-1 genome. Homologous recombination between this vector and BAV-1 genomic DNA results in a plasmid containing the entire BAV-1 genome (adenoviral backbone vector). This BAV-1 genomic plasmid may be used to generate recombinant genomes by linearization of the plasmid and recombination with homology DNAs engineered to contain foreign DNA flanked by DNA derived from the desired BAV-1 insertion site. Note that in order to linearize the adenoviral backbone vector, an infrequent cutting enzyme must be located within the region analogous to the flanking BAV-1 sequences.

We have mapped the restriction sites of such an enzyme. PvuI cuts the BAV-1 genome at two locations one in the BamH1 D fragment and one in the BamH1 C fragment (see FIG. 1). The adenoviral backbone vector contains a third PvuI site within the antibiotic resistance gene of the plasmid. The PvuI site within the BamH1 C fragment is suitable for gene insertion sites within both the E3 and E4 regions. Therefore a partial PvuI digestion of the adenoviral backbone vector will yield a sub population of molecules linearized at the PvuI site in the BamH1 C fragment. These molecules may recombine with the homology DNA to generate a viable plasmid. Molecules linearized at the other two sites will not be able to recombine to generate viable plasmids.

The high competence of bacteria cells E. coli BJ5183 recBC sbcBC (D. Hanahan (1983) J. Mol. Biol. 166:557-580) is desired to achieve efficient recombination. Typically, 10 nanograms of a restriction fragment containing foreign DNA flanked by the appropriate BAV insertion sequences (homology DNA) is mixed with 1 nanogram of linearized adenoviral backbone vector in a total volume of 10 μl. Fifty microliters of competent BJ5183 cells were added. After 15 min. on ice, 5 min. at 37° C. and 15 min. on ice, 200 μl of LB was added and the cells plated on agar containing LB+80 μg/ml carbenicillin, after one hour at 37° C.,

Low temperature (25-27° C.) for growing small scale cultures (for screening carbenicillin resistant colonies) and subsequent large scale cultures (for isolation of large quantities of plasmid DNA) is essential. CarbR colonies were first grown in 4-5 ml cultures at 25-27° C. for two days. Small scale DNAs were prepared using boiling method (J. Sambrook, et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)) and analyzed by DNA restriction analysis. To purify the DNA away from vector DNA concatemers the UNAs from correct clones were re-transform into DH10B (Life Technologies) cells. Analysis of bacterial colonies by DNA restriction analysis was repeated. Glycerol stocks were prepared from the correct clones and stored at −70° C. Large quantities of plasmid DNA were prepared using Qiagen Plasmid Kit (Qiagen Inc.) or scale-up of boiling method from 250 ml cultures which were inoculated with glycerol stock and grown at 37° C. for one day.

Transfection of BAV-1 DNA

Approximately 1.5×105 cells/ml (MBK) were plated in 6 cm plates 24 hr before transfection, by which time they reached 50-70% confluency. For transfection the Lipofectin method was used according to the manufacturer\'s instructions (Lipofectin, Life Technologies, Rockville, Md.). A transfection mix was prepared by adding several (4-15) μg of BAV-1 viral DNA or linearized genome plasmid DNA and 50 μl of Lipofectin Reagent to 200 μl of serum-free medium according to the manufacturer\'s instruction.

After incubation at room temperature for 15-30 min, the transfection mix was added to the cells. After 4-6 hr at 37° C., the media containing the transfection mix was removed, and 5 ml of growth medium was added. Cyopathic effect became apparent within 7-10 days. The transfected virus stock was harvested by scraping cells in the culture and stored at −70° C.

Plaque Purification of Recombinant Constructs

Monolayers of MDBK cells in 6 cm or 10 cm plates were infected with transfection stock, overlaid with nutrient agarose media and incubated for 5-10 days at 37° C. Once plaques have developed, single and well-isolated plaque was picked onto MDBK cells. After 5-10 days when 80-90% cytopathic effect was reached, the infected cells (P1 stock) were harvested and stored at −70° C. This procedure was repeated one more time with P1 stock.

