FreshPatents.com Logo FreshPatents.com icons
Monitor Keywords Patent Organizer File a Provisional Patent Browse Inventors Browse Industry Browse Agents

3

views for this patent on FreshPatents.com
updated 05/24/2013


Inventor Store

    Free Services  

  • MONITOR KEYWORDS
  • Enter keywords & we'll notify you when a new patent matches your request (weekly update).

  • ORGANIZER
  • Save & organize patents so you can view them later.

  • RSS rss
  • Create custom RSS feeds. Track keywords without receiving email.

  • ARCHIVE
  • View the last few months of your Keyword emails.

  • COMPANY PATENTS
  • Patents sorted by company.

Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat   

pdficondownload pdfimage preview


Abstract: Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3′-untranslated region of CD154. ...


USPTO Applicaton #: #20090221673 - Class: 514 44 A (USPTO) - 09/03/09 - Class 514 
Related Terms: Dinucleotide   Untranslated Region   
view organizer monitor keywords


The Patent Description & Claims data below is from USPTO Patent Application 20090221673, Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat.

pdficondownload pdf

US 20090221673 A1 20090903 US 12064471 20060911 12 20060101 A
A
61 K 48 00 F I 20090903 US B H
20060101 A
C
12 N 5 00 L I 20090903 US B H
20060101 A
C
12 Q 1 68 L I 20090903 US B H
US 514 44 A 435375 435 6 Compositions and Methods for Regulating RNA Translation via CD154 CA-Dinucleotide Repeat US 60716708 00 20050913 Rigby William F. C.
Etna NH US
omitted US
LICATA & TYRRELL P.C.
66 E. MAIN STREET MARLTON NJ 08053 US
WO PCT/US06/35260 00 20060911 20080222

Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3′-untranslated region of CD154.

This application claims benefit of U.S. Provisional Patent Application Ser. No. 60/716,708, filed Sep. 13, 2005, the content of which is incorporated herein by reference in its entirety.

This invention was made in the course of research sponsored by the National Institutes of Health (NIH Grant No. AI34928). The U.S. government may have certain rights in this invention.

BACKGROUND OF THE INVENTION

The expression of CD154 (CD40 ligand), a member of the Tumor Necrosis Factor (TNF) gene family, by activated T lymphocytes is critical in the development of humoral and cell-mediated immunity (Foy, et al. (1996) Annu. Rev. Immunol. 14:591-617; Grewal & Flavell (1998) Ann. Rev. Immunol. 16:111-135; Hollenbaugh, et al. (1994) Immunol. Rev. 138:23-37; Noelle (1996) Immunity 4:415-419). CD154 blockade retards the development and progression of immune responses in an array of transplantation and autoimmune disease models ranging from Systemic Lupus Erythematosus to Rheumatoid Arthritis to Multiple Sclerosis (Foy, et al. (1996) supra; Grewal & Flavell (1998) supra). Resting T cells express little or no CD154 (Lane, et al. (1992) Eur. J. Immunol. 22:2573-2578; Nusslein, et al. (1996) Eur. J. Immunol. 26:846-850; Roy, et al. (1993) J. Immunol. 151:2497-2510) and signals (anti-CD3, mitogenic lectins) that trigger resting T cells to engage in high levels of proliferation and cytokine production, elicit little (CD4+ T cells) or no (CD8+ T cells) expression on either mouse or human T cells (Lane, et al. (1992) supra; Nusslein, et al. (1996) supra; Roy, et al. (1993) supra), suggesting different pathways of gene regulation. Maximal expression of CD154 requires pharmacologic stimulation provided by phorbol myristate acetate (PMA) and calcium ionophores such as ionomycin (Lane, et al. (1992) supra; Nusslein, et al. (1996) supra; Roy, et al. (1993) supra; Roy, et al. (1994) Eur. J. Immunol. 25:596-603). Cyclosporine and glucocorticoids block CD154 induction on T lymphocytes; these effects are presumed to be transcriptional (Fuleihan, et al. (1994) J. Clin. Invest. 93:1315-1320; Roy, et al. (1993) supra), based on the presence of NF-AT sites in the CD154 promoter (Schubert, et al. (1995) J. Biol. Chem. 15:29264-29627). Since cyclosporine and glucocorticoids also inhibit cytokine production (Ashwell, et al. (1992) Ann. Rev. Immunol. 18:309-345; Sigal & Dumont (1992) Ann. Rev. Immunol. 10:519-60), this pathway does not account for the differential regulation of CD154 expression by T lymphocytes.

