Site News  |   Monitor Keywords  |   Monitor Archive  |   Organizer  |   Account Info  |

Detection of a genetic predisposition to cancers and non-cancerous pathologies in mammals

Detection of a genetic predisposition to cancers and non-cancerous pathologies in mammals description/claims

This application is a Divisional of U.S. Serial No. U.S. Ser. No. 10/341,550, filed Jan. 13, 2003, which claims priority to provisional patent application Ser. No. 60/347,757, filed on Jan. 11, 2002, the specification of which is incorporated by reference herein.

Breeding practices over the years have inadvertently promoted and sustained a rather large number of genetic diseases, e.g., cancer and urinary system disorders, in cats and other animals (Vella et al., 1999). For example, several million domestic cats in the U.S. are predisposed to developing urinary system disorders, e.g., congenital urinary tract defects, polycystic kidney disease, neoplasia, renal failure, interstitial cystitis, urocystolithiasis, obstructions in the urethra or other parts of the urinary system, and urinary incontinence (Lekcharoensuk et al, 2001). Moreover, the ubiquitous mixed breed cat known as the domestic short hair and especially one of its parent breeds, the Siamese, have high cancer incidence rates with multiple malignancies occurring in relatively young cats (Vella et al., 1993; Hayes et al., 1981). The tumors seen-in these breeds of cats are often sarcomas of soft tissues and bone. Before spaying of female kittens became a common practice, mammary tumors were the most common type of malignancy in cats (Ogilve and Moore, 1995).

Over the past decade, the incidence of sarcomas in cats has risen sharply with the mandatory administration of vaccines that commonly produce pronounced inflammatory reactions (Hendrick and Goldschmidt, 1991; Hendrick et al., 1992; Kass et al., 1993; Doddy et al., 1996; Banerji et al., 2001; Macy and Hendrick, 1996). While malignant transformation at injection sites has been documented in humans and other species, vaccine associated feline sarcoma (VAFS) has emerged as a serious problem in feline medicine with as many as ten-thirteen of every 10,000 vaccine injections leading to tumor formation (Macy and Hendrick, 1996; Marmelzat, 1968; Archampong and Clark, 1970). Since more than 53 million pet cats are administered one or more vaccines each year, a sizeable number of cats are at risk of developing the disease.

Diagnosing diseases in animals is not always an easy task. There are many examples of cases where the pets are treated repeatedly without resolution of the symptoms. In such cases, knowledge of a genetic predisposition to disease, e.g., cancer, VAFS, or a disorder of various organs such as the urinary system, endocrine system or cardiac disorder would indicate the possibility of disease development in the animal. Knowledge of disease predisposition in an animal would be extremely important in making treatment and management decisions. For example, certain treatment options may be less beneficial or even harmful to an animal predisposed to developing a disease such as cancer, VAFS, or a disorder of the urinary system. Regarding cancer, the availability and use of radiation therapy for treatment of cancers is increasing. This otherwise beneficial treatment may induce additional tumors in cancer-predisposed individuals. As for VAFS, cats that are predisposed to developing sarcomas at vaccination sites may benefit from special care and vaccination protocols during their lifetimes. Exposure to known physical, chemical or biological carcinogens could be eliminated or reduced and the individuals could be maintained on controlled diets. Routine visits to the veterinarian would include special attention to visible or palpable masses and other symptoms of possible disease development. Moreover, animals that are found to be predisposed to developing diseases or disorders of the urinary, cardiac, or endocrine systems are also likely to benefit from special care, diet, and medication during their lifetimes. In addition to preventive health maintenance, a simple genetic test would enable breeders to identify carriers and avoid mating animals that are susceptible to developing disease. Analysis of the incidence of a biomarker, e.g., a predisposing allele, in registered cats of various breeds would allow breeders to choose amongst cats without the disease-associated marker for perpetuating and improving the health of these breeds.

Thus, what is needed is a test for a molecular biomarker(s) that would allow pet owners and veterinarians to make informed decisions. What is needed is a test for detecting the predisposition of an individual to a disease such as cancer, e.g., VAFS, and/or the predisposition to a non-cancerous pathology including a disorder of the urinary, cardiac, and/or endocrine system. What is also needed is a diagnostic kit for such a test.