Cloning of Bovine Viral Diarrhea Virus (BVDV) Glycoprotein 53 (g53) Gene

The bovine viral diarrhea g53 gene was cloned by a PCR cloning procedure essentially as described by Katz et al. (Journal of Virology 64: 1808-1811 (1990)) for the HA gene of human influenza. Viral RNA prepared from BVD virus Singer strain grown in MDBK cells was first converted to cDNA utilizing an oligonucleotide primer specific for the target gene. The cDNA was then used as a template for polymerase chain reaction (PCR) cloning (M. A. Innis et al., PCR Protocols: A Guide to Methods and Applications, 84-91, Academic Press, Inc. San Diego (1990)) of the targeted region. The PCR primers were designed to incorporate restriction sites which permit the cloning of the amplified coding regions into vectors containing the appropriate signals for expression in BAV-1. One pair of oligonucleotides were required for the coding region. The g53 gene coding region (amino acids 1-394) from the BVDV Singer strain (M. S. Collett et al., Journal of Virology 65, 200-208, (1988)) was cloned using the following primers: 5′-CTGGATCCTCATCCATACTGAGTCCCTGAGGCCTTCTGTTC-3′ [SEQ ID NO: 1] for cDNA priming and combined with 5′-CATAGATCTTGTGGTGCTGTCCGACTT CGCA-3′ [SEQ ID NO: 2] for PCR.

Western Blotting Procedure

Samples of lysates and protein standards were on a polyacrylamide gel according to the procedure of Laemnli, Nature 227, 680-685 (1970)). After gel electrophoresis the proteins were transferred and processed according to Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989). The primary antibody was a mouse monoclonal antibody (Mab 6.12.2 from Dubovi, Cornell University, Ithaca, N.Y.) diluted 1:100 with 5% non-fat dry milk in Tris-sodium chloride, and sodium Azide (TSA: 6.61g Tris-HCl, 0.97 g Tris-base, 9.0 g NaCl and 2.0 g Sodium Azide per liter H2O). The secondary antibody was a goat anti-mouse alkaline phosphatase conjugate diluted 1:1000 with TSA.

Plasmid 990-11

Plasmid 990-11 contains the Left and Right ends of the BAV-1 genome. These sequences were cloned by standard PCR methods (M. A. Innis, et al., PCR Protocols: A Guide To Methods And Applications, pp. 84-91, Academic Press, Inc., San Diego, Calif. (1990) using primers based on the sequences determined for the EcoR1 A and BamH1 F fragments respectively. Primers (1) 5′-3′ GGCCTTAATTAACATCATCAATAATA TACGGAACAC [SEQ ID NO: 5] and (2) 5′-3′ GGAAGATCTTGAGCATGCAGAGC AATTCACGCCGGGTAT [SEQ ID NO: 6] were used to PCR the Left end of BAV-1. Since three repetitive elements within this region shared the same 5′ end sequences (i. e. primer 1), 1760 bp, 1340 bp and 920 bp BAV-1 DNA fragments were amplified by PCR. The 920 bp DNA fragment was cloned into PCR-Blunt vector (Invitrogen, Carlsbad, Calif.). Primers (1) and (3) 5′-GGCAATGAGATCTTTTGGATGACAAGCTGAGCTACGCG-3′ [SEQ ID NO: 7] were used to PCR the Right end of BAV-1, 740 bp and 1160 bp PCR products were amplified and 1160 bp fragment DNA was cloned into pCR-Blunt vector (Invitrogen, Carlsbad, Calif.). Plasmid 990-11 was then constructed by cloning the BAV-1 end fragments into the polylinker of plasmid pPolyII (R. Lathe, J. L. Vilotte, and A. J. Clark, Gene, 57:193-201, 1997). The end fragments were cloned as a single PacI fragment containing a unique BglII site at their internal junction. Only the BamH1 and EcoR1 sites were retained from the polylinker.

Plasmid 990-50 (Adenoviral Backbone Vector)

Plasmid 990-50 was constructed according to the method described above (Construction of Recombinant BAV-1 Genomes in E. coli). Briefly, co-transformation of the BglII-linearized plasmid 990-11 and BAV-1 genomic DNA regenerated a stable circular plasmid containing the entire BAV-1 genome. In this plasmid PacI sites flank the inserted BAV-1 genomic sequences. As Pac is absent from BAV-1 genomic DNA, digestion with this enzyme allows the precise excision of the full-length BAV-1 genome from the plasmid 990-50.