CD154 mRNA has been shown to be unstable in activated T lymphocytes, with a half-life (˜30 minutes) approximating that seen with interleukins-2 (IL-2; Ford, et al. (1999) J. Immunol. 162:4037-4044; Murakami, et al. (1999) J. Immunol. 163:2667-2673; Rigby, et al. (1999) J. Immunol. 163:4199-4206; Suarez, et al. (1997) Eur. J. Immunol. 27:2822-2829). Nevertheless, several studies indicate that cytokine (IL-2 and TNF-alpha) and CD154 mRNA stability and expression are regulated through distinct pathways (Ford, et al. (1999) supra; Lindsten, et al. (1989) Science 244:339-343; Murakami, et al. (1999) supra). A region (nucleotides 468-835 referenced to the translational stop site) within the 986 nucleotide human CD154 3′-untranslated region (3′-UTR) confers an increase in the rate of mRNA turnover to chimeric reporter gene constructs in vivo (Hamilton, et al. (2003) Mol. Cell. Biol.; 23 (2):510-25). This region lacks canonical AURE-type sequences, containing a polypyrimidine rich element as well as CA-dinucleotide repeat and polycytidine sequences. Members of the human polypyrimidine tract binding protein (PTB) gene family were identified and shown to directly interact with cytidines and uridines within this region (Hamilton, et al. (2003) supra; Kosinski, et al. (2003) J. Immunol. 170(2):979-88), consistent with the presence of multiple PTB consensus binding sites (Anwar, et al. (2000) J. Biol. Chem. 275:34231-34235; Singh, et al. (1995) Science 268:1173-1176). Overexpression of splice isoforms of the PTB proteins differentially regulates CD154 expression and mRNA accumulation in a 3′-UTR-dependent manner in cell lines and normal human T cells. These effects are specific and restricted to reporter constructs containing the 3′-UTR polypyrimidine rich region.

The murine CD154 (mCD154) 3′-UTR is ˜0.3 kb shorter than its human counterpart, due to a 292 nucleotide insertion present at the 5′ end of the human 3′-UTR. The remaining portion of the human and entire mCD154 3′-UTR exhibits 70% conservation with retention of the polycytidine, polypyrimidine, and CA-dinucleotide repeat regions as well as an AURE that is found immediately 5′ of the polyadenylation signal sequence. Murine CD154 3′-UTR inhibits luciferase mRNA accumulation and protein activity in a comparable manner relative to that seen with the human CD154 3′-UTR. Further, deletion of the polypyrimidine-rich region cis-acting element enhances inhibition of 3′-UTR-dependent gene expression.

A novel pathway has now been identified which regulates translation and nuclear export of CD154 mRNA.

SUMMARY OF THE INVENTION

The present invention embraces methods for modulating the nuclear export or translation of a ribonucleic acid. The methods involve contacting a cell or tissue containing a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a ribonucleic acid with an agent that binds to the CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region or an agent which modulates the level or activity of an hnRNP L protein so that the nuclear export or translation of the ribonucleic acid is modulated.

The present invention also encompasses methods for preventing or treating a disease or condition associated with CD154-CD40 interactions. These methods involve administering to a subject in need of treatment an agent which binds to a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region or an agent which modulates the level or activity of hnRNP L protein so that CD154 translation is inhibited thereby preventing or treating the disease or condition associated with CD154-CD40 interactions.

The present invention further provides a method for identifying agents that modulate the level or activity of hnRNP L. This method of the invention involves contacting a test cell containing hnRNP L protein, and a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a nucleic acid encoding a reporter protein, with an agent and detecting reporter protein expression in the test cell. A decrease in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent increases the level or activity of hnRNP L in the cell. An increase in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent decreases the level or activity of hnRNP L in the cell.

These and other aspects of the present invention are set forth in more detail in the following description of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The human and murine CD154 3′-UTR are highly conserved, except for the presence of a 293 nucleotide insertion immediately after the translational stop site. Most notable are the presence of adjacent CU- and CA-rich regions. In addition, the murine CD154 3′-UTR contains polycytidine and AU-rich element sequences that are expanded relative to its human counterpart. The CA-rich region is of interest as it represents an extended series of CA-dinucleotide repeats, which are almost always intronic. Chimeric reporter gene constructs have indicated that a cis-acting element of the human CD154 3′-UTR maps to a region containing both the CU- and CA-rich domains. This effect was present in multiple cell lines (Jurkat, HeLa) as well as normal human T cells.

To delineate the mCD154 3′-UTR sequences involved in regulating CD154 expression, chimeric luciferase reporter gene constructs were generated and transiently transfected into HeLa cells. The presence of the mCD154 3′-UTR markedly reduced luciferase expression. Prior studies with the human CD154 3′-UTR indicate that cytoplasmic levels of PTB proteins regulate the function of this element. The binding specificity of PTB proteins, among other factors, indicate that the CU-rich domain is the major cis-acting element in the human CD154 3′-UTR. However, deletion of the CU-rich domain from mCD154 3′-UTR resulted in a decrease rather than an increase in luciferase activity. Deletion of the CA-rich domain provided a similar effect. Accordingly, both the CU- and CA-rich domains in the CD154 3′-UTR function as cis-acting elements.

To eliminate the possibility that deletion of either the CU- or CA-rich domains enhances the function of a secondary cis-acting element, both the CU- and CA-rich domains were deleted. This mutation increased luciferase activity to 171% of that seen with control. Superimposing mutation of the polycytidine (poly C) or ARE sequences in the context of deleting the CU and CA elements in the CD154 3′-UTR had no additional effect on luciferase expression. These data indicate that the CU- and CA-rich regions each function as cis-acting elements to regulate expression of CD154. An identical pattern was observed with transient transfection of human peripheral blood mononuclear cells (PBMC) under basal and activated conditions. Thus, the adjacent CU- and CA-rich regions are major regulatory elements in the CD154 3′-UTR while other candidate elements appear to lack activity.