The inventor has discovered an association between a molecular biomarker with the predisposition to the development of various diseases and/or disorders in a mammal, such as a domestic cat. In one embodiment of the invention, the molecular biomarker is an allele of feline p53 that is located on chromosome E1. There are known polymorphisms in intron 7 of feline p53, as indicated in the following sequence: 5′-gtagggacccgca(c/t)gccaccctgccccaggccactctctcccgtgctaccgcccatcccgcctgtggaatccccg cctgtggaatctcctctgctgtcccccaccctccgcctccaagttttcttttctctggcttgggaccttctcttacccggcttc tcgatactccttaggcttttaggctccacataggatgaaggaggtggggagtaaggggggccccatctccctcactgcct ccagcTTctgtcttctta(c/t)gtgggtag-3′ (SEQ ID NO: 16).

The allele described herein contains an intronic alteration in intron 7 of p53, the alteration being a single thymidine (T) nucleotide insertion. To illustrate, the corresponding non-altered p53 allele sequence contains two Ts at nucleotide positions 246-247 of SEQ ID NO: 16 (as indicated above by capitalization). The alteration-containing allele contains Ts at positions 246, 247 and 248 in intron 7 of p53, as indicated below: 5′-gtagggacccgcacgccaccctgccccaggccactctctcccgtgctaccgcccatcccgcctgtggaatccccgcct gtggaatctcctctgctgtcccccaccctccgcctccaagttttcttttctctggctttgggaccttctcttacccggcttctcg atactccttaggcttttaggctccacataggatgaaggaggtggggagtaaggggggccccatctccctcactgcctcc agcTTTctgtcttcttacgtgggtag-3′ (SEQ ID NO:14, which is also GenBank Accession Number AF175762).

Using the methods described herein, the susceptibility to a disease or disorder, i.e., the predisposition to the disease or disorder, can be detected in a mammal, e.g., a cat. In certain embodiments of the invention, the susceptibility to diseases such as cancer, for example, sarcomas of the soft tissues and bone (including fibrosarcoma, malignant fibrous histiocytoma, angiosarcoma, chondrosarcoma, liposarcoma, neurofibrosarcoma, schwannoma, lymphosarcoma, osteosarcoma), mast cell tumors, carcinomas (including squamous cell carcinoma, adenocarcinoma), melanoma, leukemias, myelomas, dedifferentiated tumor types and disseminated cancers, as well as tumors of specific organ systems (including endocrine organs such as the thyroid and adrenals, mammary glands, musculo-skeletal system, integumentary system, lymphatic system, etc.), and/or vaccine-associated feline sarcomas (VAFS) can be detected. In one embodiment, the cancer is a sarcoma or VAFS. In other embodiments of the invention, the susceptibility in a mammal to a non-cancerous pathology is detected. Non-cancerous pathologies include cardiac disease, disorders of the urinary system, and disorders of the endocrine system. “Cardiac disease” refers to any disease, disorder or condition of the cardiac system that is manifested by cardiac abnormalities or cardiac dysfunction, for example, that can lead to heart failure. For example, cardiac diseases include cardiomyopathy, hypertrophic cardiomyopathy, acute aortic regurgitation, tricuspid stenosis, constrictive pericarditis, acute infective endocarditis, ischemic heart disease, hypertension, primary myocardial disease, valvular disease, pericardial disease, arteriovenous fistula, Paget's disease, as well as heart murmur, valvular-associated murmur, valvular lesion and cardiac lesion. By “urinary system disorder” is meant, for example, congenital urinary tract defects, polycystic kidney disease, neoplasia, renal failure, interstitial cystitis, urocystolithiasis, obstructions in the urethra or other parts of the urinary system, and urinary incontinence. “Endocrine system disorder” refers to conditions of the adrenal gland or thyroid gland, such as nodules on the thyroid gland or hype-rthyroidism.

In addition, methods and reagents for the detection and analysis of molecular biomarker, e.g., marker allele(s) of p53, which are associated with disease and/or disorder predisposition are described, and rapid methods for the detection of the predispositions have been developed and tested.