Plasmid 996-80D

Plasmid 996-80D contains DNA encompassing approximately 5945 base pairs of the Right end of the BAV-1 genome from which the EcoR1 “G” and “H” fragments have been deleted and replaced with a synthetic SmaI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique SmaI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5′-CTGTAGATCTGCGGCCGCGTTTAAACGT CGACAAGCTTCCC-3′ [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1693 base pair PstI to EcoR1 sub fragment of the BAV-1 BamH1 “C” fragment (positions 28241 to 2993 from SEQ ID NO: 3). The synthetic linker sequence 5′-AATTCGAGCTCGCCCGGGCGAGCTCGA-3′ [SEQ ID NO: 9] is ligated to fragment 1 retaining EcoR1 sites at both ends of the linker sequence. Fragment 2 is an approximately 48 base pair EcoR1 to BamH1 restriction sub fragment of the BAV-1 BamH1 “C” fragment positions 31732 to 31779 from SEQ ID NO: 3). Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 “F” fragment positions 31780 to 34185 from SEQ ID NO: 3). The synthetic linker sequence 5′-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1004-73.16.14

Plasmid 1004-73.16.14 contains a recombinant BAV-1 genome from which the EcoR1 “G” and “H” fragments have been deleted and replaced by a synthetic SmaI site (5′-GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC-3′) [SEQ ID NO: 11]. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletion and gene insertions at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 996-80D and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1004-07.16

Plasmid 1004-07.16 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique SmaI site of plasmid 996-80D. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1004-40

Plasmid 1004-40 contains a recombinant BAV-1 genome from which the EcoR1 G and H fragments have been deleted, The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1004-17.16 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-14.2

Plasmid 1018-14.2 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by SalI and BamH1 sites (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. The plasmid was constructed for the purpose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique HindIII restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5′-CTGTAGATCTG CGGCCGCGTTTAAACG-3′ [SEQ ID NO: 12] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 2665 base pair SalI to SalI sub fragment (positions 22999 to 25663 from SEQ ID NO: 3) of the BAV-1 BamH1 B fragment. Fragment 1 is ligated to the upstream synthetic sequence retaining the SalI site at the junction. Fragment 1 contains a unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3). Fragment 1 is oriented such that the unique AvaI site is closer (406 base pairs) to fragment 2 than to the plasmid vector. The synthetic linker sequence 5′-TCGACAAGCTTCCC-3′ [SEQ ID NO: 13] is ligated to second end of fragment 1 again retaining the SalI site at the junction. Fragment 2 is an approximately 4223 base pair BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C fragment (positions 26851 to 31073 from SEQ ID NO: 3). Note that the end of both fragments were blunt end by treatment with T4 polymerase. The synthetic linker sequence 5′-CCCGGG AGTTTAAACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO. 14] is ligated between fragment 2 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the HindIII site is not retained. The BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1018-75

Plasmid 1018-75 contains a recombinant BAV-1 genome from which a specific region of the BamH1 “B” fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-14.2 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-23C15

Plasmid 1018-23C15 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique HindIII site of plasmid 1018-14.2. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1018-42

Plasmid 1018-42 contains a recombinant BAV-1 genome from which a specific region of the BamH1 “B” fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted. The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-23C15 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1018-45

Plasmid 1018-45 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by EcoR1 and BamH1 sites positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. The plasmid was constructed for the purpose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique HindIII restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The plasmid vector is derived from an approximately 2774 base pair HindIIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5′-CTGTAGATC TGCGGCCGCGTTTAACG-3′ [SEQ ID NO: 12] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1582 base pair SacI to EcoR1 sub fragment (positions 24183 to 25764 from SEQ ID NO: 3) of the BAV-1 BamH1 B fragment. Fragment 1 is ligated to the upstream synthetic sequence. The fragment was blunted end with T4 polymerase treatment so neither the SacI nor EcoR1 sites are retained. Fragment 1 contains a unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3). Fragment 1 is oriented such that the unique AvaI site is closer (406 base pairs) to fragment 2 than to the plasmid vector. The synthetic linker sequence 5′-CAAGCTTCCC-3′ [SEQ ID NO: 17] is ligated to second end of fragment 1 again retaining the SalI site at the junction. Fragment 2 is an approximately 4223 base pair BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C fragment positions 26851 to 31073 from SEQ ID NO: 3). Note that the end of both fragments were blunt end by treatment with T4 polymerase. The synthetic linker sequence 5′-CCCGG GAGTTTAAACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO: 14] is ligated between fragment 2 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the HindIII site is not retained. The BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1028-03