Following transient transfection of HeLa cells, RNA was extracted and luciferase mRNA levels quantified by real-time RT-PCR. Deletion of either the CU- or the CA-rich region had no significant effect on steady-state mRNA levels. Deletion of both CU- and CA-rich regions increased luciferase mRNA expression. These data indicated that both the CU- and CA-rich regions regulated CD154 mRNA turnover. Using a HeLa TET-OFF™ system, identical constructs were generated containing either the CU- or CA-rich region. HeLa cells were transiently transfected overnight and transcription was inhibited by the addition of doxycycline. Cytoplasmic RNA was collected at time 0 and at various times thereafter. Luciferase mRNA levels measured by real-time RT-PCR indicated that at time 0, steady state levels of cytoplasmic luciferase mRNA were reduced by the presence of CD154 3′-UTR containing either the CU-rich regions. The presence of the mCD154 3′-UTR increased luciferase mRNA turnover relative to controls, as seen with the human 3′-UTR. Deletion of both CU- and CA-rich regions increased luciferase mRNA stability to that of controls. Luciferase mRNA lacking the CA-rich element exhibited increased mRNA turnover relative to controls, possibly due to the retained CU-rich region alone. Consistent with this, deletion of the CU-rich region alone exhibited decreased mRNA turnover, comparable to that seen with the control luciferase vector. These data indicate the role of the CU-rich region as a specific element that regulates cytoplasmic mRNA turnover, in the context of the mCD154 3′-UTR.

To determine how the CA-rich region reduces cytoplasmic mRNA levels in the absence of effects on mRNA stability, the contribution of other portions of the mCD154 3′-UTR were eliminated. Isolated CU-rich and/or CA-rich regions were cloned into the 3′-UTR of the pTRE vector and luciferase activity and mRNA turnover examined. The CU- and CA-rich regions alone were more effective in reducing luciferase activity than the entire CD154 3′-UTR. Expression of the region containing the CU and CA region alone reduced luciferase activity to the same degree. In contrast, the presence of either the CU- or CA-rich region suppressed luciferase activity to a greater degree than when both elements were present. This enhanced inhibitory effect of the isolated CU- or CA-rich elements was reflected by changes in steady-state levels of cytoplasmic luciferase mRNA relative to that seen with the construct containing both regions (i.e., CU/CA). Finally, while the CU/CA- and CU-rich regions alone mediated increased rates of luciferase mRNA turnover, the CA region alone appeared to markedly decrease cytoplasmic mRNA levels without altering its rate of degradation. This apparent effect was found to be due to the shortening of the poly(A) tail by the CA-dinucleotide repeat. Thus, the mCD154 3′-UTR contains two distinct cis-acting elements that reduce cytoplasmic mRNA accumulation, one through increased mRNA turnover, the other by reducing translation, at least in part, by shortening the poly(A) tail. Moreover, while these elements are functionally distinct, they clearly interact to regulate their activity and function.

Experiments were performed to characterize, purify and identify the protein(s) binding to and regulating expression of CD154 via the CA-dinucleotide rich sequence. The RNA binding protein, hnRNP L was found to specifically interact with this CA-dinucleotide rich sequence and inhibit reporter protein expression. It was found that when hnRNP L was bound to the CA-dinucleotide rich sequence, translation of the CD154 mRNA into CD154 protein was inhibited. Thus, when cytoplasmic levels of hnRNP L are low, CD154 mRNA is translated more efficiently and increased surface expression of CD154 results. Moreover, it was observed that PTB proteins and hnRNP L directly interact.

These data demonstrate the existence of a novel pathway of mRNA turnover regulation. Additionally, these data indicate that the polymorphic nature of CA-dinucleotide repeats in CD154 3′-UTR may influence CD154 expression and immune responses. The presence of CA-dinucleotide repeats could influence mRNA biogenesis both at the level of splicing and mRNA stability. Further, the relative levels of cytoplasmic hnRNP L appear to be regulated by specific stimuli and modulating the levels of hnRNP L could be used as a means of modulating the expression of CD154 at the level of translation and nuclear export. Accordingly, inhibiting CD154 expression at the level of hnRNP L expression or activity or the CA-dinucleotide repeat is useful in autoimmune and inflammatory diseases, whereas enhancing expression of CD154 by targeting this pathway could be used in immunotherapy of cancer or for augmenting immune responses in immunodeficient individuals. Moreover, soluble CD154 derived from platelets has been associated with both acute coronary syndromes as well as increased risk for cardiovascular disease. Thus, targeting hnRNP L or the CA-dinucleotide repeat may be useful in treatment of acute and chronic atherosclerotic disease including angina, myocardial infarction, stroke and other conditions of acute or chronic vascular insufficiency.

Thus, the present invention embraces methods of modulating nuclear export or translation of a ribonucleic acid molecule operatively-linked to a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region using an agent which binds to the CA-dinucleotide rich sequence or which modulates the level or activity of an hnRNP L protein so that the nuclear export or translation of the ribonucleic acid is modulated. Operatively-linked is intended to mean that the ribonucleic acid is linked to the CA-dinucleotide rich sequence in a manner which allows for translation of the ribonucleic acid molecule to be regulated by the CA-dinucleotide rich sequence, i.e., the ribonucleic acid molecule and CA-dinucleotide sequence are located on the same transcript.