One embodiment of the invention provides detecting the susceptibility to cancer in a mammal, which method involves obtaining a biological sample from the mammal and detecting a molecular biomarker in the sample, wherein the molecular biomarker is a p53 allele with an alteration at position 246, 247 or 248 in SEQ ID NO:14 as compared to positions 246-247 in SEQ ID NO:16. The alteration can be a substitution, a deletion or an insertion, for example, an insertion of thymidine. The mammal can be, for example, a feline, such as a domestic cat. A “biological sample” refers to a sample of material that is to be tested for the presence of the molecular biomarker, e.g., a polynucleotide having the altered p53 allele described herein. The biological sample can be obtained from an organism, e.g., it can be a physiological sample, such as a blood sample, a tissue sample, or a mouth swab. Ordinarily, the biological sample will contain DNA including p53. The molecular biomarker can be detected by contacting the sample with a nucleic acid segment selected from SEQ ID NOs:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. Once identified, the biomarker can be detected by methods generally known to the art, see, for example, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y. (2001). By way of illustration, the biomarker can be detected by employing PCR, for example, allele-specific PCR, PCR-RFLP analysis, as well as by allele-specific hybridization, sequencing, etc.

Further provided is a method of detecting the susceptibility to a non-cancerous pathology in a mammal, involving obtaining a biological sample from the mammal and detecting a molecular biomarker in the sample, wherein the molecular biomarker is indicative of susceptibility in the mammal. For example, the molecular biomarker can be p53. The p53 can be detected by contacting the sample with a nucleic acid segment selected from SEQ ID NOs:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. The alteration in the p53 can be one corresponding to positions 246, 247 or 248 of SEQ ID NO:14, as compared to positions 246-247 of SEQ ID NO:16. The alteration can be a substitution, a deletion or an insertion, such as an insertion of a thymidine. The non-cancerous pathology can be a urinary disorder; an endocrine system disorder, such as an adrenal gland disorder or a thyroid disorder, e.g., hyperthyroidism or thyroid gland nodules; or cardiac disease such as cardiomyopathy, heart valve dysfunction, heart murmur, valvular-associated murmur, cardiac lesion or a valvular lesion. In a particular embodiment, the mammal is a feline, such as a domestic cat.

The invention further provides a method of detecting the susceptibility to vaccine-associated feline sarcoma (VAFS) in a cat, which method involves obtaining a biological sample from the cat and detecting a molecular biomarker in the sample, wherein the molecular biomarker is indicative of VAFS susceptibility in the cat.

The invention further provides a method of detecting the susceptibility to cancer in a cat, which method involves obtaining a biological sample from the cat and detecting a molecular biomarker in the sample, wherein the molecular biomarker is a p53 allele comprising an alteration at positions 246, 247 and 248 of SEQ ID NO:14 as compared to position 246-247 of SEQ ID NO:16, wherein the molecular biomarker is indicative of cancer susceptibility in the cat.

Further provided is a method of detecting the susceptibility to a urinary disorder in a cat, which method involves obtaining sample from the cat and detecting a molecular biomarker in the sample, wherein the molecular biomarker is a p53 allele comprising an alteration at positions 246, 247 and 248 of SEQ ID NO:14 as compared to position 246-247 of SEQ ID NO:16, wherein the molecular biomarker is indicative of susceptibility to the disorder in the cat.

Further provided are diagnostic kits for detecting the susceptibility to cancer in a mammal; for detecting the susceptibility to a urinary disorder in a mammal; and for detecting the susceptibility to VAFS in a cat, which kits include packaging, containing a primer that specifically detects an alteration at position 246, 247 or 248 of SEQ ID NO:14 as compared to position 246-247 of SEQ ID NO:16. In one embodiment of the kit, the primer consists of SEQ ID Nos: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13. In addition to the primers described herein, the term “primer” refers to any primer that is capable of specifically detecting a molecular biomarker as described herein.

• Provisional Patent
• Utility Patent

• What Is a Patent?
• What Is a Trademark or Servicemark?
• What Is a Copyright?
• Patent Laws