Plasmid 1028-03 contains a recombinant BAV-1 genome from which a specific region of the BamH1 “B” fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1018-45 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1028-77

Plasmid 1028-77 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, Calif.), into the unique HindIII site of plasmid 1018-45. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1038-16

Plasmid 1038-16 contains a recombinant BAV-1 The genome from which a specific region of the BamH1 “B” fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted. The gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1028-77 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1054-93

Plasmid 1054-93 contains DNA derived from the E4 region of BAV-1. The sequence corresponding to positions 33614 to 3375 fro SEQ ID NO: 3 has been deleted and replaced with a synthetic PstI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment, The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5′-CTGTAGATCTGCGG CCGCGTTTAAACGTCGACAAGCTTCCC-3′ [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment I is an approximately 3538 base pair PstI to BamHI sub fragment of the BAV-1 BamHI “C” fragment positions 28241 to 31779 from SEQ. ID NO.3. Fragment 1 is ligated to the 3′ end of the synthetic linker sequence [SEQ ID NO: 8]. Fragment 2 is an approximately 1832 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 31780 to 33613 from SEQ ID NO: 3). Fragment 2 is ligated to fragment 1 such that the BamHI site at the junction is retained. The synthetic linker sequence 5′-CTGCAG-3′ [SEQ ID NO: 4] is ligated to fragment 2. Fragment 3 is an approximately 460 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 33725 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3, end of the synthetic linker sequence 5′-CTGCAG-3′. The synthetic linker sequence 5′-GACTCTAGGGGCGGGGAGTTT AAACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1055-38

Plasmid 1055-38 contains DNA derived from the E4 region of BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic PstI site. The plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining DNA fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence 5′-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3′ [SEQ ID NO: 8] is ligated to the PvuII site of pSPM (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 28240 to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3′ end of the synthetic linker sequence indicated above [SEQ ID NO: 8]. The synthetic linker sequence 5′-CTGCAG-3′ [SEQ ID NO: 4] is ligated to fragment 1. Fragment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 30407 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated to the 3′ end of the synthetic linker sequence 5′-CTGCAG-3′ [SEQ ID NO: 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 “F” fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3′ end of fragment 2. The synthetic linker sequence 5′-GACTCTAGGGGCGGGGAGTTTTA AACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of SP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1055-52

Plasmid 1055-52 contains a recombinant BAV-1 genome from which a portion of the E4 region positions 29522-30407 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5-CTGCAG-3′) [SEQ ID NO: 4]. This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-38 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1055-47

Plasmid 1055-47 was constructed by inserting a BVDV g53 gene into the unique Pst1 site of plasmid 1055-38. The BVDV coding region was inserted in the reverse complimentary orientation such that it is transcribed by the E4 region promoter located at the right end of the genome. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 1055-56

Plasmid 1055-56 contains a recombinant BAV-1 genome from which the BAV-1\'s sequence from positions 29522 to 30407 [SEQ ID NO: 3] has been deleted. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-47 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1055-93

Plasmid 1055-93 contains DNA derived from the E4 region of BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic PstI site. Te plasmid was constructed for the purpose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique PstI restriction enzyme site into which foreign DNA may be inserted. The plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining DNA fragments from the following sources with the synthetic DNA sequences indicated. Note that fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment. The plasmid vector is derived from an approximately 2774 base pair HindIII to PvuII restriction fragment of pSP64 (Promega Corporation, Madison, Wis.). The synthetic linker sequence S′-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3′ [SEQ ID NO: 8] is ligated to the PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome positions 28240 to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3′ end of the synthetic linker sequence indicated above [SEQ ID NO: 8]. The synthetic linker sequence 5′-CTGCAG-3′ [SEQ ID NO: 4] is ligated to fragment 1. Fragment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 30403 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated to the 3′ end of the synthetic linker sequence 5′-CTGCAG-3′ [SEQ ID NO. 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1 “F” fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment 3 is ligated to the 3′ end of fragment 2. The synthetic linker sequence 5′-GACTCTAGGGGCGGG GAGTTTAAACGCGGCCGCAGATCTAGCT-3′ [SEQ ID NO: 10] is ligated between fragment 3 and the HindIII site of pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences can be cut out of this plasmid via the NotI restriction sites located in the flanking synthetic linker sequences.