As used herein, the CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region (3′-UTR) is located between nucleotides 468 to 835 of the human CD154 3′-UTR cDNA relative to the translational stop site; i.e., within the BstNI-HphI restriction enzyme fragment of the 3′-UTR. This region is set forth herein as SEQ ID NO:1:

(SEQ ID NO: 1) CAGGCTCTAGAACGTCTAACACAGTGGAGAACCGAAACCCCCCCCCCCCC CCCCGCCACCCTCTCGGACAGTTATTCATTCTCTTTCAATCTCTCTCTCT CCATCTCTCTCTTTCAGTCTCTCTCTCTCAACCTCTTTCTTCCAATCTCT CTTTCTCAATCTCTCTGTTTCCCTTTGTCAGTCTCTTCCCTCCCCCAGTC TCTCTTCTCTCCCCCTTTCTAACACACACACACACACACACACACACACA CACACACACACACACACACACACACACACACACACAGAGTCAGGCCGTTG CTAGTCAGTTCTCTTCTTTCCACCCTGTCCCTATCTCTACCACTATAGAT GAGGGTGAGGAGTAG,

wherein the CA-dinucleotide repeat is underlined.

Methods of modulating or regulating translation of an RNA molecule operatively-linked to a CA-dinucleotide repeat of a CD154 3′-UTR encompass both enhancing and inhibiting the translation of said RNA molecule. Binding of an agent, e.g., an siRNA or hnRNP L (GENBANK Accession No. NP001005335 or NP001524) to the CA-dinucleotide repeat or increasing the expression or activity of hnRNP L via an agent results in inhibition of translation of the RNA molecule. Conversely, decreasing the expression or activity of hnRNP L via an agent (e.g., an siRNA) enhances translation of the RNA molecule. Effects on translation of the RNA can be determined using standard techniques such as western blot analysis of the translated product of the RNA sequence, or if the protein being translated is an enzyme, enzymatic assays can be performed. In particular embodiments, the ribonucleic acid molecule encodes CD154. As such, binding of an agent to the CA-dinucleotide repeat or increasing the level or activity of hnRNP L by pharmacological agents is contemplated as a useful tool in the treatment of autoimmune and inflammatory diseases which are associated with CD154-CD40 interactions, whereas decreasing the level or activity of hnRNP L by pharmacological agents is contemplated as a useful tool in the treatment of, e.g., cancer, wherein CD40 activation by CD154 is advantageous.

Thus, the present invention also encompasses methods for preventing or treating a disease or condition associated with B cell CD154-CD40 interactions, i.e., diseases or conditions resulting from enhanced CD40 activation by CD154, or diseases or conditions associated with lack of CD40 activation by CD154. The methods involve administering to a subject in need of treatment an agent which binds to a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region or an agent that increases the level or activity of hnRNP L protein so that CD154 translation is inhibited thereby preventing or treating the disease or condition associated with CD40 activation by CD154. Diseases or conditions which can be prevented or treated in accordance with the instant method, include, but are not limited to, allograft rejection; allergy (including anaphylaxis); atherosclerosis including angina, myocardial infarction, stroke and other conditions of chronic or acute vascular insufficiency; autoimmune conditions including drug-induced lupus, systemic lupus erythematosus, adult rheumatoid arthritis, juvenile rheumatoid arthritis, scleroderma, Sjogren's Syndrome, etc.; and viral diseases that involve B-cells, including Epstein-Barr infection, cancer, and retroviral infection including infection with a human immunodeficiency virus. Because it has been suggested that B cell activation is associated with the induction of human immunodeficiency virus replication from latency, it may be desirable to decrease translation of CD154 mRNA in HIV positive individuals who have not yet developed AIDS or ARC.

In particular embodiments, the subject is a primate, such as a human. In other embodiments, the subject is a mammal of commercial importance, or a companion animal or other animal of value. Thus, subjects also include, but are not limited to, sheep, horses, cattle, goats, pigs, dogs, cats, rabbits, guinea pigs, hamsters, rats and mice.

It is contemplated that the agent can be administered as a capsule, intramuscularly, intraperitoneally, subcutaneously, intradermally or applied locally to a wound site. It is also clear that the invention can be used with a skin graft procedure. The skin is a notoriously difficult tissue with which to achieve or maintain engraftment. A preferred route of administration for treating or preventing skin graft rejection is topical, subdermal, intradermal or subcutaneous, though systemic and other routes are also contemplated.

Another route of administration for skin graft includes direct application locally (by topical application, immersion or bath, or local injection) into the subject tissue bed, or to the graft tissue itself. High local concentrations of the agent, particularly in areas of lymphatic drainage, are expected to be particularly advantageous. Alternatively, the graft tissue can be transfected or transformed with a recombinant expression vector to overexpress hnRNP L.

An effective amount of an agent which binds to a CA-dinucleotide rich sequence of the CD154 mRNA 31-untranslated region or an agent that alters the level or activity of hnRNP L protein is an amount which decreases or inhibits the signs or symptoms of diseases or conditions associated with CD40 activation (e.g., edema, fever, and loss of graft function) and will be dependent on the nature of the agent.

Agents useful in accordance with the methods provided herein include, but are not limited to, purified hnRNP L protein, a recombinant expression vector expressing hnRNP L, a recombinant expression vector expressing an siRNA which binds the CA-dinucleotide repeat or hnRNP L RNA, organic molecules, biomolecules including peptides, antibodies, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

An isolated or purified protein hnRNP L protein for administrating PTB or PTB-T proteinadministration to a cell or tissue can be produced by various means. An isolated or purified protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the hnRNP L protein is derived. To be substantially free of cellular material includes preparations of hnRNP L protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. When the hnRNP L protein is recombinantly produced, it is also preferably substantially free of culture medium.