Plasmid 1064-26

Plasmid 1064-26 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 33613 to 33725 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5′-CTGCAG-3′) [SEQ ID NO: 4]. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1054-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1066-29

Plasmid 1066-29 was constructed by inserting a BVDV g53 gene into the unique Pst1 site of plasmid 1055-93. The BVDV coding region was inserted in the reverse complimentary orientation such that it is transcribed by the E4 region promoter located at the right end of the genome. The BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).

Plasmid 106644

Plasmid 1066-44 contains a recombinant BAV-1 genome from which a portion of to the E4 region (positions 29523 to 30403 from SEQ ID NO: 3) has been deleted and replaced by a synthetic PstI site (5′-CTGCAG-3′) [SEQ ID NO: 4]. This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1055-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

Plasmid 1066-51

Plasmid 1066-51 contains a recombinant BAV-1 genome from which the BAV-1\'s sequence from positions 30403 to 29523 [SEQ ID NO: 3] has been deleted. The gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region. The plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived from the NotI insert of plasmid 1066-29 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the PvuI.

EXAMPLES Example 1 Sequence of BAV-1

By convention we will refer to the region containing the EcoR1 A fragment as the Left end of the BAV-1 genome. To complement the previously published restriction map (Maria Benko and B. Harrach, 1990 Acta Veterinaria Hungarica 38:281-284) other restriction enzyme sites in the BAV-1 genome were defined (PuvI, SmaI). The complete genome was cloned as several large restriction fragments. These included BamHI “B”, “C”, “D”, “F”, EcoR1 “A”, “E”, and PvuI “B”. The genome was also clone in its entirety as described above (Construction of Recombinant BAV-1 Genomes in E. coli). These clones and 126 different oligonucleotide primers were used according to the method described above (DNA Sequencing) to determine an over lapping sequence for the entire BAV-1 genome.

This sequence (34,185 base pairs ) contains 43 methionine initiated open reading frames (ORF) of greater than or equal to 110 amino acids (excluding smaller nested ORFs). All 43 ORFs were compared to the current version of the Genbank protein subset as described in the methods above (DNA Sequencing). Based on the BLAST analysis 28 of the ORFs (ORFS 1-28) exhibited significant homology to one or more other virus genes. Fifteen ORFs showed no significant homology to virus genes in the current version of Genbank (nORFs 1-15). Table 1 shows that the ORFs have a widely varying homology to adenovirus genes from several different species.

TABLE 1 BAV-1 Left end Open reading frames (Orf) % ORF* Location** Best Match to GenBank*** Similarity. ORF1 1400, 1867 BAV-2 E1A 49.5% ORF2 2189, 2656 BAV-2 E1B 58.6% ORF3 2566, 3777 SAV-3 E1B 42.3% ORF4 3838, 4185 BAV-2 Hexon 36.9% ORF5 RC 4197, 5315 HuAd-7 Maturation Protein 69.6% ORF6 RC 5285, 8530 BAV-2 Polymerase 72.9% ORF7 6255, 6680 HuAd-7 unknown protein 59.4% ORF8 RC  8527, 10185

Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Novel recombinant and mutant adenoviruses patent application.

Patent Applications in related categories:

20130122038 - Heterologous prime-boost immunization using measles virus-based vaccines - The invention provides reagents and methods for heterologous prime-boost immunization regimens. In particular, the invention provides reagents and methods for use in a paramyxovirus-based prime and adenovirus-based boost immunization system, wherein the immunization induces an immune response to a foreign antigen. ...


###
monitor keywords

Other recent patent applications listed under the agent :



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Novel recombinant and mutant adenoviruses or other areas of interest.
###


Previous Patent Application:
Novel recombinant and mutant adenoviruses
Next Patent Application:
Materials and methods for detecting, preventing, and treating retroviral infection
Industry Class:
Drug, bio-affecting and body treating compositions

###

FreshPatents.com Support - Terms & Conditions
Thank you for viewing the Novel recombinant and mutant adenoviruses patent info.
- - - AAPL - Apple, BA - Boeing, GOOG - Google, IBM, JBL - Jabil, KO - Coca Cola, MOT - Motorla

Results in 0.88699 seconds


Other interesting Freshpatents.com categories:
Qualcomm , Schering-Plough , Schlumberger , Texas Instruments , g2