Recombinant production of hnRNP L protein typically involves generating a fusion protein such as a GST-hnRNP L in which the hnRNP L protein sequence is fused to the C-terminus of the GST sequence. Such fusion proteins can facilitate the purification of recombinant hnRNP L protein. Alternatively, the fusion protein is a hnRNP L protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression and/or secretion of hnRNP L protein can be increased through use of a heterologous signal sequence. Preferably, a hnRNP L chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. Alternatively, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers or PCR amplification. PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which are subsequently annealed and reamplified to generate a chimeric gene sequence (see, e.g., Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A hnRNP L-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the hnRNP L protein.

A recombinant expression vector contains a nucleic acid encoding hnRNP L in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively-linked to the nucleic acid to be expressed. Within a recombinant expression vector, operatively-linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell). A regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel (1990) Methods Enzymol. 185:3-7. Regulatory sequences include those which direct constitutive expression of a nucleic acid sequence in many types of host cells and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by one of skill in the art that the design of the expression vector depends on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vector can be introduced into a host cell to thereby produce proteins or peptides of hnRNP L, isoforms of hnRNP L, mutant forms of hnRNP L, fusion proteins, and the like.

A recombinant expression vector can be designed for expression of hnRNP L protein in prokaryotic or eukaryotic cells. For example, hnRNP L proteins can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel (1990) supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve to increase expression of recombinant protein; increase the solubility of the recombinant protein; and aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include PGEX (Pharmacia Biotech Inc; Smith and Johnson (1988) Gene 67:31-40), PMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann, et al., (1988) Gene 69:301-315) and pET ld (Studier, et al. (1990) Methods Enzymol. 185:60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET lid vector relies on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is supplied by host strains BL21 (DE3) or HMS174 (DE3) from a resident prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.

A yeast expression vector is also contemplated. Examples of vectors for expression in yeast Saccharomyces cerevisiae include pYepSec 1 (Baldari, et al. (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz, et al. (1987) Gene 54:113-123), pYES2 (INVITROGEN™ Corp., San Diego, Calif.), and picZ (INVITROGEN™ Corp., San Diego, Calif.).

Alternatively, hnRNP L protein can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf9 cells) include the pAc series (Smith, et al. (1983) Mol. Cell. Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39).

Further, nucleic acid molecules encoding hnRNP L are expressed in mammalian cells using a mammalian expression vector. As will be appreciated by one of skill in the art, hnRNP L expression in mammalian cells provides a means of purifying the proteins as well as a means of modulating the endogenous levels of hnRNP L protein in a cell. Examples of mammalian expression vectors include any one of the well-known recombinant viral vectors, pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman, et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

The recombinant mammalian expression vector may further be capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji, et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund, et al. (1985) Science 230:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and EP 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the α-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).

In addition to increasing the expression of hnRNP L to modulate the levels of hnRNP L present in the cell, hnRNP L expression can be decreased to modulate the levels of hnRNP L present in the cell. Thus, a recombinant expression vector harboring a nucleic acid encoding hnRNP L, or an iRNA target sequence thereof, cloned into the expression vector in an antisense orientation is also provided. That is, the nucleic acid encoding hnRNP L, or a target fragment thereof, is operatively-linked to a regulatory sequence in a manner which allows for expression (by transcription of the nucleic acid sequence) of an RNA molecule which is antisense to hnRNP L mRNA. Regulatory sequences operatively-linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue-specific or cell type-specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, et al. (1986) Reviews-Trends in Genetics Vol. 1 (1).

Host cells into which a hnRNP L nucleic acid can be introduced, e.g., a hnRNP L nucleic acid within a vector (e.g., a recombinant expression vector) or a hnRNP L nucleic acid containing sequences which allow it to homologously recombined into a specific site of the host cell's genome, are further contemplated. The terms host cell and recombinant host cell are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms transformation and transfection are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. supra and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the nucleic acid of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a hnRNP L protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die). A host cell, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) an hnRNP L protein.

The host cells can also be used to produce non-human transgenic animals. For example, a host cell is a fertilized oocyte or an embryonic stem cell into which hnRNP L-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous hnRNP L sequences have been introduced into their genome or homologous recombinant animals in which endogenous hnRNP L sequences have been altered. Such animals are useful for studying the function and/or activity of a hnRNP L protein and for identifying and/or evaluating modulators of hnRNP L activity. As used herein, a transgenic animal is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a homologous recombinant animal is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous hnRNP L gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.

A transgenic animal can be created by introducing a hnRNP L-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection or retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Alternatively, a non-human homologue of a human hnRNP L gene, such as a rat or mouse hnRNP L gene, can be used as a transgene. Intronic sequences and polyadenylation signals may also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operatively-linked to a hnRNP L transgene to direct expression of a hnRNP L protein to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866; 4,870,009; 4,873,191; and in Hogan, Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of a hnRNP L transgene in its genome and/or expression of hnRNP L mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding a hnRNP L protein can further be bred to other transgenic animals carrying other transgenes.

To create a homologous recombinant animal, a vector is prepared which contains at least a portion of a hnRNP L gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the hnRNP L gene. The hnRNP L gene can be a human gene or a non-human homologue of a human hnRNP L gene. For example, a mouse hnRNP L gene can be used to construct a homologous recombination nucleic acid molecule, e.g., a vector, suitable for altering an endogenous hnRNP L gene in the mouse genome. The homologous recombination nucleic acid molecule may be designed such that, upon homologous recombination, the endogenous hnRNP L gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a knock out vector). Alternatively, the homologous recombination nucleic acid molecule can be designed such that, upon homologous recombination, the endogenous hnRNP L gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous hnRNP L protein). In the homologous recombination nucleic acid molecule, the altered portion of the hnRNP L gene is flanked at its 5′ and 3′ ends by additional nucleic acid sequence of the hnRNP L gene to allow for homologous recombination to occur between the exogenous hnRNP L gene carried by the homologous recombination nucleic acid molecule and an endogenous hnRNP L gene in a cell, e.g., an embryonic stem cell or fetal fibroblast. The additional flanking hnRNP L nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5′ and 3′ ends) are included in the homologous recombination nucleic acid molecule (see, e.g., Thomas and Capecchi (1987) Cell 51:503). The homologous recombination nucleic acid molecule is introduced into a cell, e.g., an embryonic stem cell line, by for example electroporation, and cells in which the introduced hnRNP L gene has homologously recombined with the endogenous hnRNP L gene are selected (see, e.g., Li, et al. (1992) Cell 69:915). The selected cells can then be injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley, In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, E. J. ed. (IRL, Oxford, 1987) pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination nucleic acid molecules, e.g., vectors, or homologous recombinant animals are well-known (see, e.g., Bradley (1991) Current Opin. Biotechnol. 2:823-829; WO 90/11354; WO 91/01140; WO 92/0968; and WO 93/04169.

A method for identifying an agent that modulates the level or activity of hnRNP L is also encompassed by the instant invention. The method involves contacting a test cell containing hnRNP L protein, and a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a nucleic acid encoding a reporter protein, with an agent and detecting reporter protein expression in the test cell. A decrease in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent increases the level or activity of hnRNP L in the cell. Conversely, an increase in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent decreases the level or activity of hnRNP L in the cell. Test cells expressing a reporter which can be used in accordance with the method of the invention are, in certain embodiments, mammalian cells including human cells.

The reporter gene sequence(s) can be inserted into a recombinant expression vector according to methods disclosed herein. More than one reporter gene can be inserted into the construct such that the test cells containing the resulting construct can be assayed by different means. The test cells which contain the nucleic acid encoding the reporter and which express the reporter can be identified by at least four general approaches; detecting DNA-DNA or DNA-RNA hybridization; observing the presence or absence of marker gene functions (e.g., resistance to antibiotics); assessing the level of transcription as measured by the expression of reporter mRNA transcripts in the host cell; and detecting the reporter gene product as measured by immunoassay or by its biological activity.

The test cells can be cultured under standard conditions of temperature, incubation time, optical density, plating density and media composition corresponding to the nutritional and physiological requirements of the cells. However, conditions for maintenance and growth of the test cell can be different from those for assaying candidate test compounds in the screening methods of the invention. Modified culture conditions and media are used to facilitate detection of the expression of a reporter molecule. Any techniques known in the art can be applied to establish the optimal conditions.

A reporter gene refers to any genetic sequence that is detectable and distinguishable from other genetic sequences present in test cells. Desirably, the reporter nucleic acid encodes a protein that is readily detectable either by its presence, or by its activity that results in the generation of a detectable signal. A nucleic acid encoding the reporter is used in the invention to monitor and report the translation of an RNA operatively-linked to a CA-dinucleotide rich sequence of a CD154 3′-untranslated region in test cells.

A variety of enzymes can be used as reporters including, but are not limited to, β-galactosidase (Nolan, et al. (1988) Proc. Natl. Acad. Sci. USA 85:2603-2607), chloramphenicol acetyltransferase (CAT; Gorman, et al. (1982) Molecular Cell Biology 2:1044; Prost, et al. (1986) Gene 45:107-111), β-lactamase, β-glucuronidase and alkaline phosphatase (Berger, et al. (1988) Gene 66:1-10; Cullen, et al. (1992) Methods Enzymol. 216:362-368). Transcription of the reporter gene leads to production of the enzyme in test cells. The amount of enzyme present can be measured via its enzymatic action on a substrate resulting in the formation of a detectable reaction product. The methods of the invention provide means for determining the amount of reaction product, wherein the amount of reaction product generated or the remaining amount of substrate is related to the amount of enzyme activity. For some enzymes, such as β-galactosidase, β-glucuronidase and β-lactamase, well-known fluorogenic substrates are available that allow the enzyme to covert such substrates into detectable fluorescent products.

A variety of bioluminescent, chemiluminescent and fluorescent proteins can also be used as light-emitting reporters in the invention. Exemplary light-emitting reporters, which are enzymes and require cofactor(s) to emit light, include, but are not limited to, the bacterial luciferase (luxAB gene product) of Vibrio harveyi (Karp (1989) Biochim. Biophys. Acta 1007:84-90; Stewart, et al. (1992) J. Gen. Microbiol. 138:1289-1300), and the luciferase from firefly, Photinus pyralis (De Wet, et al. (1987) Mol. Cell. Biol. 7:725-737).

Other types of light-emitting reporter, which do not require substrates or cofactors, are wild-type green fluorescent protein (GFP) of Victoria aequoria (Chalfie, et al. (1994) Science 263:802-805), modified GFPs (Heim, et al. (1995) Nature 373:663-4; WO 96/23810), and the gene products encoded by the Photorhabdus luminescens lux operon (luxABCDE) (Francis, et al. (2000) Infect. Immun. 68(6):3594-600). Transcription and translation of these types of reporter genes leads to the accumulation of the fluorescent or bioluminescent proteins in test cells, which can be measured by a device, such as a fluorimeter, flow cytometer, or luminometer. Methods for performing assays on fluorescent materials are well-known in the art (e.g., Lackowicz, 1983, Principles of Fluorescence Spectroscopy, New York, Plenum Press).

For convenience and efficiency, enzymatic reporters and light-emitting reporters are desirable for the screening assays of the invention. Accordingly, the invention encompasses histochemical, calorimetric and fluorometric assays. An exemplary reporter construct, exemplified herein, contains the CA-dinucleotide rich sequence of a CD154 3′-untranslated region which regulates the translation of and therefore the expression of the reporter luciferase.

By way of illustration, a screening assay of the invention can be carried out by culturing a test cell containing a nucleic acid encoding luciferase operatively-linked to a CA-dinucleotide rich sequence of a CD154 3′-untranslated region; adding a test agent to a point of application, such as a well, in the plate and incubating the plate for a time sufficient to allow the test agent to effect luciferase mRNA translation; detecting luminescence of the test cells contacted with the test agent, wherein luminescence indicates expression of the luciferase polypeptide in the test cells; and comparing the luminescence of test cells not contacted with the test agent. A decrease in luminescence of the test cell contacting the test agent relative to the luminescence of test cells not contacting the test agent indicates that the test agent causes a decrease in the level or activity of hnRNP L. An increase in luminescence of the test cell contacting the test agent relative to the luminescence of test cells not contacting the test agent indicates that the test agent causes an increase in the level or activity of hnRNP L.

Agents which can be screened using the method provided herein encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Agents encompass functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The agents often contain cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Agents can also be found among biomolecules including peptides, antibodies, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Agents are obtained from a wide variety of sources including libraries of natural or synthetic compounds.

A variety of other reagents such as salts and neutral proteins can be included in the screening assays. Also, reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, and the like can be used. The mixture of components can be added in any order that provides for the requisite binding.

Alternatively, antibodies against the hnRNP L can serve as the agent to inhibit (antagonize) or stimulate (agonize) hnRNP L activity. Whole hnRNP L or an epitope bearing fragment thereof can be used as an immunogen to produce antibodies immunospecific for hnRNP L. Various techniques well-known in the art can be used routinely to produce antibodies (Kohler and Milstein (1975) Nature 256:495-497; Kozbor, et al. (1983) Immunol. Today 4:72; Cole, et al. (1985) In: Monoclonal Antibodies and Cancer Therapy, pp 77-96).

What is claimed is: 1. A method for inhibiting the nuclear export or translation of a ribonucleic acid comprising contacting a cell or tissue containing a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a ribonucleic acid with an agent which binds to the CA-dinucleotide rich sequence so that the nuclear export or translation of the ribonucleic acid is inhibited. 2. A method for modulating the nuclear export or translation of a ribonucleic acid comprising contacting a cell or tissue containing a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a ribonucleic acid with an agent which modulates the level or activity of an hnRNP L protein so that the nuclear export or translation of the ribonucleic acid is modulated. 3. A method for preventing or treating a disease or condition associated with CD154-CD40 interactions comprising administering to a subject in need of treatment an agent which binds to a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region so that CD154 translation is inhibited thereby preventing or treating the disease or condition associated with CD154-CD40 interactions. 4. A method for preventing or treating a disease or condition associated with CD154-CD40 interactions comprising administering to a subject in need of treatment an agent which modulates the level or activity of hnRNP L protein so that the disease or condition associated with CD154-CD40 interactions is prevented or treated. 5. A method for identifying agents that modulate the level or activity of hnRNP L comprising contacting a test cell containing hnRNP L protein, and a CA-dinucleotide rich sequence of the CD154 mRNA 3′-untranslated region operatively-linked to a nucleic acid encoding a reporter protein, with an agent and detecting reporter protein expression in the test cell, wherein a decrease in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent increases the level or activity of hnRNP L in the cell, and an increase in reporter protein expression in the test cell contacted with the agent relative to reporter protein expression in a test cell not contacted with the agent, indicates that the agent decreases the level or activity of hnRNP L in the cell. 6. An agent identified by the method of claim 5.


Download full PDF for full patent description/claims.




You can also Monitor Keywords and Search for tracking patents relating to this Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat patent application.

Patent Applications in related categories:

20130123327 - Combined use of prame inhibitors and hdac inhibitors - The invention relates to the cancer antigen PRAME (PReferentially expressed Antigen in MElanoma) and its use in a method of treatment of a tumour which comprises administering to a subject in need of treatment an effective amount of an inhibitor of PRAME, in combination with a second agent selected from ...

20130123332 - Compositions and methods for inhibiting expression of mylip/idol gene - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the Mylip/Idol gene, and methods of using such dsRNA compositions to inhibit expression of Mylip/Idol. ...

20130123339 - Compositions and methods for silencing apolipoprotein b - The present invention provides compositions and methods for the delivery of interfering RNAs such as siRNAs that silence APOB expression in cells such as liver cells. In particular, the nucleic acid-lipid particles provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells such as ...

20130123340 - Compositions and methods for the treatment and prevention of cardiac ischemic injury - Disclosed herein are compositions and methods for the treatment and/or prevention of pathological conditions associated with ischemia/reperfusion injury and/or hypoxic injury of myocardial cell or tissue. ...

20130123330 - Dual targeted sirna therapeutics for treatment of diabetic retinopathy and other ocular neovascularization diseases - The present invention relates to compositions and methods for treating diabetic retinopathy and other ocular neovascularization diseases. In one embodiment, the composition comprises at least two different siRNA duplexes and a pharmaceutically acceptable carrier. One of the duplexes binds to an mRNA molecule that encodes VEGF, and the other binds ...

20130123335 - Idh1 and idh2 mutations in cholangiocarcinoma - This document relates to methods and materials involved in assessing isocitrate dehydrogenase 1 (IDH1) or isocitrate dehydrogenase 2 (IDH2) mutations in a mammal (e.g., human). For example, this document provides methods and materials for diagnosis, characterization, determining prognosis, and treatment of cholangiocarcinoma tumor in a mammal. ...

20130123344 - Method of preventing or treating viral infection - wherein R1, R2, R3, R4, and R5 are as defined herein or pharmaceutically acceptable salts thereof. Also disclosed is a method of preventing or treating a viral infection of a host, comprising administering to the host an effective amount of an inhibitor of the JMJD2 family of histone demethylases, for ...

20130123345 - Method of treating a viral infection dysfunction by disrupting an adenosine receptor pathway - Described herein is a method of treating a viral infection such as an influenza infection, in a subject comprising administering an effective amount of a pharmaceutical composition to disrupt a adenosine receptor pathway, such as the Aradenosine receptor pathway, in a subject. The adenosine receptor pathway includes the steps of ...

20130123342 - Methods and compositions for the specific inhibition of kras by asymmetric double-stranded rna - This invention relates to compounds, compositions, and methods useful for reducing KRAS target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA) agents possessing asymmetric end structures. ...

20130123328 - Methods and compositions for treating cancer - We describe a method of determining whether a cancer cell is likely to be resistant to treatment by an mTOR inhibitor. The method may comprise detecting PPP2R2B (GenBank Accession Number: NM_18167) in or of the cell. It may, alter-natively, or in addition, comprise detecting PDK1 (GenBank Accession Number: NM_002613), in ...

20130123343 - Methods for reverting methylation by targeting methyltransferase and compositions useful therefor - Methods for restoring a desired pattern of DNA methylation, inducing re-expression of methylation-silenced tumor suppressor genes (TSGs), and/or inhibiting tumorigenicity both in vitro and in vivo in a subject in need thereof by administering an effective amount of one or more miR-29s sufficient to target one or more of DNMT3A ...

20130123341 - Methods, compositions and kits for diagnosing and treating alzheimer's disease using mitochondrial co3 gene mutations - Methods and kits are provided for diagnosing, prognosing and treating Alzheimer's disease (AD) by identifying heteroplasmic mitochondrial mutations in cytochrome c oxidase subunit 3 (CO3). The methods are efficient, economical, and rapid, for diagnosis, prognosis and subsequent early treatment of AD in subjects. ...

20130123329 - Microrna compositions and methods - Provided herein are compositions comprising oligomeric compounds. In certain embodiments, the oligomeric compounds are useful as miRNA mimics. The oligomeric compounds may mimic the activity of miR-34. Also provided herein are methods for the treatment of cancer. ...

20130123331 - Modulation of diacylglycerol acyltransferase 2 expression - Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 2. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 2. Methods of using these compounds for modulation of diacylglycerol acyltransferase 2 expression and for diagnosis and treatment of diseases and conditions associated with expression ...

20130123338 - Novel cationic lipids and methods of use thereof - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present ...

20130123334 - Novel sirna structures - The invention relates to siRNA compounds possessing novel sequences and structural motifs which down-regulate the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity ...

20130123333 - Nucleic acid functionalized nanoparticles for therapeutic applications - Materials and methods for regulating gene expression using nanoparticles functionalized with antisense oligonucleotides are provided. ...

20130123336 - Polyplexes of hydrophobically-modified sirna for delivery of sirna - The present invention provides compositions and methods for delivering nucleic acid molecules to a cell. ...

20130123337 - Rnai inhibition of serum amyloid a for treatment of glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. ...


###
monitor keywords

Other recent patent applications listed under the agent :



Keyword Monitor How KEYWORD MONITOR works... a FREE service from FreshPatents
1. Sign up (takes 30 seconds). 2. Fill in the keywords to be monitored.
3. Each week you receive an email with patent applications related to your keywords.  
Start now! - Receive info on patent apps like Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat or other areas of interest.
###


Previous Patent Application:
Biomarker for prostate cancer
Next Patent Application:
Compositions and methods for therapy and diagnosis of cancer
Industry Class:
Drug, bio-affecting and body treating compositions

###

FreshPatents.com Support - Terms & Conditions
Thank you for viewing the Compositions and methods for regulating rna translation via cd154 ca-dinucleotide repeat patent info.
- - - AAPL - Apple, BA - Boeing, GOOG - Google, IBM, JBL - Jabil, KO - Coca Cola, MOT - Motorla

Results in 0.77502 seconds


Other interesting Freshpatents.com categories:
Celera Genomics , Cingular Wireless , Colgate-Palmolive , Corning , g2